Gremlin-1 Promotes Colorectal Cancer Cell Metastasis by Activating ATF6 and Inhibiting ATF4 Pathways
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Lines and Culture
2.2. Lentivirus Production and Infection
2.3. RNA-Seq and Gene Set Enrichment Analysis (GSEA)
2.4. qRT-PCR
2.5. Western Blot Analysis
2.6. Invasion Assay
2.7. Wound Healing Assay
2.8. Animal Experiments
2.9. Immunohistochemistry
2.10. Statistical Analysis
3. Results
3.1. The GREM1 Level Is Associated with Poor Prognosis of CRC
3.2. GREM1 Promotes Invasion, Migration and ER Stress of CRC Cells
3.3. ER Stress Activator Tunicamycin Inhibits Invasion and Migration of CRC
3.4. GREM1 Promotes CRC Invasion and Migration through Activating ATF6 but Inhibiting the ATF4 Signaling Pathways
3.5. GREM1 Modulates ATF4 and ATF6 via Inhibiting BMP and Activating VEGF-VEGFR2-PI3K-AKT Signaling Pathways
3.6. Effects of GREM1, GSK621 and CeapinA7 on CRC Metastasis In Vivo
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
| Gene | qRT-PCR forward Primer (5′-3′) | qRT-PCR Reversed Primer (5′-3′) |
|---|---|---|
| GREM1 | CTGCTGAAGGGAAAA AGAA | GATGGATATGCAACGACACT |
| E-cadherin | ATTTTTCCCTCGACACCCGAT | TCCCAGGCGTAGACCAAGA |
| ZEB-1 | CGAGTCAGATGCAGAAAATGAGCAA | ACCCAGACTGCGTCACATGTCTT |
| ZO-1 | AGGCGGATGGTGCTACAAGTGA | AGAGGACCGTGTAATGGCAGACT |
| Snail | TCGGAAGCCTAACTACAGCGA | AGATGAGCATTGGCAGCGAG |
| Vimentin | AGTCCACTGAGTACCGGAGAC | CATTTCACGCATCTGGCGTTC |
| β-Catenin | GAGTGCTGAAGGTGCTATCTGTCTG | TTCTGAACAAGACGTTGACTTGGA |
| Hspa5 (BiP) | GACGGGCAAAGATGTCAGGA | GCCCGTTTGGCCTTTTCTAC |
| ATF4 | ATGACCGAAATGAGCTTCCTG | GCTGGAGAACCCATGAGGT |
| ATF6 | AGCAGCACCCAAGACTCAAAC | GCATAAGCGTTGGTACTGTCTGA |
| IRE1a | AGTATGTGGAGCAGAAGGAC | GTTGTGTGGCTTTAGGTCTC |
| GAPDH | GATTTGGTCGTATTGGGCG | TGGAAGATGGTGATGGGAT |
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Poturnajova, M.; Furielova, T.; Balintova, S.; Schmidtova, S.; Kucerova, L.; Matuskova, M. Molecular features and gene expression signature of metastatic colorectal cancer. Oncol. Rep. 2021, 45, 10. [Google Scholar] [CrossRef] [Scilit]
- Miller, K.D.; Nogueira, L.; Mariotto, A.B.; Rowland, J.H.; Yabroff, K.R.; Alfano, C.M.; Jemal, A.; Kramer, J.L.; Siegel, R.L. Cancer treatment and survivorship statistics, 2019. CA Cancer J. Clin. 2019, 69, 363–385. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xiang, Q.; Hong, D.; Liao, Y.; Cao, Y.; Liu, M.; Pang, J.; Zhou, J.; Wang, G.; Yang, R.; Wang, M.; et al. Overexpression of Gremlin1 in Mesenchymal Stem Cells Improves Hindlimb Ischemia in Mice by Enhancing Cell Survival. J. Cell. Physiol. 2017, 232, 996–1007. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zuniga, A.; Laurent, F.; Lopez-Rios, J.; Klasen, C.; Matt, N.; Zeller, R. Conserved cis-regulatory regions in a large genomic landscape control SHH and BMP-regulated Gremlin1 expression in mouse limb buds. BMC Dev. Biol. 2012, 12, 23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gazzerro, E.; Smerdel-Ramoya, A.; Zanotti, S.; Stadmeyer, L.; Durant, D.; Economides, A.N.; Canalis, E. Conditional deletion of gremlin causes a transient increase in bone formation and bone mass. J. Biol. Chem. 2007, 282, 31549–31557. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Church, R.H.; Ali, I.; Tate, M.; Lavin, D.; Krishnakumar, A.; Kok, H.M.; Hombrebueno, J.R.; Dunne, P.D.; Bingham, V.; Goldschmeding, R.; et al. Gremlin1 plays a key role in kidney development and renal fibrosis. Am. J. Physiol. Ren. Physiol. 2017, 312, F1141–F1157. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.Q.; Wan, L.Y.; He, X.M.; Ni, Y.R.; Wang, C.; Liu, C.B.; Wu, J.F. Gremlin1 Accelerates Hepatic Stellate Cell Activation Through Upregulation of TGF-Beta Expression. DNA Cell Biol. 2017, 36, 603–610. [Google Scholar] [CrossRef] [Scilit]
- Lavoz, C.; Alique, M.; Rodrigues-Diez, R.; Pato, J.; Keri, G.; Mezzano, S.; Egido, J.; Ruiz-Ortega, M. Gremlin regulates renal inflammation via the vascular endothelial growth factor receptor 2 pathway. J. Pathol. 2015, 236, 407–420. [Google Scholar] [CrossRef] [Scilit]
- Park, S.-A.; Sung, N.J.; Choi, B.-J.; Kim, W.; Kim, S.H.; Surh, Y.-J. Gremlin-1 augments the oestrogen-related receptor α signalling through EGFR activation: Implications for the progression of breast cancer. Br. J. Cancer 2020, 123, 988–999. [Google Scholar] [CrossRef] [Scilit]
- Davis, H.; Irshad, S.; Bansal, M.; Rafferty, H.; Boitsova, T.; Bardella, C.; Jaeger, E.; Lewis, A.; Freeman-Mills, L.; Giner, F.C.; et al. Aberrant epithelial GREM1 expression initiates colonic tumorigenesis from cells outside the stem cell niche. Nat. Med. 2015, 21, 62–70. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rodrigues-Diez, R.; Rodrigues-Diez, R.R.; Lavoz, C.; Carvajal, G.; Droguett, A.; Garcia-Redondo, A.B.; Rodriguez, I.; Ortiz, A.; Egido, J.; Mezzano, S.; et al. Gremlin activates the Smad pathway linked to epithelial mesenchymal transdifferentiation in cultured tubular epithelial cells. Biomed. Res. Int. 2014, 2014, 802841. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kalluri, R.; Neilson, E.G. Epithelial-mesenchymal transition and its implications for fibrosis. J. Clin. Investig. 2003, 112, 1776–1784. [Google Scholar] [CrossRef] [PubMed]
- Kobayashi, H.; Gieniec, K.A.; Wright, J.A.; Wang, T.; Asai, N.; Mizutani, Y.; Lida, T.; Ando, R.; Suzuki, N.; Lannagan, T.R.M.; et al. The Balance of Stromal BMP Signaling Mediated by GREM1 and ISLR Drives Colorectal Carcinogenesis. Gastroenterology 2021, 160, 1224–1239.e30. [Google Scholar] [CrossRef] [Scilit]
- Ren, J.; Smid, M.; Iaria, J.; Salvatori, D.C.F.; van Dam, H.; Zhu, H.J.; Martens, J.W.M.; Ten Dijke, P. Cancer-associated fibroblast-derived Gremlin 1 promotes breast cancer progression. Breast Cancer Res. 2019, 21, 109. [Google Scholar] [CrossRef] [Scilit]
- Neckmann, U.; Wolowczyk, C.; Hall, M.; Almaas, E.; Ren, J.; Zhao, S.; Johannessen, B.; Skotheim, R.I.; Bjorkoy, G.; Ten Dijke, P.; et al. GREM1 is associated with metastasis and predicts poor prognosis in ER-negative breast cancer patients. Cell Commun. Signal. 2019, 17, 140. [Google Scholar] [CrossRef] [Scilit]
