Rational Design of Cyclodextrin Glycosyltransferase with Improved Hesperidin Glycosylation Activity
Abstract
1. Introduction
2. Results
2.1. Selection of Mutagenesis Sites and Rational Design
2.2. Library Construction and Screening
3. Discussions
4. Materials and Methods
4.1. Materials, Plasmids, and Strains
4.2. Structure Modeling and Rational Design
4.3. Preparation of Mutant Libraries
4.4. Screening of Positive Mutants
4.5. Kinetic Analysis
4.6. Molecular Dynamic Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Garg, A.; Garg, S.; Zaneveld, L.J.D.; Singla, A.K. Chemistry and pharmacology of the citrus bioflavonoid hesperidin. Phytother. Res. 2001, 15, 655–669. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wilmsen, P.K.; Spada, D.S.; Salvador, M. Antioxidant activity of the flavonoid hesperidin in chemical and biological systems. J. Agric. Food. Chem. 2005, 53, 4757–4761. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Parhiz, H.; Roohbakhsh, A.; Soltani, F.; Rezaee, R.; Iranshahi, M. Antioxidant and anti-inflammatory properties of the citrus flavonoids hesperidin and hesperetin: An updated review of their molecular mechanisms and experimental models. Phytother. Res. 2015, 29, 323–331. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Devi, K.P.; Rajavel, T.; Nabavi, S.F.; Setzer, W.N.; Ahmadi, A.; Mansouri, K.; Nabavi, S.M. Hesperidin: A promising anticancer agent from nature. Ind. Crops Prod. 2015, 76, 582–589. [Google Scholar] [CrossRef] [Scilit]
- Al-Ishaq, R.K.; Abotaleb, M.; Kubatka, P.; Kajo, K.; Büsselberg, D. Flavonoids and their anti-diabetic effects: Cellular mechanisms and effects to improve blood sugar levels. Biomolecules 2019, 9, 430. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Hasegawa, J.; Kitamura, Y.; Wang, Z.; Matsuda, A.; Shinoda, W.; Miura, N.; Kimura, K. Effects of hesperidin on the progression of hypercholesterolemia and fatty liver induced by high-cholesterol diet in rats. J. Pharmacol. Sci. 2011, 117, 129–138. [Google Scholar] [CrossRef] [Scilit]
- Li, C.; Schluesener, H. Health-promoting effects of the citrus flavanone hesperidin. Crit. Rev. Food Sci. Nutr. 2017, 57, 613–631. [Google Scholar] [CrossRef] [Scilit]
- Stanisic, D.; Liu, L.H.; Dos Santos, R.V.; Costa, A.F.; Durán, N.; Tasic, L. New sustainable process for hesperidin isolation and anti-ageing effects of hesperidin nanocrystals. Molecules 2020, 25, 4534. [Google Scholar] [CrossRef] [Scilit]
- Mayneris-Perxachs, J.; Alcaide-Hidalgo, J.M.; de la Hera, E.; del Bas, J.M.; Arola, L.; Caimari, A. Supplementation with biscuits enriched with hesperidin and naringenin is associated with an improvement of the Metabolic Syndrome induced by a cafeteria diet in rats. J. Funct. Foods 2019, 61, 103504. [Google Scholar] [CrossRef] [Scilit]
