Next Article in Journal / Special Issue
The Mitochondrial Genomes of Neuropteridan Insects and Implications for the Phylogeny of Neuroptera
Previous Article in Journal
Metagenome Profiling Identifies Potential Biocontrol Agents for Selaginella kraussiana in New Zealand
Previous Article in Special Issue
Assembly of the Mitochondrial Genome in the Campanulaceae Family Using Illumina Low-Coverage Sequencing
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Genes
Volume 10
Issue 2
10.3390/genes10020107
genes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Characterization of the Complete Mitochondrial Genome of Ostertagia trifurcata of Small Ruminants and its Phylogenetic Associations for the Trichostrongyloidea Superfamily

by
Awais Ali Ahmad
1,
Xin Yang
1,
Ting Zhang
1,
Chunqun Wang
1,
Caixian Zhou
1,
Xingrun Yan
1,
Mubashar Hassan
1,
Muhammad Ikram
2 and
Min Hu
1,*
1
State Key Laboratory of Agricultural Microbiology, Key Laboratory for the Development of Veterinary Products, Ministry of Agriculture, College of Veterinary Medicine, Huazhong Agricultural University, Wuhan 430070, China
2
Statistical Genomics Lab, College of Plant Science and Technology, Huazhong Agricultural University, Wuhan 430070, China
*
Author to whom correspondence should be addressed.
Genes 2019, 10(2), 107; https://doi.org/10.3390/genes10020107
Submission received: 3 January 2019 / Revised: 23 January 2019 / Accepted: 29 January 2019 / Published: 31 January 2019
(This article belongs to the Special Issue Mitochondrial Genomes: Genetic and Transcriptomic Studies)
Browse Figures
Versions Notes

Abstract

:
The complete mitochondrial (mt) genome of Ostertagia trifurcata, a parasitic nematode of small ruminants, has been sequenced and its phylogenetic relationship with selected members from the superfamily Trichostrongyloidea was investigated on the basis of deduced datasets of mt amino acid sequences. The entire mt genome of Ostertagia trifurcata is circular and 14,151 bp in length. It consists of a total of 36 genes comprising 12 genes coding for proteins (PCGs), 2 genes for ribosomal RNA (rRNA), 22 transfer RNA (tRNA) genes and 2 non-coding regions, since all genes are transcribed in the same direction. The phylogenetic analysis based on the concatenated datasets of predicted amino acid sequences of the 12 protein coding genes supported monophylies of the Haemonchidae, Dictyocaulidae and Molineidae families, but rejected monophylies of the Trichostrongylidae family. The complete characterization and provision of the mtDNA sequence of Ostertagia trifurcata provides novel genetic markers for molecular epidemiological investigations, systematics, diagnostics and population genetics of Ostertagia trifurcata and its correspondents.

1. Introduction

Gastrointestinal parasites cause major economic losses to the livestock industry all over the world [1]. Among these parasites, Ostertagia spp., which is a reddish brown worm present in the abomasum of ruminants, is a major cause of parasitic gastritis (ostertagiosis) worldwide, particularly in temperate climates. Ostertagia spp. is considered to be among the most common gastrointestinal nematodes of ruminants [2]. Postmortem examination of small ruminants revealed a high infection rate in goats in China [2]. More than 15 Ostertagia species have been reported in small ruminants [3,4,5]. Among them, Ostertagia trifurcata (O. trifurcata) is distributed widely and has a lifecycle similar to Haemonchus contortus, another important parasitic nematode of small ruminants. Animals infected with Ostertagia spp. show the presence of eggs in fecal samples 15–17 days after infection [6]. Importantly, Ostertagia spp. is prevalent in both temperate and cold climates [7]. Heavy infection leads to emaciation, anemia, intermittent constipation and even death in extreme cases [8]. In China, it is one of the most predominant nematodes of ruminants and contributes to substantial financial losses [9].
Mitochondria are a subcellular organelle with important biochemical functions. This organelle is the powerhouse of the eukaryotic cell. The mitochondrial (mt) genome is located within the organelle, independent of the nuclear genome but with a closer relationship to each other. The mt genome is maternally inherited, and has stable genes, a variable gene arrangement and a faster gene evolution rate [10,11,12]. These features make them widely applicable in epidemiological studies, population genetics and phylogenetic relationships at different taxonomic levels [13,14,15,16,17].
The current hypothesis of Trichostrongylidae’s phylogeny was based on ecological and morphological characteristics along with the sequence analysis of small subunit (SSU) rRNA genes [6,18]. Moreover, reconstructions of phylogenetic relationships among Trichostrongylidae nematodes have been performed using the mt genome sequences [19]. Regardless of the advancements, there is still ambiguity relating to the phylogenetic relationships among Trichostrongylidae nematodes. Some previous studies were indicative of Trichostrongylidae monophyly [20,21], whereas other studies support a contrary argument and are suggestive of a sister relationship among Trichostrongylidae, Haemonchidae and Cooperiidae [18,22,23]. Insufficient perseverance at higher levels of taxonomy with dissimilar datasets of DNA, as well as the utilization of distinct methods for inference may result in such inconsistent results. Even though Trichostrongylidae is a large family of nematodes, the number of complete mt genomes sequenced to date are limited [19]. The enrichment of information on the mt genome of helminths, especially those infecting small ruminants, is required to augment database and species characterization, which provides valuable information for future studies on the identification of species, phylogenetic analysis and genetic diversity. There is very limited availability of genomic data on the mt genome of members of Ostertagia genus. This lack of adequate knowledge about the mt genomes of nematodes is a key limitation for studies of the phylogenetic relationship of Trichostrongylidae.
Keeping in view the background and connotation of O. trifurcata, the current study intended to determine the mt genome composition of O. trifurcata and a reconstruction of the phylogenetic relationship of the Trichostrongyloidea superfamily using these mtDNA sequences.