- Karagiannis, G.S.; Berk, A.; Dimitromanolakis, A.; Diamandis, E.P. Enrichment map profiling of the cancer invasion front suggests regulation of colorectal cancer progression by the bone morphogenetic protein antagonist, gremlin-1. Mol. Oncol. 2013, 7, 826–839. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yan, K.; Wu, Q.; Yan, D.H.; Lee, C.H.; Rahim, N.; Tritschler, I.; DeVecchio, J.; Kalady, M.F.; Hjelmeland, A.B.; Rich, J.N. Glioma cancer stem cells secrete Gremlin1 to promote their maintenance within the tumor hierarchy. Genes Dev. 2014, 28, 1085–1100. [Google Scholar] [CrossRef] [Scilit]
- Kawasaki, K.; Fujii, M.; Sugimoto, S.; Ishikawa, K.; Matano, M.; Ohta, Y.; Toshimitsu, K.; Takahashi, S.; Hosoe, N.; Sekine, S.; et al. Chromosome Engineering of Human Colon-Derived Organoids to Develop a Model of Traditional Serrated Adenoma. Gastroenterology 2020, 158, 638–651.e8. [Google Scholar] [CrossRef] [Scilit]
- Pelli, A.; Vayrynen, J.P.; Klintrup, K.; Makela, J.; Makinen, M.J.; Tuomisto, A.; Karttunen, T.J. Gremlin1 expression associates with serrated pathway and favourable prognosis in colorectal cancer. Histopathology 2016, 69, 831–838. [Google Scholar] [CrossRef] [Scilit]
- Wang, M.; Kaufman, R.J. The impact of the endoplasmic reticulum protein-folding environment on cancer development. Nat. Rev. Cancer 2014, 14, 581–597. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, M.J.; Malhi, H. The unfolded protein response and hepatic lipid metabolism in non alcoholic fatty liver disease. Pharmacol. Ther. 2019, 203, 107401. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, K.; Wang, S.; Malhotra, J.; Hassler, J.R.; Back, S.H.; Wang, G.; Chang, L.; Xu, W.; Miao, H.; Leonardi, R.; et al. The unfolded protein response transducer IRE1alpha prevents ER stress-induced hepatic steatosis. EMBO J. 2011, 30, 1357–1375. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, J.; Chen, Y.J.; Dobbs, N.; Sakai, T.; Liou, J.; Miner, J.J.; Yan, N. STING-mediated disruption of calcium homeostasis chronically activates ER stress and primes T cell death. J. Exp. Med. 2019, 216, 867–883. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hetz, C. The unfolded protein response: Controlling cell fate decisions under ER stress and beyond. Nat. Rev. Mol. Cell Biol. 2012, 13, 89–102. [Google Scholar] [CrossRef] [Scilit]
- Zhou, K.; Zheng, Z.; Li, Y.; Han, W.; Zhang, J.; Mao, Y.; Chen, H.; Zhang, W.; Liu, M.; Xie, L.; et al. TFE3, a potential therapeutic target for Spinal Cord Injury via augmenting autophagy flux and alleviating ER stress. Theranostics 2020, 10, 9280–9302. [Google Scholar] [CrossRef] [Scilit]
- Bhardwaj, M.; Leli, N.M.; Koumenis, C.; Amaravadi, R.K. Regulation of autophagy by canonical and non-canonical ER stress responses. Semin. Cancer Biol. 2020, 66, 116–128. [Google Scholar] [CrossRef] [Scilit]
- Urra, H.; Dufey, E.; Avril, T.; Chevet, E.; Hetz, C. Endoplasmic Reticulum Stress and the Hallmarks of Cancer. Trends Cancer 2016, 2, 252–262. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Wang, K.; Jin, Y.; Sheng, X. Endoplasmic reticulum proteostasis control and gastric cancer. Cancer Lett. 2019, 449, 263–271. [Google Scholar] [CrossRef] [Scilit]
- Chen, X.; Cubillos-Ruiz, J.R. Endoplasmic reticulum stress signals in the tumour and its microenvironment. Nat. Rev. Cancer 2021, 21, 71–88. [Google Scholar] [CrossRef] [Scilit]