- Valls, R.M.; Pedret, A.; Calderón-Pérez, L.; Llaurado, E.; Pla-Pagà, L.; Companys, J.; Moragas, A.; Martín-Luján, F.; Ortega, Y.; Giralt, M.; et al. Hesperidin in orange juice improves human endothelial function in subjects with elevated blood pressure and stage 1 hypertension: A randomized, controlled trial (Citrus study). J. Funct. Foods 2021, 85, 104646. [Google Scholar] [CrossRef] [Scilit]
- Wdowiak, K.; Walkowiak, J.; Pietrzak, R.; Bazan-Woźniak, A.; Cielecka-Piontek, J. Bioavailability of Hesperidin and Its Aglycone Hesperetin—Compounds Found in Citrus Fruits as a Parameter Conditioning the Pro-Health Potential (Neuroprotective and Antidiabetic Activity)—Mini-Review. Nutrients 2022, 14, 2647. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Anwer, M.K.; Al-Shdefat, R.; Jamil, S.; Alam, P.; Abdel-Kader, M.S.; Shakeel, F. Solubility of bioactive compound hesperidin in six pure solvents at (298.15 to 333.15) K. J. Chem. Eng. Data 2014, 59, 2065–2069. [Google Scholar] [CrossRef] [Scilit]
- Kometani, T.; Terada, Y.; Nishimura, T.; Takii, H.; Okada, S. Transglycosylation to hesperidin by cyclodextrin glucanotransferase from an alkalophilic Bacillus species in alkaline pH and properties of hesperidin glycosides. Biosci. Biotechnol. Biochem. 1994, 58, 1990–1994. [Google Scholar] [CrossRef] [Scilit]
- Choi, S.S.; Lee, S.H.; Lee, K.A. A comparative study of hesperetin, hesperidin and hesperidin glucoside: Antioxidant, anti-inflammatory, and antibacterial activities in vitro. Antioxidants 2022, 11, 1618. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, Y.S.; Woo, J.B.; Ryu, S.I.; Moon, S.K.; Han, N.S.; Lee, S.B. Glucosylation of flavonol and flavanones by Bacillus cyclodextrin glucosyltransferase to enhance their solubility and stability. Food Chem. 2017, 229, 75–83. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yamada, M.; Tanabe, F.; Arai, N.; Mitsuzumi, H.; Miwa, Y.; Kubota, M.; Chaen, H.; Kibata, M. Bioavailability of glucosyl hesperidin in rats. Biosci. Biotechnol. Biochem. 2006, 70, 1386–1394. [Google Scholar] [CrossRef] [Scilit]
- Janecek, Š.; Svensson, B.; MacGregor, E. α-Amylase: An enzyme specificity found in various families of glycoside hydrolases. Cell. Mol. Life Sci. 2014, 71, 1149–1170. [Google Scholar] [CrossRef] [Scilit]
- Lombard, V.; Golaconda Ramulu, H.; Drula, E.; Coutinho, P.M.; Henrissat, B. The carbohydrate-active enzymes database (CAZy) in 2013. Nucleic Acids Res. 2014, 42, D490–D495. [Google Scholar] [CrossRef] [Scilit]
- Zhou, J.; Jiang, R.; Shi, Y.; Ma, W.; Liu, K.; Lu, Y.; Zhu, L.; Chen, X. Sucrose phosphorylase from Lactobacillus reuteri: Characterization and application of enzyme for production of 2-O-α-d-glucopyranosyl glycerol. Int. J. Biol. Macromol. 2022, 209, 376–384. [Google Scholar] [CrossRef] [Scilit]
- Zhou, Y.; Gan, T.; Jiang, R.; Chen, H.; Ma, Z.; Lu, Y.; Zhu, L.; Chen, X. Whole-cell catalytic synthesis of 2-O-α-glucopyranosyl-l-ascorbic acid by sucrose phosphorylase from Bifidobacterium breve via a batch-feeding strategy. Process Biochem. 2022, 112, 27–34. [Google Scholar] [CrossRef] [Scilit]