2. Materials and Methods

2.1. Collection of Worms and Extraction of DNA

The adult worms from the abomasum of naturally-infected domesticated sheep and goats in Luotian, Hubei, P.R. China were collected. The collected worms were subsequently washed in 0.9% sodium chloride solution and identified as Ostertagia based on their morphological characteristics. Samples were then washed with phosphate buffered saline (PBS), fixed in 70% ethyl alcohol, and stored at −20 °C until next use. It was challenging to attain precise morphological characteristics of, so molecular identification was carried out. For the extraction of the total genomic DNA from single worm Ostertagia samples, Sodium dodecyl (SDS)-proteinase K treatment was performed, trailed by purification using mini column (Wizard® SV Genomic DNA Purification System, Promega).

2.2. Amplification of the ITS-2 of Ostertagia trifurcata

To identify the organism, the ITS-2 region was amplified and then sequenced according to a previously described method [24]. The universal primers NC5 and NC2 (Table 1) were used for the amplification of the ITS-2 region. A total volume of 20 µL was prepared including DNA template, primers and PCR premix (Takara, Dalian, China). The conditions used for PCR amplification were initially 94 °C for 5 min followed by 35 cycles of 94 °C for 30 seconds, 50 °C for 30 seconds and 72 °C for 1 min, final extension at 72 °C for 10 min, and the reaction was stopped at 20 °C for 5 min.

2.3. Amplification of Long Fragments and Sequencing

The primers used in amplifying long overlapping fragments of mitochondrial genome were relative to their conserved regions (Table 1) [25]. Long-range PCR was used to amplify the whole mt genome of O. trifurcata in four overlapping fragments with locations of amplicons between rrnS and cytb (~3 kb), cytb and cox1 (~4 kb), cox1 and rrnL (~3 kb) and rrnL and rrnS (~5 kb). The long PCRs were performed by making a total volume of 50 µl per amplicon, with the reaction mixture containing 34.75 µL dH2O, 5 µL of 10× Thermopol reaction buffer (Biolabs, New England), 10 mM of each dNTP (Takara, Dalian, China), 1.25U LATaq (Takara, Dalian, China), 2 µM of each primers (TsingKe, Beijing, China) and 2 µL of genomic DNA in a thermocycler (Biometra, Göttingen, Germany). The PCR conditions for the amplification were initiated by denaturation at 94 °C for 5 min, followed by 35 cycles of denaturation for 30 seconds at 94 °C, annealing for 30 seconds at 50 °C, extension for 5 min at 60 °C, with 7 min of final extension at 60 °C, and finally the reaction was stopped at 4 °C. The obtained amplicons were then cloned into pGEM-T-Easy vector (Promega, USA), which were sequenced (Sangon BioTech company, Shanghai, China) employing a strategy of primer-walking [26]. The complete mitochondrial genome of O. trifurcata (GenBank accession no. MK227249) was thus obtained.

2.4. Gene Annotation and Sequence Analysis

The mt genome annotation was performed by implementing a methodology similar to Ascaridomorph nematodes [27]. The assembly of sequences was carried out manually and the assembled sequences were subsequently aligned against the entire mt genome sequences of the reference species (Teladorsagia circumcincta, accession number GQ888720) to identify gene boundaries. The Open Reading Frame Finder (<http://www.ncbi.nlm.nih.gov/gorf/gorf.html>) and DOGMA tool (http://dogma.ccbb.utexas.edu/index.html) were used to analyze the open reading frames using the invertebrate mitochondrial code with further comparison performed using other enoplid nematodes. The MEGA5 software was used to select the invertebrate mt genetic code for the translation of individual genes into amino acid sequences. The amino acid sequences of other nematodes were then aligned with the resulting sequences of amino acids inferred for the mt genes using Clustal × 1.83. Based on the pairwise comparison, amino acid identity (%) was also calculated for homologous genes. Codon usage was inspected whereby the genetic codons were split into rich GC codons, rich AT codons and neutral codons based on the relationships among codon families, the occurrence of amino acids and composition of nucleotides. To examine the rRNA genes, presumed secondary structures of tRNA genes were recognized using ARWEN (http://mbio-serv2.mbioekol.lu.se/ARWEN/) [28,29] as well as visual inspection [30].

2.5. Phylogenetic Analysis on Basis of the Dataset of Amino Acid Sequences

Individual genes of the O. trifurcata mt genome were translated to obtain amino acid sequences that were then integrated to form a single alignment. These sequences were aligned with other deduced sequences of amino acids from already-published mt genomes. Selective nematodes were representatives for comparison with the superfamily Trichostrongyloidea, featuring family Trichostrongylidae (Trichostrongylus vitrinus, NC_013807; Trichostrongylus axei, NC_013824; Teladorsagia circumcincta, NC_013827; Marshallagia marshalli, MG011723) [19,31], Molineidae family (Nematodirus oiratianus, NC_024639, and Nematodirus spathiger, NC_024638) [22], Cooperiidae family (Cooperia oncophora, NC_004806) [32], Haemonchidae family (Mecistocirrus digitatus, NC_013848, Haemonchus placei, NC_029736) [19] and (Haemonchus contortus, NC_010383) [33], Dictyocaulidae family (Dictyocaulus eckerti, NC_019809; Dictyocaulus viviparus, NC_019810;) [34], whereas Oesophagostomum quadrispinulatum (GenBank accession number NC_014181) [23] was selected as an outgroup. The individual sequential alignment of amino acids derived from mt protein coding genes was performed using the MAFFT 7.122 software [35] and were chained into a single dataset. Furthermore, sequences that were aligned ambiguously were removed according to a previously described method [31]. Phylogenetic assessment was piloted using the neighbor joining (NJ), maximum likelihood (ML) and maximum parsimony (MP) methods using default parameters according to a formerly described method [36,37]. The bootstrap values for NJ and MP were 1000, whereas bootstrap 100 was selected for the ML analysis with a cutoff value of 95% for all methods. The number of differences model was used by NJ to infer the phylogenetic tree, and in the case of ML the uniform rates model was used. MP used the subtree-pruning-regrafting search method where the maximum trees to retain were 100. The FigTree v. 1.4 program (http://tree.bio.ed.ac.uk/software/figtree) was used to construct the phylograms.