- Zhang, T.; Li, N.; Sun, C.; Jin, Y.; Sheng, X. MYC and the unfolded protein response in cancer: Synthetic lethal partners in crime? EMBO Mol. Med. 2020, 12, e11845. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hetz, C.; Axten, J.M.; Patterson, J.B. Pharmacological targeting of the unfolded protein response for disease intervention. Nat. Chem. Biol. 2019, 15, 764–775. [Google Scholar] [CrossRef] [Scilit]
- Shah, P.P.; Beverly, L.J. Regulation of VCP/p97 demonstrates the critical balance between cell death and epithelial-mesenchymal transition (EMT) downstream of ER stress. Oncotarget 2015, 6, 17725. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sheng, W.; Wang, G.; Tang, J.; Shi, X.; Cao, R.; Sun, J.; Lin, Y.H.; Jia, C.; Chen, C.; Zhou, J. Calreticulin promotes EMT in pancreatic cancer via mediating Ca 2+ dependent acute and chronic endoplasmic reticulum stress. J. Exp. Clin. Cancer Res. 2020, 39, 209. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tarazona, S.; García-Alcalde, F.; Dopazo, J.; Ferrer, A.; Conesa, A. Differential expression in RNA-seq: A matter of depth. Genome Res. 2011, 21, 2213–2223. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, J.; Cao, Q.; Mehra, R.; Laxman, B.; Yu, J.; Tomlins, S.A.; Creighton, C.J.; Dhanasekaran, S.M.; Shen, R.; Chen, G. Integrative genomics analysis reveals silencing of β-adrenergic signaling by polycomb in prostate cancer. Cancer Cell 2007, 12, 419–431. [Google Scholar] [CrossRef] [Scilit]
- Kim, M.; Jang, K.; Miller, P.; Picon-Ruiz, M.; Yeasky, T.M.; El-Ashry, D.; Slingerland, J.M. VEGFA links self-renewal and metastasis by inducing Sox2 to repress miR-452, driving Slug. Oncogene 2017, 36, 5199–5211. [Google Scholar] [CrossRef] [Scilit]
- Park, Y.L.; Kim, H.P.; Ock, C.Y.; Min, D.W.; Kang, J.K.; Lim, Y.J.; Song, S.H.; Han, S.W.; Kim, T.Y. EMT-mediated regulation of CXCL1/5 for resistance to anti-EGFR therapy in colorectal cancer. Oncogene 2022, 41, 2026–2038. [Google Scholar] [CrossRef] [Scilit]
- Raychaudhuri, K.; Chaudhary, N.; Gurjar, M.; D’Souza, R.; Limzerwala, J.; Maddika, S.; Dalal, S.N. 14-3-3σ Gene Loss Leads to Activation of the Epithelial to Mesenchymal Transition Due to the Stabilization of c-Jun Protein. J. Biol. Chem. 2016, 291, 16068–16081. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.; Xu, L.; Wang, P.; Jian, H.; Shi, X.; Jia, M.; Mo, L.; Hu, Z.; Li, H.; Li, J. Phenotypic transition of tumor cells between epithelial- and mesenchymal-like state during adaptation to acidosis. Cell Cycle 2019, 18, 1938–1947. [Google Scholar] [CrossRef] [Scilit]
- Harikrishnan, K.; Cooley, M.A.; Sugi, Y.; Barth, J.L.; Rasmussen, L.M.; Kern, C.B.; Argraves, K.M.; Argraves, W.S. Fibulin-1 suppresses endothelial to mesenchymal transition in the proximal outflow tract. Mech. Dev. 2015, 136, 123–132. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Harikrishnan, K.; Joshi, O.; Madangirikar, S.; Balasubramanian, N. Cell Derived Matrix Fibulin-1 Associates With Epidermal Growth Factor Receptor to Inhibit Its Activation, Localization and Function in Lung Cancer Calu-1 Cells. Front. Cell Dev. Biol. 2020, 8, 522. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tan, F.; Wahdan-Alaswad, R.; Yan, S.; Thiele, C.J.; Li, Z. Dihydropyrimidinase-like protein 3 expression is negatively regulated by MYCN and associated with clinical outcome in neuroblastoma. Cancer Sci. 2013, 104, 1586–1592. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Artero-Castro, A.; Perez-Alea, M.; Feliciano, A.; Leal, J.A.; Genestar, M.; Castellvi, J.; Peg, V.; Ramón, Y.C.S.; Lleonart, M.E. Disruption of the ribosomal P complex leads to stress-induced autophagy. Autophagy 2015, 11, 1499–1519. [Google Scholar] [CrossRef] [Scilit]
- Sujobert, P.; Poulain, L.; Paubelle, E.; Zylbersztejn, F.; Grenier, A.; Lambert, M.; Townsend, E.C.; Brusq, J.-M.; Nicodeme, E.; Decrooqc, J. Co-activation of AMPK and mTORC1 induces cytotoxicity in acute myeloid leukemia. Cell Rep. 2015, 11, 1446–1457. [Google Scholar] [CrossRef] [Scilit]
- Gallagher, C.M.; Garri, C.; Cain, E.L.; Ang, K.K.-H.; Wilson, C.G.; Chen, S.; Hearn, B.R.; Jaishankar, P.; Aranda-Diaz, A.; Arkin, M.R. Ceapins are a new class of unfolded protein response inhibitors, selectively targeting the ATF6α branch. eLife 2016, 5, e11878. [Google Scholar] [CrossRef] [Scilit]
- Gallagher, C.M.; Walter, P. Ceapins inhibit ATF6α signaling by selectively preventing transport of ATF6α to the Golgi apparatus during ER stress. eLife 2016, 5, e11880. [Google Scholar] [CrossRef] [Scilit]
- Church, R.H.; Krishnakumar, A.; Urbanek, A.; Geschwindner, S.; Meneely, J.; Bianchi, A.; Basta, B.; Monaghan, S.; Elliot, C.; Strömstedt, M.; et al. Gremlin1 preferentially binds to bone morphogenetic protein-2 (BMP-2) and BMP-4 over BMP-7. Biochem. J. 2015, 466, 55–68. [Google Scholar] [CrossRef] [Scilit]
- Hughes, A.; Oxford, A.E.; Tawara, K.; Jorcyk, C.L.; Oxford, J.T. Endoplasmic reticulum stress and unfolded protein response in cartilage pathophysiology; contributing factors to apoptosis and osteoarthritis. Int. J. Mol. Sci. 2017, 18, 665. [Google Scholar] [CrossRef] [Scilit]
- Wellbrock, J.; Sheikhzadeh, S.; Bonk, V.; Oliveira-Ferrer, L.; Klaetschke, K.; Streichert, T.; Bokemeyer, C.; von Kodolitsch, Y.; Fiedler, W. Gremlin-1 Is Overexpressed in Endothelial Cells of Patients with Loeys-Dietz Syndrome Due to Dysregulation of TGF-β Signalling. Blood 2011, 118, 3269. [Google Scholar] [CrossRef] [Scilit]
- Claesson-Welsh, L.; Welsh, M. VEGFA and tumour angiogenesis. J. Intern. Med. 2013, 273, 114–127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, Q.; Han, C.; Xiong, X.; He, F.; Gan, W.; Wei, S.; Liu, H.; Li, L.; Xu, H. PI3K-Akt-mTOR signal inhibition affects expression of genes related to endoplasmic reticulum stress. Genet. Mol. Res. 2016, 15, gmr.15037868. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lamalice, L.; Houle, F.; Jourdan, G.; Huot, J. Phosphorylation of tyrosine 1214 on VEGFR2 is required for VEGF-induced activation of Cdc42 upstream of SAPK2/p38. Oncogene 2004, 23, 434–445. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.; Gan, B.; Liu, D.; Paik, J.H. FoxO family members in cancer. Cancer Biol. 2011, 12, 253–259. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Deng, C.F.; Zhu, N.; Zhao, T.J.; Li, H.F.; Gu, J.; Liao, D.F.; Qin, L. Involvement of LDL and ox-LDL in Cancer Development and Its Therapeutical Potential. Front. Oncol. 2022, 12, 803473. [Google Scholar] [CrossRef] [Scilit]