- Yu, S.; Wang, Y.; Tian, Y.; Xu, W.; Bai, Y.; Zhang, T.; Mu, W. Highly efficient biosynthesis of α-arbutin from hydroquinone by an amylosucrase from Cellulomonas carboniz. Process Biochem. 2018, 68, 93–99. [Google Scholar] [CrossRef] [Scilit]
- Marié, T.; Willig, G.; Teixeira, A.R.; Gazaneo Barboza, E.; Kotland, A.; Gratia, A.; Courot, E.; Hubert, J.; Renault, J.H.; Allais, F. Enzymatic synthesis of resveratrol α-glycosides from β-cyclodextrin-resveratrol complex in water. ACS Sustain. Chem. Eng. 2018, 6, 5370–5380. [Google Scholar] [CrossRef] [Scilit]
- Moon, S.S.; Lee, H.J.; Mathiyalagan, R.; Kim, Y.J.; Yang, D.U.; Lee, D.Y.; Min, J.W.; Jimenez, Z.; Yang, D.C. Synthesis of a novel α-glucosyl ginsenoside F1 by cyclodextrin glucanotransferase and its in vitro cosmetic applications. Biomolecules 2018, 8, 142. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, H.; Liu, Y.; Ren, X.; Wang, J.; Zhu, L.; Lu, Y.; Chen, X. Engineering of Cyclodextrin Glycosyltransferase through a Size/Polarity Guided Triple-Code Strategy with Enhanced α-Glycosyl Hesperidin Synthesis Ability. Appl. Environ. Microbiol. 2022, 88, e01027-22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hur, S.; Bruice, T.C. The near attack conformation approach to the study of the chorismate to prephenate reaction. Proc. Natl. Acad. Sci. USA 2003, 100, 12015–12020. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barlow, K.A.; Conchúir, S.Ó.; Thompson, S.; Suresh, P.; Lucas, J.E.; Heinonen, M.; Kortemme, T. Flex ddG: Rosetta ensemble-based estimation of changes in protein–protein binding affinity upon mutation. J. Phys. Chem. B 2018, 122, 5389–5399. [Google Scholar] [CrossRef] [Scilit]
- Uitdehaag, J.; Mosi, R.; Kalk, K.H.; van der Veen, B.A.; Dijkhuizen, L.; Withers, S.G.; Dijkstra, B.W. X-ray structures along the reaction pathway of cyclodextrin glycosyltransferase elucidate catalysis in the α-amylase family. Nat. Struct. Biol. 1999, 6, 432–436. [Google Scholar] [CrossRef] [Scilit]
- Szejtli, J. Past, Present and future of cyclodextrin research. Pure Appl. Chem. 2004, 76, 1825–1845. [Google Scholar] [CrossRef] [Scilit]
- González-Alfonso, J.L.; Míguez, N.; Padilla, J.D.; Leemans, L.; Poveda, A.; Jiménez-Barbero, J.; Ballesteros, A.O.; Sandoval, G.; Plou, F.J. Optimization of regioselective α-glucosylation of hesperetin catalyzed by cyclodextrin glucanotransferase. Molecules 2018, 23, 2885. [Google Scholar] [CrossRef] [Scilit]
- Han, R.; Liu, L.; Shin, H.D.; Chen, R.R.; Du, G.; Chen, J. Site-saturation engineering of lysine 47 in cyclodextrin glycosyltransferase from Paenibacillus macerans to enhance substrate specificity towards maltodextrin for enzymatic synthesis of 2-O-D-glucopyranosyl-L-ascorbic acid (AA-2G). Appl. Microbiol. Biotechnol. 2013, 97, 5851–5860. [Google Scholar] [CrossRef] [Scilit]