3. Results and Discussion

3.1. ITS-2 Analysis

The obtained ITS-2 sequence had 99% identity to a previously published ITS-2 sequence of O. trifurcata (GenBank Accession no. AJ251124.1), suggesting that the worms collected are Ostertagia trifurcata.

3.2. Organization, Content and mt Genome Annotation

The complete mt genome of O. trifurcata (GenBank accession no. MK227249) was 14,151 bp in length (Figure 1). The mt genomes of Trichostrongyloidea published to date possess variations in size that range from 13,296 bp of Dictyocallus eckerti [34] to 15,221 bp of Mecistocircus digitatus [19]. The size of the O. trifurcata mt genome was found to be within the expected range, i.e., 14,151 bp. This mt genome includes 12 protein-coding genes (nad1-6, cox1-3, cytb, nad4L and atp6), 2 rRNA genes, 22 tRNA genes and 2 non-coding regions (NC) (Table 2). The nucleotide composition of the coding strand of O. trifurcata was A = 4639 (32.78%), T = 6418 (45.35%), G = 2106 (14.88%) and C = 988 (6.98%). The gene contents and their organization were the same as those of M. marshalli [31], D. viviparus [34], N. oiratianus [22], T. axei [19] and H. contortus [33].
The mt genome of O. trifurcata encodes 12 proteins with 3181 amino acids. It accords three start codons (ATA, ATT, ATG) and two termination codons (TAA, TAG) (Table 2). Amongst the initiation codons, ATT was more frequently used, namely eight times by cox1, cox2, nad5, nad6, nad1, atp6, nad2 and nad4. ATA was utilized three times as the start codon by the nad3, cytb and cox3 genes, whereas ATG was used once as the start codon for the nad4L gene. In the case of stop codons, TAA was most frequently used as the stop codon, namely ten times by the cox1, cox2, cox3, nad5, nad6, nad4L, nad1, atp6, nad2 and cytb genes. The other stop codon was TAG, which was used by the nad3 and nad4 genes. These results are consistent with other studies of Trichostongyloidea nematodes (T. circumcincta, T. axei and T. vitrinus) [19], with some marked differences. In some previous mt genome studies of other nematodes of Trichostrongyloidea (T. vitrines, T. axei and T. circumcincta) [19], four start codons (ATA and TTG) were found, as well as incomplete stop codons (TA and A). However, in the present study, ATT and ATA were used as the initiation codons in the higher frequency by eleven protein coding genes and ATG was used once as a start codon. The present study also revealed the usage of complete termination codons as the stop codon. TAA was used altogether 10 times as the termination codon, and our data suggests the use of complete stop codons for all 12 genes coding for proteins. O. trifurcata is markedly different from other nematodes with regard to the basis of the start and stop codons, hence the provision of new molecular data provides insights into future studies of comparative mitochondrial genomics. Furthermore, the O. trifurcata mt genome possesses several overlaps between the CDS region and trnAs (Table 2). One nucleotide of cox1, cox2 and nad4 overlaps with trnC, trnH and trnT, respectively, whereas the nad1-atp6 and trnG-cox2 genes had overlaps of four and nine nucleotides, respectively. Moreover, there were longer overlaps in the mt genome sequence ranging from 20–50 nucleotides between nad4L–trnW, atp6–trnK, trnV–nad6, cox3–trnT, nad5–trnA, and trnL2 overlapping with the cox3 gene.
The O. trifurcata mt genome has 22 tRNA genes that range between 54 and 67 nucleotides in length. The rrnL gene of O. trifurcata is positioned between the trnH and nad3 genes with a length of 1315 bp. The rrnS gene is situated between the two tRNA genes represented as trnE and trnS. The A+T content of both the rRNA genes is high, at 81.66% and 77.63%, respectively, for rrnL and rrnS (Table 3). The mt genome of O. trifurcata possesses two non-coding regions, represented as LNCR (large non-coding region) and SNCR (short non-coding region) (Table 2). The longer non-coding region (LNCR) is sited between the trnR1 gene and trnV with a length of 308 bp, whereas the shorter non-coding region (SNCR) is positioned between the nad4 and cox1 gene, with a length of 113 bp (Table 2). The A+T contents was found to be higher for both non-coding regions, at 80.19% and 76.10% for LNCR and SNCR, respectively. These non-coding regions might play a vital role in replication and transcription processes, however, the authentic processes are still unknown [38].