- Wu, T.; Jiao, Z.; Li, Y.; Su, X.; Yao, F.; Peng, J.; Chen, W.; Yang, A. HPRT1 Promotes Chemoresistance in Oral Squamous Cell Carcinoma via Activating MMP1/PI3K/Akt Signaling Pathway. Cancers 2022, 14, 855. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miyazono, K.; Miyazawa, K. Id: A target of BMP signaling. Sci. STKE 2002, 2002, pe40. [Google Scholar] [CrossRef]
- O’Reilly, S. Gremlin: A complex molecule regulating wound healing and fibrosis. Cell. Mol. Life Sci. 2021, 78, 7917–7923. [Google Scholar] [CrossRef] [Scilit]
- Koppens, M.A.J.; Davis, H.; Valbuena, G.N.; Mulholland, E.J.; Nasreddin, N.; Colombe, M.; Antanaviciute, A.; Biswas, S.; Friedrich, M.; Lee, L.; et al. Bone Morp.phogenetic Protein Pathway Antagonism by Grem1 Regulates Epithelial Cell Fate in Intestinal Regeneration. Gastroenterology 2021, 161, 239–254.e9. [Google Scholar] [CrossRef] [Scilit]
- Sung, N.J.; Kim, N.H.; Surh, Y.-J.; Park, S.-A. Gremlin-1 promotes metastasis of breast cancer cells by activating STAT3-MMP13 signaling pathway. Int. J. Mol. Sci. 2020, 21, 9227. [Google Scholar] [CrossRef] [Scilit]
- Sun, Q.; Qi, X.; Zhang, W.; Li, X. Knockdown of circRNA_0007534 suppresses the tumorigenesis of cervical cancer via miR-206/GREM1 axis. Cancer Cell Int. 2021, 21, 54. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, Z.; Liu, R.; Miao, X.; Li, D.; Zou, Q.; Yuan, Y.; Yang, Z. Prognostic and clinicopathological significance of Hapto and Gremlin1 expression in extrahepatic cholangiocarcinoma. J. Cancer 2020, 11, 199–207. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, H.S.; Shin, M.S.; Cheon, M.S.; Kim, J.W.; Lee, C.; Kim, W.H.; Kim, Y.S.; Jang, B.G. GREM1 is expressed in the cancer-associated myofibroblasts of basal cell carcinomas. PLoS ONE 2017, 12, e0174565. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- van Vlodrop, I.J.; Baldewijns, M.M.; Smits, K.M.; Schouten, L.J.; van Neste, L.; van Criekinge, W.; van Poppel, H.; Lerut, E.; Schuebel, K.E.; Ahuja, N.; et al. Prognostic significance of Gremlin1 (GREM1) promoter CpG island hypermethylation in clear cell renal cell carcinoma. Am. J. Pathol. 2010, 176, 575–584. [Google Scholar] [CrossRef] [Scilit]
- Sato, M.; Kawana, K.; Fujimoto, A.; Yoshida, M.; Nakamura, H.; Nishida, H.; Inoue, T.; Taguchi, A.; Takahashi, J.; Adachi, K.; et al. Clinical significance of Gremlin 1 in cervical cancer and its effects on cancer stem cell maintenance. Oncol. Rep. 2016, 35, 391–397. [Google Scholar] [CrossRef] [Scilit]
- Sneddon, J.B.; Zhen, H.H.; Montgomery, K.; van de Rijn, M.; Tward, A.D.; West, R.; Gladstone, H.; Chang, H.Y.; Morganroth, G.S.; Oro, A.E.; et al. Bone morphogenetic protein antagonist gremlin 1 is widely expressed by cancer-associated stromal cells and can promote tumor cell proliferation. Proc. Natl. Acad. Sci. USA 2006, 103, 14842–14847. [Google Scholar] [CrossRef] [Scilit]