- Tao, X.; Wang, T.; Su, L.; Wu, J. Enhanced 2-O-α-d-glucopyranosyl-l-ascorbic acid synthesis through iterative saturation mutagenesis of acceptor subsite residues in Bacillus stearothermophilus NO2 cyclodextrin glycosyltransferase. J. Agric. Food. Chem. 2018, 66, 9052–9060. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, R.; Chai, B.; Jiang, Y.; Ni, J.; Ni, Y. Engineering of cyclodextrin glycosyltransferase from Paenibacillus macerans for enhanced product specificity of long-chain glycosylated sophoricosides. Mol. Catal. 2022, 519, 112147. [Google Scholar] [CrossRef] [Scilit]
- Ara, K.Z.G.; Linares-Pastén, J.A.; Jönsson, J.; Viloria-Cols, M.; Ulvenlund, S.; Adlercreutz, P.; Karlsson, E.N. Engineering CGTase to improve synthesis of alkyl glycosides. Glycobiology 2021, 31, 603–612. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pokala, N.; Handel, T.M. Protein design—Where we were, where we are, where we’re going. J. Struct. Biol. 2001, 134, 269–281. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Smith, C.A.; Kortemme, T. Backrub-like backbone simulation recapitulates natural protein conformational variability and improves mutant side-chain prediction. J. Mol. Biol. 2008, 380, 742–756. [Google Scholar] [CrossRef] [Scilit]
- Lodola, A.; Mor, M.; Zurek, J.; Tarzia, G.; Piomelli, D.; Harvey, J.N.; Mulholland, A.J. Conformational effects in enzyme catalysis: Reaction via a high energy conformation in fatty acid amide hydrolase. Biophys. J. 2007, 92, L20–L22. [Google Scholar] [CrossRef] [Scilit]
- Romero-Téllez, S.; Cruz, A.; Masgrau, L.; González-Lafont, À.; Lluch, J.M. Accounting for the instantaneous disorder in the enzyme–substrate Michaelis complex to calculate the Gibbs free energy barrier of an enzyme reaction. Phys. Chem. Chem. Phys. 2021, 23, 13042–13054. [Google Scholar] [CrossRef] [Scilit]
- Wijma, H.J.; Floor, R.J.; Bjelic, S.; Marrink, S.J.; Baker, D.; Janssen, D.B. Enantioselective enzymes by computational design and in silico screening. Angew. Chem. Int. Ed. 2015, 54, 3726–3730. [Google Scholar] [CrossRef] [Scilit]
- Ohdan, K.; Kuriki, T.; Takata, H.; Okada, S. Cloning of the cyclodextrin glucanotransferase gene from alkalophilic Bacillus sp. A2-5a and analysis of the raw starch-binding domain. Appl. Microbiol. Biotechnol. 2000, 53, 430–434. [Google Scholar] [CrossRef] [Scilit]
- Huang, J.; MacKerell, A.D., Jr. CHARMM36 all-atom additive protein force field: Validation based on comparison to NMR data. J. Comput. Chem. 2019, 34, 2135–2145. [Google Scholar] [CrossRef] [Scilit]




| Enzyme | Relative Activity (%) | Specific Transglycosylation Activity (U/g) |
|---|---|---|
| WT | 100 | 134.4 7.0 |
| Y217F | 671.6 | 916.6 22.2 |
| S211T/Y217F | 574.2 | - |
| Y217F/K254V | 458.1 | - |
| Y217F/K254L | 684.1 | 478.3 20.7 |
| Y217F/K254H | 575.6 | - |
| Y217F/H255S | 16.3 | - |
| Y217F/H255L | 89.4 | - |
| Y217F/H255F | 41.4 | - |
| Y217F/F281M | 333.1 | - |
| Y217F/F281Y | 743.3 | 805.6 6.3 |
| Y217F/F281R | 68.2 | - |
| Y217F/F281H | 157.9 | - |
| Y217F/M351T | 402.5 | - |