3.3. Phylogenetic Analysis

The sequences of amino acids of the 12 key representative nematodes belonging to the Trichostrongyloidea superfamily were concatenated to infer the phylogenetic tree (Figure 2) producing similar results using the maximum parsimony (MP), maximum likelihood (ML) and neighbor joining (NJ) methods. The results showed monophylies of Molineidae, Dictyocaulidae and Haemonchidae with significant statistical support, as shown in Figure 2. However, monophyly of the family Trichostrongylidae was rejected and these results were consistent with preceding studies [18,22,23]. Haemonchidae family species (M. digitatus, H. contortus and H. placei) were found to be more closely linked to the two species of the Trichstongylidae family compared to the other three species (O. trifurcata, Teladorsagia circumcincta and Marshallagia marshalli) belonging to the same family. The closer relationship within the Haemonchidae family was supported moderately (bootstrap values of NJ/ML/MP: 95/93/62, respectively) (Figure 2). Molineidae family species (N. oiratianus and N. spathiger) were found to be closer in evolutionary relationship to Dictyocaulidae family species (D. viviparous and D. eckerti) compared to Trichostrongylus spp., (O. trifurcata, T. circumcincta) and Cooperidae (C. oncophora). The results in our study were consistent with earlier studies [22,31].

4. Implications and Significance

Gastrointestinal nematodes causing animal infections including ostertagiosis can sometimes be diagnosed on the basis of clinical presentation and symptoms such as chronic diarrhea, depressed appetite and high morbidity [1]. However, diagnosis only on the basis of clinical symptoms is usually unreliable as these symptoms can be present in animals with one or more gastrointestinal nematode members. The morphological identification of O. trifurcata is also not reliable enough at the larval stages. Fortunately, numerous DNA scientific methods have been developed as diagnostic tools for a number of nematodes [39,40,41,42]. The ITS-2 region has been used as a molecular marker for diagnosis and epidemiological investigation [43,44,45,46]. Therefore, the characterization of the mt genome of O. trifurcata now provides the basis for the development of innovative analytical and diagnostic tools as well as novel genetic markers.
The mt genome sequences, particularly sequences of protein coding genes have been used effectively for the systematic examination of the nematodes [9,17,27,47,48,49,50]. Consequently, we ascertained the mt genome of O. trifurcata in the current study, allowing a reassessment of systematic relationships using the datasets of Trichostrongyloidea nematodes. Regarding the members of Trichostrongyloidea (Trichostrongylidea, Cooperiidae, Haemonchidae, Molineidae and Dictyocaulidae), there have been disagreements about their systematic taxonomy. To date, the mt genomes of a number of species belonging to Trichostrongyloidea are not represented or are underrepresented. Therefore, expansion of the taxa sampling is very important to carrying out phylogenetic studies of Trichostrongyloidea species utilizing the mt genome datasets in the future.

5. Conclusions

The complete mt genome of O. trifurcata was determined in the present study. The molecular data presented in this study provides new mtDNA resources for the better consideration of phylogeny and mt genomics. It also provides useful and unique genetic markers for studying the diagnosis, molecular epidemiology, systematics and population genetics of O. trifurcata in small ruminants.

Author Contributions

Conceptualization, M.H.; Methodology, A.A.A.; Software, not applicable; Validation, A.A.A., X.Y. (Xin Yang), M.H.; Formal Analysis, A.A.A., X.Y. (Xin Yang), Investigation, A.A.A., T.Z., C.W., C.Z., X.Y. (Xingrun Yan), M.H.; Resources, M.H.; Data Curation, A.A.A.; Writing—Original Draft Preparation, A.A.A.; Writing—Review & Editing, A.A.A., X.Y. (Xin Yang), M.I., M.H.; Supervision, M.H.; Project Administration, M.H.; Funding Acquisition, M.H.