- Mulvihill, M.S.; Kwon, Y.W.; Lee, S.; Fang, L.T.; Choi, H.; Ray, R.; Kang, H.C.; Mao, J.H.; Jablons, D.; Kim, I.J. Gremlin is overexpressed in lung adenocarcinoma and increases cell growth and proliferation in normal lung cells. PLoS ONE 2012, 7, e42264. [Google Scholar] [CrossRef] [Scilit]
- Yamasaki, Y.; Ishigami, S.; Arigami, T.; Kita, Y.; Uchikado, Y.; Kurahara, H.; Kijima, Y.; Maemura, K.; Natsugoe, S. Expression of gremlin1 in gastric cancer and its clinical significance. Med. Oncol. 2018, 35, 30. [Google Scholar] [CrossRef] [Scilit]
- Namkoong, H.; Shin, S.M.; Kim, H.K.; Ha, S.A.; Cho, G.W.; Hur, S.Y.; Kim, T.E.; Kim, J.W. The bone morphogenetic protein antagonist gremlin 1 is overexpressed in human cancers and interacts with YWHAH protein. BMC Cancer 2006, 6, 74. [Google Scholar] [CrossRef] [Scilit]
- Wang, D.J.; Zhi, X.Y.; Zhang, S.C.; Jiang, M.A.; Liu, P.; Han, X.P.; Li, J.; Chen, Z.; Wang, C.L. The bone morphogenetic protein antagonist Gremlin is overexpressed in human malignant mesothelioma. Oncol. Rep. 2012, 27, 58–64. [Google Scholar] [CrossRef] [Scilit]
- Chen, M.H.; Yeh, Y.C.; Shyr, Y.M.; Jan, Y.H.; Chao, Y.; Li, C.P.; Wang, S.E.; Tzeng, C.H.; Chang, P.M.; Liu, C.Y.; et al. Expression of gremlin 1 correlates with increased angiogenesis and progression-free survival in patients with pancreatic neuroendocrine tumors. J. Gastroenterol. 2013, 48, 101–108. [Google Scholar] [CrossRef] [Scilit]
- Guimei, M.; Baddour, N.; Elkaffash, D.; Abdou, L.; Taher, Y. Gremlin in the pathogenesis of hepatocellular carcinoma complicating chronic hepatitis C: An immunohistochemical and PCR study of human liver biopsies. BMC Res. Notes 2012, 5, 390. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, C.; Rezov, V.; Joensuu, E.; Vartiainen, V.; Ronty, M.; Yin, M.; Myllarniemi, M.; Koli, K. Pirfenidone decreases mesothelioma cell proliferation and migration via inhibition of ERK and AKT and regulates mesothelioma tumor microenvironment in vivo. Sci. Rep. 2018, 8, 10070. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sung, N.J.; Kim, N.H.; Bae, N.Y.; Jo, H.S.; Park, S.A. DHA inhibits Gremlin-1-induced epithelial-to-mesenchymal transition via ERK suppression in human breast cancer cells. Biosci. Rep. 2020, 40, BSR20200164. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kosinski, C.; Li, V.S.W.; Chan, A.S.Y.; Zhang, J.; Ho, C.; Tsui, W.Y.; Chan, T.L.; Mifflin, R.C.; Powell, D.W.; Yuen, S.T.; et al. Gene expression patterns of human colon tops and basal crypts and BMP antagonists as intestinal stem cell niche factors. Proc. Natl. Acad. Sci. USA 2007, 104, 15418–15423. [Google Scholar] [CrossRef] [Scilit]
- Karagiannis, G.S.; Afaloniati, H.; Karamanavi, E.; Poutahidis, T.; Angelopoulou, K. BMP pathway suppression is an early event in inflammation-driven colon neoplasmatogenesis of uPA-deficient mice. Tumor Biol. 2016, 37, 2243–2255. [Google Scholar] [CrossRef] [Scilit]
- Hong, D.; Liu, T.; Huang, W.; Liao, Y.; Wang, L.; Zhang, Z.; Chen, H.; Zhang, X.; Xiang, Q. Gremlin1 Delivered by Mesenchymal Stromal Cells Promoted Epithelial-Mesenchymal Transition in Human Esophageal Squamous Cell Carcinoma. Cell. Physiol. Biochem. 2018, 47, 1785–1799. [Google Scholar] [CrossRef] [Scilit]