| Y217F/M351F | 774.5 | 1194.7 12.5 |
| Y217F/M351L | 791.8 | 1126.1 6.4 |
| Y217F/M351A | 287.5 | - |
| Y217F/M351Y | 547.0 | - |
| Y217F/M351H | 238.0 | - |
| Y217F/N392V | 533.8 | - |
| Y217F/N392M | 474.4 | - |
| Y217F/D393H | 716.4 | 1306.4 21.6 |
| Enzyme | kcat (min−1) | KmA (Hesperidin) (g/L) | KmB (Maltodextrin) (g/L) | kcat/KmA (L/g·min) |
|---|---|---|---|---|
| WT | 0.47 | 6.52 | 0.92 | 0.07 |
| Y217F | 4.85 | 10.86 | 2.11 | 0.45 |
| Y217F/M351F | 11.58 | 16.43 | 6.48 | 0.71 |
| Y217F/M351L | 16.31 | 26.42 | 4.87 | 0.62 |
| Y217F/D393H | 14.74 | 13.87 | 2.84 | 1.06 |
| Mutants | Average Distances during 10 ns Simulation (Å) | |
|---|---|---|
| O4 and Cα | H4 and OE2 in E279 | |
| Y217F | 0.832 | 0.686 |
| Y217F/M351F | 0.540 | 0.645 |
| Y217F/M351L | 0.531 | 0.444 |
| Y217F/D393H | 0.729 | 0.634 |
| Primers | Sequence (5′−3′ Direction) xxx: Mutation Site | Target Mutation (Codon) | |||||
|---|---|---|---|---|---|---|---|
| S211-R | aatctgtttgatctggcggattacgatctg | T | |||||
| S211-F | cgccagatcaaacagattgcggtaaatxxxatcctcata | ggt | |||||
| K254-R | ttgatggcattcgcgtggatgcggttxxxcacatgagcgaag | V | L | H | |||
| K254-F | tccacgcgaatgccatcaatgcctttgtcca | gtg | cat | ctg | |||
| H255-R | gaaggctggcagactagcctgatgagcgatatt | S | L | F | |||
| H255-F | gctagtctgccagccttcgctcatxxxtttaac | gct | cag | gaa | |||
| F281-R | agcggcgaagttgatccgcagaaccatcat | M | Y | R | H | ||
| F281-F | cggatcaacttcgccgctgcccagxxxccattc | cat | ata | gcg | atg | ||
| M351-R | agcggcgaagttgatccgcagaaccatcat | T | F | L | A | Y | H |
| M351-F | gctctgttcaaagctaaagcggctxxxgtcatggtt | cgt | gaa | cag | cgc | ata | atg |
| N392-R | gaaaaccgcaaaccgatgagcgattttgat | V | M | ||||
| N392-F | tcatcggtttgcggttttccggatcxxxgccgcccgtcagat | cac | cat | ||||
| D393-R | gaaaaccgcaaaccgatgagcgattttgat | H | |||||
| D393-F | atcggtttgcggttttccggxxxattgccgcccgtcagata | atg | |||||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, H.; Wang, J.; Liu, Y.; Chen, Y.; Wang, C.; Zhu, L.; Lu, Y.; Chen, X. Rational Design of Cyclodextrin Glycosyltransferase with Improved Hesperidin Glycosylation Activity. Catalysts 2023, 13, 885. https://doi.org/10.3390/catal13050885
Chen H, Wang J, Liu Y, Chen Y, Wang C, Zhu L, Lu Y, Chen X. Rational Design of Cyclodextrin Glycosyltransferase with Improved Hesperidin Glycosylation Activity. Catalysts. 2023; 13(5):885. https://doi.org/10.3390/catal13050885
Chicago/Turabian StyleChen, Hanchi, Jiajun Wang, Yi Liu, Yongfan Chen, Chunfeng Wang, Linjiang Zhu, Yuele Lu, and Xiaolong Chen. 2023. "Rational Design of Cyclodextrin Glycosyltransferase with Improved Hesperidin Glycosylation Activity" Catalysts 13, no. 5: 885. https://doi.org/10.3390/catal13050885
APA StyleChen, H., Wang, J., Liu, Y., Chen, Y., Wang, C., Zhu, L., Lu, Y., & Chen, X. (2023). Rational Design of Cyclodextrin Glycosyltransferase with Improved Hesperidin Glycosylation Activity. Catalysts, 13(5), 885. https://doi.org/10.3390/catal13050885