Funding

This research was funded by National Key Research and Development Program of China (2018YFD0501600) to M.H.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Gasser, R.B.; Bott, N.J.; Chilton, N.B.; Hunt, P.; Beveridge, I. Toward practical, DNA-based diagnostic methods for parasitic nematodes of livestock—Bionomic and biotechnological implications. Biotechnol. Adv. 2008, 26, 325–334. [Google Scholar] [CrossRef] [PubMed]
  2. Ma, J.; He, S.W.; Li, H.; Guo, Q.C.; Pan, W.W.; Wang, X.J.; Zhang, J.; Liu, L.Z.; Liu, W.; Liu, Y. First survey of helminths in adult goats in Hunan Province, China. Trop. Biomed. 2014, 31, 261–269. [Google Scholar] [PubMed]
  3. Blaxter, M.L.; De Ley, P.; Garey, J.R.; Llu, L.X.; Scheldeman, P.; Vierstraete, A.; Vanfleteren, J.R.; Mackey, L.Y.; Dorrls, M.; Frisse, L.M.; et al. A molecular evolutionary framework for the phylum Nematoda. Nature 1998, 392, 71–75. [Google Scholar] [CrossRef] [PubMed]
  4. Blaxter, M.; Koutsovoulos, G. The evolution of parasitism in Nematoda. Parasitology 2015, 142, S26–S39. [Google Scholar] [CrossRef] [PubMed]
  5. Waghorn, T.S.; Bouchet, C.L.G.; Bekelaar, K.; Leathwick, D.M. Nematode parasites in young cattle: What role for unexpected species? N. Z. Vet. J. 2019, 67, 40–45. [Google Scholar] [CrossRef] [PubMed]
  6. Hoberg, E.P.; Lichtenfels, J.R. Phylogenetic systematic analysis of the Trichostrongylidae (Nematoda), with an initial assessment of coevolution and biogeography. J. Parasitol. 1994, 80, 976–996. [Google Scholar] [CrossRef] [PubMed]
  7. Tariq, K.A. A Review of the Epidemiology and Control of Gastrointestinal Nematode Infections of Small Ruminants. Proc. Natl. Acad. Sci. India Sect. B Biol. Sci. 2015, 85, 693–703. [Google Scholar] [CrossRef]
  8. Wall, R. Veterinary Parasitology, 4th ed.; Wiley: Hoboken, NJ, USA, 2016. [Google Scholar]
  9. Sun, M.M.; Liu, G.H.; Ando, K.; Woo, H.C.; Ma, J.; Sohn, W.M.; Sugiyama, H.; Zhu, X.Q. Complete mitochondrial genomes of Gnathostoma nipponicum and Gnathostoma sp., and their comparison with other Gnathostoma species. Infect. Genet. Evol. 2017, 48, 109–115. [Google Scholar] [CrossRef]
  10. Wolstenholme, D.R. Animal Mitochondrial DNA: Structure and Evolution. Int. Rev. Cytol. 1992, 141, 173–216. [Google Scholar]
  11. Boore, J.L. Animal mitochondrial genomes. Nucleic Acids Res. 1999, 27, 1767–1780. [Google Scholar] [CrossRef] [Green Version]
  12. Liu, G.-H.; Lin, R.-Q.; Li, M.-W.; Liu, W.; Liu, Y.; Yuan, Z.-G.; Song, H.-Q.; Zhao, G.-H.; Zhang, K.-X.; Zhu, X.-Q. The complete mitochondrial genomes of three cestode species of Taenia infecting animals and humans. Mol. Biol. Rep. 2011, 38, 2249–2256. [Google Scholar] [CrossRef] [PubMed]
  13. Song, F.; Li, H.; Shao, R.; Shi, A.; Bai, X.; Zheng, X.; Heiss, E.; Cai, W. Rearrangement of mitochondrial tRNA genes in flat bugs (Hemiptera: Aradidae). Sci. Rep. 2016, 6, 2–11. [Google Scholar] [CrossRef] [PubMed]
  14. Song, N.; Cai, W.; Li, H. Deep-level phylogeny of Cicadomorpha inferred from mitochondrial genomes sequenced by NGS. Sci. Rep. 2017, 7, 1–11. [Google Scholar] [CrossRef] [PubMed]
  15. Herd, K.E.; Barker, S.C.; Shao, R. The mitochondrial genome of the chimpanzee louse, Pediculus schaeffi: Insights into the process of mitochondrial genome fragmentation in the blood-sucking lice of great apes. BMC Genom. 2015, 16, 1–8. [Google Scholar] [CrossRef] [PubMed]
  16. Li, H.; Leavengood, J.M.; Chapman, E.G.; Burkhardt, D.; Song, F.; Jiang, P.; Liu, J.; Zhou, X.; Cai, W. Mitochondrial phylogenomics of Hemiptera reveals adaptive innovations driving the diversification of true bugs. Proc. R. Soc. B Biol. Sci. 2017, 284, 20171223. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  17. Wang, B.J.; Gu, X.B.; Yang, G.Y.; Wang, T.; Lai, W.M.; Zhong, Z.J.; Liu, G.H. Mitochondrial genomes of Heterakis gallinae and Heterakis beramporia support that they belong to the infraorder Ascaridomorpha. Infect. Genet. Evol. 2016, 40, 228–235. [Google Scholar] [CrossRef] [PubMed]
  18. Gouÿ De Bellocq, J.; Ferté, H.; Depaquit, J.; Justine, J.L.; Tillier, A.; Durette-Desset, M.C. Phylogeny of the Trichostrongylina (Nematoda) inferred from 28S rDNA sequences. Mol. Phylogenet. Evol. 2001, 19, 430–442. [Google Scholar] [CrossRef]
  19. Jex, A.R.; Hall, R.S.; Littlewood, D.T.J.; Gasser, R.B. An integrated pipeline for next-generation sequencing and annotation of mitochondrial genomes. Nucleic Acids Res. 2009, 38, 522–533. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  20. Durette-Desset, M.-C. Trichostrongyloid Nematodes and their Vertebrate Hosts: Reconstruction of the Phylogeny of a Parasitic Group. Adv. Parasitol. 1985, 24, 239–306. [Google Scholar] [PubMed]
  21. Durette-Desset, M.C.; Chabaud, A.G. Strongylida Nomenclature for Taxa above the Family Group. Ann. Parasitol. Hum. Comp. 1993, 68, 111–112. [Google Scholar] [CrossRef]
  22. Zhao, G.H.; Jia, Y.Q.; Cheng, W.Y.; Zhao, W.; Bian, Q.Q.; Liu, G.H. Characterization of the complete mitochondrial genomes of Nematodirus oiratianus and Nematodirus spathiger of small ruminants. Parasites Vectors 2014, 7, 1–9. [Google Scholar] [CrossRef] [PubMed]
  23. Lin, R.Q.; Liu, G.H.; Hu, M.; Song, H.Q.; Wu, X.Y.; Li, M.W.; Zhang, Y.; Zou, F.C.; Zhu, X.Q. Oesophagostomum dentatum and Oesophagostomum quadrispinulatum: Characterization of the complete mitochondrial genome sequences of the two pig nodule worms. Exp. Parasitol. 2012, 131, 1–7. [Google Scholar] [CrossRef] [PubMed]
  24. Anshary, H.; Sriwulan; Freeman, M.A.; Ogawa, K. Occurrence and molecular identification of Anisakis Dujardin, 1845 from marine fish in southern Makassar Strait, Indonesia. Korean J. Parasitol. 2014, 52, 9–19. [Google Scholar] [CrossRef]
  25. Hu, M.; Chilton, N.B.; Gasser, R.B. Long PCR-based amplification of the entire mitochondrial genome from single parasitic nematodes. Mol. Cell. Probes 2002, 16, 261–267. [Google Scholar] [CrossRef] [PubMed]