- Santamaria, P.G.; Mazon, M.J.; Eraso, P.; Portillo, F. UPR: An Upstream Signal to EMT Induction in Cancer. J. Clin. Med. 2019, 8, 624. [Google Scholar] [CrossRef] [Scilit]
- Han, C.C.; Wan, F.S. New Insights into the Role of Endoplasmic Reticulum Stress in Breast Cancer Metastasis. J. Breast Cancer 2018, 21, 354–362. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Chen, X.; Gao, Y.; Wu, J.; Zeng, F.; Song, F. XBP1 induces snail expression to promote epithelial- to-mesenchymal transition and invasion of breast cancer cells. Cell Signal. 2015, 27, 82–89. [Google Scholar] [CrossRef] [Scilit]
- Azim, M.; Surani, H.J.C. Glycoprotein synthesis and inhibition of glycosylation by tunicamycin in preimplantation mouse embryos: Compaction and trophoblast adhesion. Cell 1979, 18, 217–227. [Google Scholar] [CrossRef] [Scilit]
- Wu, J.; Chen, S.; Liu, H.; Zhang, Z.; Ni, Z.; Chen, J.; Yang, Z.; Nie, Y.; Fan, D. Tunicamycin specifically aggravates ER stress and overcomes chemoresistance in multidrug-resistant gastric cancer cells by inhibiting N-glycosylation. J. Exp. Clin. Cancer Res. 2018, 37, 272. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hetz, C.; Zhang, K.; Kaufman, R.J. Mechanisms, regulation and functions of the unfolded protein response. Nat. Rev. Mol. Cell Biol. 2020, 21, 421–438. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Grenier, A.; Poulain, L.; Mondesir, J.; Jacquel, A.; Bosc, C.; Stuani, L.; Mouche, S.; Larrue, C.; Sahal, A.; Birsen, R.; et al. AMPK-PERK axis represses oxidative metabolism and enhances apoptotic priming of mitochondria in acute myeloid leukemia. Cell Rep. 2022, 38, 110197. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, M.; Li, H.; Wang, P.; Yang, W.; Mi, R.; Zhuang, J.; Jiang, Y.; Lu, Y.; Shen, X.; Wu, Y.; et al. ATF6 aggravates angiogenesis-osteogenesis coupling during ankylosing spondylitis by mediating FGF2 expression in chondrocytes. iScience 2021, 24, 102791. [Google Scholar] [CrossRef] [Scilit] [PubMed]








Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, R.; Zhou, H.; Li, M.; Mai, Q.; Fu, Z.; Jiang, Y.; Li, C.; Gao, Y.; Fan, Y.; Wu, K.; et al. Gremlin-1 Promotes Colorectal Cancer Cell Metastasis by Activating ATF6 and Inhibiting ATF4 Pathways. Cells 2022, 11, 2136. https://doi.org/10.3390/cells11142136
Li R, Zhou H, Li M, Mai Q, Fu Z, Jiang Y, Li C, Gao Y, Fan Y, Wu K, et al. Gremlin-1 Promotes Colorectal Cancer Cell Metastasis by Activating ATF6 and Inhibiting ATF4 Pathways. Cells. 2022; 11(14):2136. https://doi.org/10.3390/cells11142136
Chicago/Turabian StyleLi, Ruohan, Huaixiang Zhou, Mingzhe Li, Qiuyan Mai, Zhang Fu, Youheng Jiang, Changxue Li, Yunfei Gao, Yunping Fan, Kaiming Wu, and et al. 2022. "Gremlin-1 Promotes Colorectal Cancer Cell Metastasis by Activating ATF6 and Inhibiting ATF4 Pathways" Cells 11, no. 14: 2136. https://doi.org/10.3390/cells11142136
APA StyleLi, R., Zhou, H., Li, M., Mai, Q., Fu, Z., Jiang, Y., Li, C., Gao, Y., Fan, Y., Wu, K., Costa, C. D., Sheng, X., He, Y., & Li, N. (2022). Gremlin-1 Promotes Colorectal Cancer Cell Metastasis by Activating ATF6 and Inhibiting ATF4 Pathways. Cells, 11(14), 2136. https://doi.org/10.3390/cells11142136