  26. Hu, M.; Jex, A.R.; Campbell, B.E.; Gasser, R.B. Long pcr amplification of the entire mitochondrial genome from individual helminths for direct sequencing. Nat. Protoc. 2007, 2, 2339–2344. [Google Scholar] [CrossRef] [PubMed]
  27. Liu, G.H.; Jia, Y.Q.; Wang, Y.N.; Zhao, G.H.; Zhu, X.Q. The complete mitochondrial genome of the gullet worm gongylonema pulchrum: Gene content, arrangement, composition and phylogenetic implications. Parasites Vectors 2015, 8, 1–8. [Google Scholar] [CrossRef] [PubMed]
  28. Guo, A. Complete mitochondrial genome of Anoplocephala magna solidifying the species. Korean J. Parasitol. 2016, 54, 369–373. [Google Scholar] [CrossRef]
  29. Laslett, D.; Canbäck, B. ARWEN: A program to detect tRNA genes in metazoan mitochondrial nucleotide sequences. Bioinformatics 2008, 24, 172–175. [Google Scholar] [CrossRef]
  30. Hu, M.; Chilton, N.B.; Gasser, R.B. The mitochondrial genomes of the human hookworms, Ancylostoma duodenale and Necator americanus (Nematoda: Secernentea). Int. J. Parasitol. 2002, 32, 145–158. [Google Scholar] [CrossRef]
  31. Sun, M.M.; Han, L.; Zhang, F.K.; Zhou, D.H.; Wang, S.Q.; Ma, J.; Zhu, X.Q.; Liu, G.H. Characterization of the complete mitochondrial genome of Marshallagia marshalli and phylogenetic implications for the superfamily Trichostrongyloidea. Parasitol. Res. 2018, 117, 307–313. [Google Scholar] [CrossRef]
  32. VAN DER VEER, M.; DE VRIES, E. A single nucleotide polymorphism map of the mitochondrial genome of the parasitic nematode Cooperia oncophora. Parasitology 2004, 128, 421–431. [Google Scholar] [CrossRef] [PubMed]
  33. Jex, A.R.; Hu, M.; Littlewood, D.T.J.; Waeschenbach, A.; Gasser, R.B. Using 454 technology for long-PCR based sequencing of the complete mitochondrial genome from single Haemonchus contortus (Nematoda). BMC Genom. 2008, 9, 1–14. [Google Scholar] [CrossRef] [PubMed]
  34. Gasser, R.B.; Jabbar, A.; Mohandas, N.; Höglund, J.; Hall, R.S.; Littlewood, D.T.J.; Jex, A.R. Assessment of the genetic relationship between Dictyocaulus species from Bos taurus and Cervus elaphus using complete mitochondrial genomic datasets. Parasites Vectors 2012, 5, 241. [Google Scholar] [CrossRef] [PubMed]
  35. Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [PubMed]
  36. Liu, G.H.; Nadler, S.A.; Liu, S.S.; Podolska, M.; D’Amelio, S.; Shao, R.; Gasser, R.B.; Zhu, X.Q. Mitochondrial phylogenomics yields strongly supported hypotheses for ascaridomorph nematodes. Sci. Rep. 2016, 6, 1–8. [Google Scholar] [CrossRef] [PubMed]
  37. Liu, G.H.; Wang, Y.; Xu, M.J.; Zhou, D.H.; Ye, Y.G.; Li, J.Y.; Song, H.Q.; Lin, R.Q.; Zhu, X.Q. Characterization of the complete mitochondrial genomes of two whipworms Trichuris ovis and Trichuris discolor (Nematoda: Trichuridae). Infect. Genet. Evol. 2012, 12, 1635–1641. [Google Scholar] [CrossRef] [PubMed]
  38. Shadel, G.S.; Clayton, D.A. Mitochondrial DNA maintenance in vertebrates. Annu. Rev. Biochem. 1997, 66, 409–435. [Google Scholar] [CrossRef]
  39. Lodh, N.; Caro, R.; Sofer, S.; Scott, A.; Krolewiecki, A.; Shiff, C. Diagnosis of Strongyloides stercoralis: Detection of parasite-derived DNA in urine. Acta Trop. 2016, 163, 9–13. [Google Scholar] [CrossRef]
  40. Fernández-Soto, P.; Sánchez-Hernández, A.; Gandasegui, J.; Bajo Santos, C.; López-Abán, J.; Saugar, J.M.; Rodríguez, E.; Vicente, B.; Muro, A. Strong-LAMP: A LAMP Assay for Strongyloides spp. Detection in Stool and Urine Samples. Towards the Diagnosis of Human Strongyloidiasis Starting from a Rodent Model. PLoS Negl. Trop. Dis. 2016, 10, e0004836. [Google Scholar] [CrossRef]
  41. Solórzano-García, B.; Pérez-Ponce de León, G. Helminth parasites of howler and spider monkeys in Mexico: Insights into molecular diagnostic methods and their importance for zoonotic diseases and host conservation. Int. J. Parasitol. Parasites Wildl. 2017, 6, 76–84. [Google Scholar] [CrossRef]
  42. Roeber, F.; Morrison, A.; Casaert, S.; Smith, L.; Claerebout, E.; Skuce, P. Multiplexed-tandem PCR for the specific diagnosis of gastrointestinal nematode infections in sheep: An European validation study. Parasites Vectors 2017, 10, 1–11. [Google Scholar] [CrossRef] [PubMed]
  43. Gasser, R.B.; Chilton, N.B.; Hoste, H.; Beveridge, I. Rapid sequencing of rDNA from single worms and eggs of parasitic helminths. Nucleic Acids Res. 1993, 21, 2525–2526. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Lee, Y.; Choi, Y.; Min, B. PCR-RFLP and sequence analysis of the rDNA ITS region in the Fusarium spp. J. Microbiol. 2000, 38, 66–73. [Google Scholar]
  45. Lotfy, W.M.; Brant, S.V.; Ashmawy, K.I.; Devkota, R.; Mkoji, G.M.; Loker, E.S. A molecular approach for identification of paramphistomes from Africa and Asia. Vet. Parasitol. 2010, 174, 234–240. [Google Scholar] [CrossRef] [PubMed]
  46. Nguyen, T.D.; Le, Q.D.; Huynh, V.V.; Nguyen, S.T.; Nguyen, T.V.; Vu-Khac, H. The development of PCR methodology for the identification of species of the tapeworm Moniezia from cattle, goats and sheep in central Vietnam. J. Helminthol. 2012, 86, 426–429. [Google Scholar] [CrossRef] [PubMed]
  47. Kim, J.; Kern, E.; Kim, T.; Sim, M.; Kim, J.; Kim, Y.; Park, C.; Nadler, S.A.; Park, J.K. Phylogenetic analysis of two Plectus mitochondrial genomes (Nematoda: Plectida) supports a sister group relationship between Plectida and Rhabditida within Chromadorea. Mol. Phylogenet. Evol. 2017, 107, 90–102. [Google Scholar] [CrossRef] [PubMed]
  48. Aghazadeh, M.; Traub, R.J.; Mohandas, N.; Aland, K.V.; Reid, S.A.; McCarthy, J.S.; Jones, M.K. The mitochondrial genome of Angiostrongylus mackerrasae as a basis for molecular, epidemiological and population genetic studies. Parasites Vectors 2015, 8, 1–11. [Google Scholar] [CrossRef] [PubMed]
  49. Blouin, M.S. Molecular prospecting for cryptic species of nematodes: Mitochondrial DNA versus internal transcribed spacer. Int. J. Parasitol. 2002, 32, 527–531. [Google Scholar] [CrossRef]
  50. Sun, M.M.; Ma, J.; Sugiyama, H.; Ando, K.; Li, W.W.; Xu, Q.M.; Liu, G.H.; Zhu, X.Q. The complete mitochondrial genomes of Gnathostoma doloresi from China and Japan. Parasitol. Res. 2016, 115, 4013–4020. [Google Scholar] [CrossRef]
Genes 10 00107 g001 550
Figure 1. Mitochondrial genome arrangement of Ostertagia trifurcata. The scales are similar and all the genes are transcribed in the clockwise direction. The genes follow the standard nomenclature, except for the 22 tRNA genes, which are designated using one-letter amino acid codes with numerals differentiating each of the two leucine and arginine-specifying tRNAs (L1 and L2 for codon families UUR and CUN, respectively; R1 and R2 for codon families AGR and CGN, respectively). The tRNA genes and atp6 located on the inner circle indicate regions of gene overlap.
Figure 1. Mitochondrial genome arrangement of Ostertagia trifurcata. The scales are similar and all the genes are transcribed in the clockwise direction. The genes follow the standard nomenclature, except for the 22 tRNA genes, which are designated using one-letter amino acid codes with numerals differentiating each of the two leucine and arginine-specifying tRNAs (L1 and L2 for codon families UUR and CUN, respectively; R1 and R2 for codon families AGR and CGN, respectively). The tRNA genes and atp6 located on the inner circle indicate regions of gene overlap.
Genes 10 00107 g001
Genes 10 00107 g002 550
Figure 2. Phylogenetic tree inferred from concatenated amino acid sequences of 12 protein coding genes of key parasitic nematodes belonging to the Trichostrongyloidea family. Phylogenetic relationships of Ostertagia trifurcata and other members of Trichostrongyloidea were inferred using the neighbor joining (NJ), maximum likelihood (ML) and maximum parsimony (MP) methods. Oesophagostomum quadrispinulatum (GenBank accession number NC_014181) was chosen as the outgroup. The numbers along the branches indicate bootstrap values resulting from the analysis using NJ/ML/MP, where the values under 50 are given as “–”.
Figure 2. Phylogenetic tree inferred from concatenated amino acid sequences of 12 protein coding genes of key parasitic nematodes belonging to the Trichostrongyloidea family. Phylogenetic relationships of Ostertagia trifurcata and other members of Trichostrongyloidea were inferred using the neighbor joining (NJ), maximum likelihood (ML) and maximum parsimony (MP) methods. Oesophagostomum quadrispinulatum (GenBank accession number NC_014181) was chosen as the outgroup. The numbers along the branches indicate bootstrap values resulting from the analysis using NJ/ML/MP, where the values under 50 are given as “–”.
Genes 10 00107 g002
Table
Table 1. Sequences of primers used to amplify ITS-2 region and long fragments of mitochondrial DNA from Ostertagia trifurcata.
Table 1. Sequences of primers used to amplify ITS-2 region and long fragments of mitochondrial DNA from Ostertagia trifurcata.
PrimerSequence (5′ to 3′)Region
NC5GTAGGTGAACCTGCGGAAGGATITS-2
NC2TTAGTTTCTTTTCCTCCGCT
37FGGAGTAAAGTTGTATTTAAACrrnS-cytb
36RCCTCAAACTAAAACATAACC
45FACTAGTTTGTTAAGTGTTATTCCTcytb-ox1
48RATAAACCTCAGGATGCCCAAAAAA
CO1FTTTTTTGGGCATCCTGAGGTTTATcox1-rrnL
40RGAATTAAACTAATATCACGT
39FTAAATGGCAGTCTTAGCGTGArrnL-rrnS
4RTCTACTTTACTACAACTTACTCC
Table
Table 2. Structure of the mitochondrial genome of Ostertagia trifurcata and nucleotide positions of the starting and termination sites as well as the length of each gene and the number of encoded amino acids, starting and terminator codons of protein coding genes and anticodons for tRNAs starting from trnC.
Table 2. Structure of the mitochondrial genome of Ostertagia trifurcata and nucleotide positions of the starting and termination sites as well as the length of each gene and the number of encoded amino acids, starting and terminator codons of protein coding genes and anticodons for tRNAs starting from trnC.
Gene/codonsPosition and sequence length of ntAmino acidsStart/stop codonsAnticodons
cox11–1578 (1578)525ATT/TAA
trnC1578–1634 (57) GCA
trnM1753–1813 (61) CAT
trnD1823–1876 (54) GTC
trnG1893–1948 (56) TCC
cox21937–2644 (708)235ATT/TAA
trnH2644–2699 (56) GTG
rrnL2700–4014 (1315)
nad34048–4398 (351)116ATA/TAG
nad54405–6030 (1626)541ATT/TAA
trnA5986–6044 (59) TGC
trnP6102–6162 (61) TGG
trnR1 (AGR)6227–6288 (62) TCT
LNCR6289–6596 (308)
trnV6597–6653 (57) TAC
nad66623–6928 (306)101ATT/TAA
nad4L 7110–7352 (243)80ATG/TAA
trnW7332–7389 (58) TCA
trnE7523–7577 (55) TTC
rrnS7578–8270 (693)
trnS8277–8330 (54) TGA
trnN8376–8431 (56) GTT
trnY8502–8556 (55) GTA
nad18578–9432 (855)284ATT/TAA
atp69428–10045 (618)205ATT/TAA
trnK10025–10088(64) TTT
trnL1 (UUR)10153–10210 (58) TAA
nad210302–11126 (825)274ATT/TAA
trnI11141–11205 (65) GAT
trnR2 (CGN)11211–11277 (67) ACG
trnQ11280–11336 (57) TTG
trnF11337–11403 (67) GAA
cytb11415–12251 (837)278ATA/TAA
trnL2 (CUN)12435–12490 (56) TAG
cox312401–13294 (894)297ATA/TAA
trnT13244–13301 (58) TGT
nad413301–14038 (738)245ATT/TAG
SNCR14039–14151 (113)
*LNCR—large non-coding region, SNCR—short non-coding region.
Table
Table 3. Composition of nucleotides and skew values of Ostertagia trifurcata mitochondrial protein-coding genes.
Table 3. Composition of nucleotides and skew values of Ostertagia trifurcata mitochondrial protein-coding genes.
GeneAGCTA+T (%)AT skewGC skew
cox125.9820.0810.8943.0269.00−0.24−0.29
cox231.3517.378.6142.6574.00−0.15−0.33
nad333.3313.963.7049.0082.33−0.19−0.58
nad531.5413.716.3948.3379.87−0.21−0.36
nad627.1214.054.9053.9281.04−0.33−0.48
nad4L32.0916.872.4648.5580.64−0.20−0.74
nad125.8417.667.9548.5374.37−0.30−0.37
atp628.9617.316.1447.5776.53−0.24−0.47
nad230.4211.635.2152.7283.14−0.26−0.38
cytb27.8318.879.6743.8471.67−0.22 −0.32
cox328.6316.557.6047.2075.83−0.24−0.37
nad429.1313.417.0450.4079.53−0.26−0.31
rrnL37.7912.246.0843.8781.66−0.07−0.33
rrnS36.6514.717.6440.9877.63−0.05−0.31
LNCR37.6616.882.9242.5380.19−0.06−0.70
SNCR32.7410.6113.2743.3676.10−0.13−0.11
Overall 32.78 14.886.9845.3578.13−0.16−0.36

Share and Cite

MDPI and ACS Style

Ahmad, A.A.; Yang, X.; Zhang, T.; Wang, C.; Zhou, C.; Yan, X.; Hassan, M.; Ikram, M.; Hu, M. Characterization of the Complete Mitochondrial Genome of Ostertagia trifurcata of Small Ruminants and its Phylogenetic Associations for the Trichostrongyloidea Superfamily. Genes 2019, 10, 107. https://doi.org/10.3390/genes10020107

AMA Style

Ahmad AA, Yang X, Zhang T, Wang C, Zhou C, Yan X, Hassan M, Ikram M, Hu M. Characterization of the Complete Mitochondrial Genome of Ostertagia trifurcata of Small Ruminants and its Phylogenetic Associations for the Trichostrongyloidea Superfamily. Genes. 2019; 10(2):107. https://doi.org/10.3390/genes10020107

Chicago/Turabian Style

Ahmad, Awais Ali, Xin Yang, Ting Zhang, Chunqun Wang, Caixian Zhou, Xingrun Yan, Mubashar Hassan, Muhammad Ikram, and Min Hu. 2019. "Characterization of the Complete Mitochondrial Genome of Ostertagia trifurcata of Small Ruminants and its Phylogenetic Associations for the Trichostrongyloidea Superfamily" Genes 10, no. 2: 107. https://doi.org/10.3390/genes10020107

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop