Next Article in Journal
Implications of Accuracy of Global Glacier Inventories in Hydrological Modeling: A Case Study of the Western Himalayan Mountain Range
Previous Article in Journal
Effects of Geometry on Artificial Tracer Dispersion in Synthetic Karst Conduit Networks
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Water
Volume 15
Issue 22
10.3390/w15223886
water-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genetic Diversity and Population Dynamics of Invasive Ascidiella aspersa: Insights from Cytochrome Oxidase Subunit I and 18S rDNA Analyses in Korean and Global Populations

by
Jeounghee Lee
1,
Soyeon Kwon
2,
Michael Dadole Ubagan
1,2,
Taekjun Lee
1,2 and
Sook Shin
1,2,*
1
Marine Biological Resource Institute, Sahmyook University, Seoul 01795, Republic of Korea
2
Department of Animal Biotechnology & Resource, College of Science and Technology, Sahmyook University, Seoul 01795, Republic of Korea
*
Author to whom correspondence should be addressed.
Water 2023, 15(22), 3886; https://doi.org/10.3390/w15223886
Submission received: 14 September 2023 / Revised: 14 October 2023 / Accepted: 29 October 2023 / Published: 7 November 2023
(This article belongs to the Topic Marine Microorganisms: Diversity, Bioactivity and Applications)
Browse Figures
Review Reports Versions Notes

Abstract

:
Ascidiella aspersa, originally native to the northeastern Atlantic, has emerged as a prolific invasive species in coastal waters worldwide. In 2010, it was identified as an alien species in Republic of Korea, rapidly colonizing artificial harbor structures and outcompeting native species. This study employs morphological analyses and genetic sequencing, focusing on mitochondrial DNA (cytochrome oxidase subunit I; mt-COI) and nuclear markers (18S rRNA), to unravel the genetic structure and haplotype diversity (Hd) of A. aspersa populations in Republic of Korea and globally. The analysis of 154 mt-COI and 127 18S rDNA global population sequences, as well as 80 mt-COI and 79 18S-rDNA Korean population sequences, revealed distinct genetic patterns. Among global populations, the mt-COI gene displayed significant genetic diversity, with 21 distinct haplotypes distributed across 41 polymorphic sites, which is indicative of extensive genetic variability. In contrast, the 18S rDNA marker exhibited limited diversity, with only four haplotypes identified at three polymorphic sites. In Korean populations, the mt-COI gene also exhibited substantial genetic diversity, with 14 distinct haplotypes displaying genetic variations at 29 polymorphic sites. Conversely, the 18S rDNA marker in Korean populations revealed a unique genetic pattern, with only one shared haplotype. These findings emphasize the complex genetic diversity within A. aspersa populations, both globally and in Republic of Korea. This genetic analysis provides valuable insights into the species’ colonization history and adaptation mechanisms, shedding light on the factors shaping its genetic structure. Further research is warranted to elucidate the ecological implications of these genetic patterns in the context of invasion biology.

1. Introduction

The rapid increase in the global proliferation of invasive marine species has negative impacts on endemic biodiversity and aquatic ecosystems [1,2]. Invasive marine organisms often possess competitive advantages over native species, allowing them to colonize new locations and artificial structures more abundantly [3,4,5,6]. This colonization signifies significant ecological changes within invaded areas. Among these invasive species, Ascidians, specifically Ascidiella aspersa (European sea squirt), have emerged as a significant issue, particularly in harbors where they attach to artificial underwater structures [7,8].
A. aspersa is native to Norway in the NE Atlantic [9,10,11,12,13] and has also been found in the northern Mediterranean. However, this species has since invaded various parts of the world, including Australia [4,14], Argentina [15,16], Iceland [17], India [18], Japan [19,20,21], Republic of Korea [22], New Zealand [23,24], the NW Atlantic including the USA [25,26], Canada [27,28], and South Africa [29]. It spreads through ballast water or attachments to ship hulls, allowing it to easily migrate and colonize farming facilities, fishing gear, and port infrastructure, resulting in significant damage. A. aspersa has the potential to be a successful invader due to its rapid growth rate, short lifespan, production of large numbers of short-lived non-feeding planktonic larvae, lack of predators, and tolerance to a wide range of environmental conditions [8,19,30]. The biological advantages of A. aspersa may lead to the formation of large populations and subsequent high biomass of A. aspersa. Colonization by A. aspersa may provide them with a significant advantage in the competition for habitats against native species and other species [25,31]. For that reason, this species was registered in the Global Invasive Species Database (GISD) in 2010.
In Republic of Korea, A. aspersa was first confirmed in the Tongyong yacht marina in 2010 and has since spread along the eastern coast, including areas such as Gunsan, Jindo, Jeju Island, Wando (WD), and Yeosu (YS). Currently, it has invaded and inhabited the entire sea area, including coastal sites and Jeju Island. Monitoring efforts for A. aspersa have been ongoing since 2008, and several studies have been conducted to understand its morphology, phylogenetic relationships, risk assessment, damage analysis, and physiological and ecological aspects [7,22,32].
The present study focuses on evaluating the population genetic structures of A. aspersa in Korean and global populations using cytochrome oxidase subunit I (COI) data. The analysis included genetic mutations in the COI gene of sea squirts found along the coast of the Korean Peninsula. The haplotype analysis of mitochondrial DNA (mtDNA) sequences from populations in 10 countries provided insights into invasion pathways, potential sources of origin, and information for predicting the introduction time, location, and transport vectors of this species. This knowledge aids in estimating subsequent spread routes to other regions. Therefore, this study aimed to contribute to the understanding of population genetics in A. aspersa and provide valuable insights for predicting and managing the spread of this invasive species.

2. Materials and Methods

2.1. Sample Collection

2.1.1. Korean Coast Population

Between April and October 2021, we collected 80 European sea squirts from 10 harbors (or ports) along the coast of Republic of Korea (Figure 1, Table 1). The specimens were fixed in 96% ethanol solution at the collection site. The reproductive tracts were transported to the laboratory and subsequently immersed in 96% alcohol and stored until DNA extraction.

2.1.2. Global Population

We sequenced and aligned partial mitochondrial COI sequences of 82 European sea squirts from Republic of Korea and 72 from the nine localities of A. aspersa retrieved from GenBank [6,22,33,34,35,36,37,38]. Similarly, 18S rDNA sequences were obtained from 83 sea squirts from Republic of Korea and 44 from the four localities of A. aspersa retrieved from GenBank [6,22,34]. Detailed information, including the collection localities and GenBank accession numbers, is provided in Table 1.

2.2. DNA Extraction, PCR Amplification, and Sequence Alignment

The total genomic DNA was extracted from the gonad tissue using the DNeasy® Tissue Kit (Qiagen, Düsseldorf, Germany). DNA fragments (mt-COI and 18S rRNA) were amplified via a polymerase chain reaction (PCR) using previously published primers (Table 2).
The PCR reaction mixture contained the AccuPower® Multiplex PCR PreMix with 3 μL of genomic DNA template, 10 mM of each primer, and 18 μL of ddH2O in a total volume of 20 μL. The PCR was performed using the AllInOneCycler™ PCR system (Bioneer, Daejeon, Republic of Korea). The PCR (mt-COI and 18S-rRNA) comprised an initial denaturation step at 95 °C for 5 min, followed by 30 cycles of denaturation at 95 °C for 1 min, annealing at 48–52 °C for 1 min, and elongation at 72 °C for 1 min 30 s, with a final elongation step at 72 °C for 7 min. The PCR products were verified using 2% agarose gel electrophoresis and were sequenced by Cosmo Genetech (Seoul, Republic of Korea). These sequences were deposited in GenBank.

2.3. Phylogenetic Analyses and Genetic Diversity

The sequences of COI (657 bp) and 18S-rRNA (744 bp) segments were obtained from 80 and 79 sea squirts, respectively. All sequences were submitted to the GenBank database under accession numbers (OQ722425-OQ722433, OR131195-OR131264 for mt-COI, and OR453000-OR453078 for 18s-rRNA).
Alignment and sequence verifications for mt-COI and 18S-rRNA were performed using MAFFT v7.49 [41] in Geneious Prime 2019.2.1 [42] (Biomatters Ltd., Auckland, New Zealand) and by applying the L-INS-I setting (Scoring matrix: 200PAM/k = 2). All haplotypes were defined using DnaSP 6.0, and the specific genetic diversity indices for each population, including the number of polymorphic sites (S), nucleotide diversity (π), number of haplotypes (h), and haplotype diversity (Hd), were calculated using DnaSP 6.0 [43]. To evaluate the historical demography, Fu’s Fs statistics and Tajima’s D were calculated using Arlequin 3.5.2.2 with 1000 permutations to test for neutrality. The values of the fixation index (FST) between different populations and the analyses of molecular variance components (AMOVA) were also calculated using Arlequin 3.5.2.2. [44]. Genetic distances among the sampled locations were computed in MEGA 11.0 using the Pairwise Kimura 2-parameter (K2P) distance model of nucleotide substitution [45]. The haplotype networks were individually generated based on the mt-COI and 18S DNA gene sequences using the TCS plug-in [46] in PopART v. 1.7 [47] to evaluate the genealogy patterns of the haplotypes.

3. Results

3.1. Genetic Diversity and Population Structure of A. aspersa

3.1.1. mt-COI

In the Korean population, we collected samples from 80 European sea squirts across 10 harbors or ports, resulting in the identification of 14 distinct mt-COI haplotypes (Figure 2, Table S1).
These haplotypes exhibited variations at 29 polymorphic sites. The Hd was 0.785, and the nucleotide diversity (π) was 0.00853. The most prevalent haplotype, Hap_3, was present in all 10 populations, with 33 sea squirts (41.25%) matching this haplotype. Six haplotypes were unique to their respective populations (Figure 2, Table 3).
Yeosu had the highest Hd of 0.8571 ± 0.1083 and nucleotide diversity (π) of 0.0102 ± 0.0061, whereas the Tongyeong (TY) population exhibited the lowest haplotype and nucleotide diversities (0.6429 ± 0.1841 and 0.0022 ± 0.0017, respectively) (Table 4).
The analysis of variance (ANOVA) revealed that 4.39% of the genetic variation was attributed to differences among the 10 populations, with the remaining 95.61% within the populations. The overall Fst value was 0.04394 (p = 0.09271 ± 0.01575; p > 0.05), indicating high genetic variation within populations (Table S2). Pairwise genetic distances (K2P) within populations ranged from 0.0022 to 0.0119, whereas distances among populations ranged from 0.0024 to 0.0099 (Table S3). The largest genetic differences were observed between Donghae (DH) and TY, whereas the smallest differences were observed between WD and YS. The haplotype network demonstrated the diversity indices and results of the AMOVA, featuring one common haplotype and six unique haplotypes across the 10 populations (Figure 2). In the 18S-rDNA analysis, 79 sea squirts shared a single haplotype. The presence of unique mutations and low sequence divergence suggests the potential for rapid population expansion.
Regarding the global population, we analyzed mt-COI sequences from 154 sea squirts across nine countries, including two sea squirts from the Korean population. This resulted in the identification of 21 mt-COI haplotypes, which varied at 41 polymorphic sites (Figure 3, Table S4).
The global population exhibited Hd of 0.781 and nucleotide diversity (π) of 0.00601. The dominant haplotypes were hap_2 (matched by 63 sea squirts; 40.9%), hap_1 (matched by 30 individuals; 19.48%), and hap_10 (matched by 14 sea squirts; 9.09%) (Table S4). The Spanish population exhibited the highest haplotype and nucleotide diversities (Hd = 0.9524 ± 0.0955; π = 0.0073 ± 0.0052), whereas the USA population had the lowest haplotype and nucleotide diversities (Hd = 0.3556 ± 0.1591; π = 0.00173 ± 0.00160), except for populations with a size of one (Figure 3, Table 5). The pairwise genetic distances within populations ranged from 0.0017 to 0.0053, and the distances among populations ranged from 0.0012 to 0.0784 (Table S6). The ANOVA results indicated that 27.69% of the genetic variation was among the nine populations, whereas 72.31% was within the populations. The overall Fst value was 0.2769 (p = 0.00098 ± 0.00098; p > 0.05), indicating high genetic variation within the populations (Table S2).

3.1.2. 18S-rDNA

Conversely, the 18S rDNA marker exhibited a more constrained genetic diversity among global populations. We identified five haplotypes, differing at only three polymorphic sites. The Hd was 0.0774, and the nucleotide diversity (π) was 0.00008. The most common haplotype, Hap_1, was found in all regions, with 124 sea squirts matching this haplotype. Four haplotypes were unique to their respective populations (Table S6). The English population exhibited the highest haplotype and nucleotide diversities (Hd = 0.9524 ± 0.0955; π = 0.0073 ± 0.0052) (Figure 2, Table 6). In contrast, despite comprising the largest number of sea squirts, the Korean population exhibited only two haplotypes (Hap_1 and Hap_5), signifying a notably low genetic diversity within this population (Hd = 00.0476 ± 0.0321; π = 0.000081 ± 0.000220) (Table 6). It is noteworthy that this outcome incorporated data from four sea squirts (JN573230-JN573233) from a prior study [22]. Remarkably, the sea squirts obtained in the current study shared only one (Hap_1) of these two haplotypes (Table S6). The AMOVA results revealed that 1.39% of the genetic variation was attributed to differences among the five populations, whereas 98.61% was within the populations (Table S7). The overall Fst value was 0.01390 (p = 0.06940 ± 0.00772; p > 0.05, indicating high genetic variation within the populations. The pairwise genetic distances (K2P) within the populations ranged from 0.000000 to 0.000570, whereas distances among the populations ranged from 0.000000 to 0.0003614 (Table S8).
The findings regarding the genetic diversity and population structure of A. aspersa indeed offer valuable insights into its colonization history and potential for population expansion. The stark differences in genetic diversity between the Korean population and the global population, as indicated by the 18S-rDNA and mt-COI markers, provide clues about the species’ history and dynamics. The low genetic diversity observed in the 18S-rDNA marker within the Korean population, with only one haplotype being detected, suggests a relatively recent colonization event. This could mean that A. aspersa was introduced to Korean waters more recently compared to other regions where it exhibits higher genetic diversity in the mt-COI marker. Conversely, the higher genetic diversity observed in the mt-COI marker globally, with 21 haplotypes being identified across various regions, could imply that A. aspersa has been present in waters in other parts of the world for a longer time. This extended presence might have allowed for more mutations to accumulate in the COI gene, resulting in a more diverse set of haplotypes.

3.2. Neutrality Tests and Mismatch Distribution Analysis

3.2.1. mt-COI

In the Korean populations, both Fu’s Fs statistic test and Tajima’s D test yielded negative values for the Bieung (BU), TY, and DH populations. This suggests that these populations likely experienced population selection or expansion events. Conversely, the Yangpo (YP) and Sokcho (SC) populations did not exhibit significant deviations in these tests. Mismatch distribution analysis, which estimates the congruence between observed and expected distributions under a sudden expansion model, revealed statistically significant differences between the TY and DH populations based on the sum of square deviations (SSD). This further supports the notion that the BU population experienced an expansion phase. The raggedness index (Rag) varied among populations without statistical significance, except for in the YP population, which indicates the population expansion of A. aspersa within the Korean population (Table 4).
In the global population, negative values were observed in the Korean and Spanish populations in both Fu’s Fs test and Tajima’s D test. However, only the Spanish population exhibited a significant deviation in Tajima’s D test, whereas England, France, Japan, and Spain exhibited significant deviations in Fu’s Fs test (Table 4). This suggests that these populations, including those in Korea, England, and the USA, may have experienced population selection or expansion events. The SSD ranged from 0.00594 to 0.2907, and statistically significant differences (p > 0.05) were observed between the Korean, English, and USA populations. This indicates that the Spanish and French populations were not at equilibrium and were undergoing expansion. The Rag varied among populations without statistical significance, except for in the Spanish population (Table 5), which suggests the population expansion of A. aspersa in the global population.

3.2.2. 18S-rDNA

In the global population, both Fu’s Fs statistic test and Tajima’s D test yielded negative values for the English and Spanish populations. However, only the English population exhibited a significant deviation in Tajima’s D test, whereas the Korean population exhibited significant deviations in Fu’s Fs statistic test. These results suggest that the Korean population has recently undergone a demographic expansion event. The SSD ranged from 0.0001 to 0.67769, and the Rag varied among populations from 0.22658 to 0.82091. Statistically significant differences (p > 0.05) were observed between the Korean, English, and Spanish populations (Table 6).
These results obtained from neutrality tests and mismatch distribution analyses provide insights into the population dynamics, selection, and expansion events in both the Korean and global populations of A. aspersa.

4. Discussion

The genetic analysis conducted in this study provides valuable insights into the population dynamics and colonization history of Ascidiella aspersa in Korean and global populations. Notably, our findings reveal differences in the distinct genetic patterns between global and Korean populations of A. aspersa, with implications for understanding its spread and potential for population expansion.
The genetic diversity patterns observed in this study are consistent with the notion of recent colonization and population expansion in both the global and Korean populations of A. aspersa. In particular, the high genetic diversity observed in the COI gene marker globally, with 21 haplotypes being identified, suggests a longer presence of A. aspersa in other regions, allowing for more mutations to accumulate over time. In contrast, the low genetic diversity observed in the 18S rDNA marker in the Korean population, where only one haplotype was detected, suggests a lack of genetic variation within this marker within the Korean population. This is indicative of either a population bottleneck or a recent colonization event where a small number of individuals with similar genetic makeups established the population. When comparing these findings with those of previous studies, several key points come to light. First, the genetic diversity patterns in A. aspersa are consistent with those observed in other invasive marine species. For instance, similar genetic homogeneity has been reported in invasive ascidians in non-native environments [49]. Second, the presence of a single haplotype in the Korean population for the 18S rDNA marker aligns with the findings of previous studies on introduced populations of marine species [50]. This pattern is often associated with founder effects or bottleneck events during colonization. The genetic patterns observed here highlight the complex dynamics of invasive species, where rapid population expansion can contribute to the successful colonization of new areas by an invasive species. The wide distribution range and genetic connectivity of A. aspersa among populations, despite geographic distances, underscore its invasive potential.
In conclusion, this study contributes to our understanding of the genetic diversity and population dynamics of A. aspersa and sheds light on its invasive potential and population expansion patterns. The distinct genetic patterns observed among global and Korean populations highlight the complexity of invasive species dynamics. To further enhance our knowledge, it is essential to conduct future research with larger sample sizes and broader geographic ranges, thereby providing more comprehensive insights into the genetic diversity and invasion scenarios of A. aspersa populations. These expanded research efforts may help clarify the species’ colonization history, adaptive mechanisms, and factors that lead to successful invasions in various regions. It may also contribute to more effective management and conservation strategies to address the challenges posed by invasive marine organisms such as A. aspersa.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/w15223886/s1, Table S1: Haplotype distribution of Ascidiella aspersa inferred from 80 COI sequences in Korea population. Each column represents the sampling location, and the rows refer to the 14 haplotypes; Table S2. Results of mt-COI analysis of molecular variance (AMOVA) for Ascidiella aspersa along the coast of Korea and global population; Table S3. The pairwise genetic distances (K2P) mt-COI results between Korean populations; Table S4. Haplotype distribution of Ascidiella aspersa inferred from 154 mt-COI sequences in the global population. Each column represents the sampling location, and the rows refer to the 21 haplotypes in global population; Table S5. The pairwise genetic distances (K2P) mt-COI results between Global populations; Table S6. Haplotype distribution of Ascidiella aspersa inferred from 124 18S-rDNA sequences in the global population. Each column represents the sampling location, and the rows refer to the 5 haplotypes in global population; Table S7. Results of 18S-rDNA analysis of molecular variance (AMOVA) for Ascidiella aspersa along the coast of Korea and global population; Table S8. The pairwise genetic distances (K2P) among populations 18S-rDNA results between Global populations.

Author Contributions

Conceptualization, J.L., T.L. and S.S.; methodology, J.L.; software, J.L. and S.K.; formal analysis, J.L. and S.K.; investigation, J.L., S.K. and M.D.U.; resources, J.L. and S.K.; writing—original draft preparation, J.L.; writing—review and editing, J.L.; visualization, J.L.; supervision, S.S.; project administration, S.S.; funding acquisition, S.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Improvement of Management Strategies on Marine Ecosystems Disturbing and Harmful Organisms, grant number 20190518. It was also supported by the Monitoring Survey on the Distribution of Disturbing and Harmful Benthos in the Marine Ecosystem (2022) funded by the Ministry of Oceans and Fisheries.

Data Availability Statement

The presented data are available upon request and the approval of the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Bulleri, F.; Chapman, M.G. The introduction of coastal infrastructure as a driver of change in marine environments. J. Appl. Ecol. 2010, 47, 26–35. [Google Scholar] [CrossRef]
  2. Dumont, C.P.; Harris, L.G.; Gaymer, C.F. Anthropogenic structures as a spatial refuge from predation for the invasive bryozoan Bugula neritina. Mar. Ecol. Prog. Ser. 2011, 427, 95–103. [Google Scholar] [CrossRef]
  3. Dufresnes, C.; Déjean, T.; Zumbach, S.; Schmidt, B.R.; Fumagalli, L.; Ramseier, P.; Dubey, S. Early detection and spatial monitoring of an emerging biological invasion by population genetics and environmental DNA metabarcoding. Conserv. Sci. Pract. 2019, 1, e86. [Google Scholar] [CrossRef]
  4. Sams, M.A.; Keough, M.J. Predation during early post-settlement varies in importance for shaping marine sessile communities. Mar. Ecol. Prog. Ser. 2007, 348, 85–101. [Google Scholar] [CrossRef]
  5. Gittenberger, A.; van Stelt, R.C. Artificial structures in harbors and their associated ascidian fauna. Aquat. Invasions 2011, 6, 413–420. [Google Scholar] [CrossRef]
  6. López-Legentil, S.; Legentil, M.L.; Erwin, P.M.; Turon, X. Harbor networks as introduction gateways: Contrasting distribution patterns of native and introduced ascidians. Biol. Invasions 2015, 17, 1623–1638. [Google Scholar] [CrossRef]
  7. Kim, D.; Kim, M.K.; Park, J.; Kim, D.G.; Yoon, T.J.; Shin, S. Effects of Temperature and Salinity on Egg Development of Ascidiella aspersa (Ascidiacea, Phlebobranchia, Ascidiidae). Korean J. Environ. Biol. 2018, 36, 232–240. [Google Scholar] [CrossRef]
  8. Lynch, S.A.; Darmody, G.; O’Dwyer, K.; Gallagher, M.C.; Nolan, S.; McAllen, R.; Culloty, S.C. Biology of the invasive ascidian Ascidiella aspersa in its native habitat: Reproductive patterns and parasite load. Estuar. Coast. Shelf Sci. 2016, 181, 249–255. [Google Scholar] [CrossRef]
  9. Berrill, N.J. The identification and validity of certain species of ascidians. J. Mar. Biol. Assoc. United Kingd. 1928, 15, 159–175. [Google Scholar] [CrossRef]
  10. Berrill, N.J. The Tunicata: With an Account of the British Species; The University of Virginia, Ray Soc.: Charlottesville, VA, USA, 1950; no. 133; pp. 1–354. [Google Scholar]
  11. Thompson, H. The Tunicata of Scottish Area (Dictiobranchiata); H.M. Stationery Off.: London, UK, 1933. [Google Scholar]
  12. Millar, R. Tunicata Ascidiacea (Marine Invertebrates of Scandinavia no. 1); Universitetsforlaget: Oslo, Norway, 1966. [Google Scholar]
  13. Millar, R.H. British Ascidians, Tunicata: Ascidiacea; Keys and Notes for the Identification of the Species. In Synopses of the British Fauna; New Series; Academic Press for the Linnean Society of London: London, UK, 1970. [Google Scholar]
  14. Hewitt, C.L.; Campbell, M.L.; Thresher, R.E.; Martin, R.B.; Boyd, S.; Cohen, B.F.; Currie, D.R.; Gomon, M.F.; Keough, M.J.; Lewis, J.A. Introduced and cryptogenic species in port Phillip bay, Victoria, Australia. Mar. Biol. 2004, 144, 183–202. [Google Scholar]
  15. Tatián, M.; Schwindt, E.; Lagger, C.F.; Varela, M.d.L.M. Colonization of Patagonian harbours (SW Atlantic) by an invasive sea squirt. Spixiana 2010, 333, 111–117. [Google Scholar]
  16. Lazari, C.; del Socorro Doldan, M.; Carignano, A.; Orrego, M.E.; Morsan, E.M. Association of the Mytilid Musculus viator with the Invasive Tunicate Ascidiella aspersa in San Matías Gulf, Argentine Patagonia. Am. Malacol. Bull. 2018, 36, 286–290. [Google Scholar] [CrossRef]
  17. Ramos Espla, A.; Micael, J.; Halldórsson, H.P.; Gíslason, S. Iceland: A laboratory for non-indigenous ascidians. Bioinvasions Rec. 2020, 9, 450–460. [Google Scholar] [CrossRef]
  18. Nagabhushanam, A.; Krishnamoorthy, P. Occurrence and biology of the solitary ascidian Ascidiella aspersa in Tamil Nadu coastal waters. J. Mar. Biol. Assoc. India 1992, 34, 1–9. [Google Scholar]
  19. Kanamori, M.; Baba, K.; Natsuike, M.; Goshima, S. Life history traits and population dynamics of the invasive ascidian, Ascidiella aspersa, on cultured scallops in Funka Bay, Hokkaido, northern Japan. J. Mar. Biol. Assoc. U. K. 2017, 97, 387–399. [Google Scholar] [CrossRef]
  20. Goto, T.; Oba, Y. A record of utilization as a spawning bed for the invasive ascidian Ascidiella aspersa (Muller, 1776) newly introduced in the Pacific coast of northeastern Japan. Biogeography 2019, 21, 37–42. [Google Scholar]
  21. Nishikawa, T.; Yasuda, A.; Murata, Y.; Otani, M. The Earliest Japanese records of the invasive European ascidian Ascidiella aspersa (Müller, 1776) (Urochordata: Ascidiidae) from Mutsu and Ago Bays, with a brief discussion of its invasion processes. Sess. Org. 2019, 36, 1–6. [Google Scholar] [CrossRef]
  22. Pyo, J.; Lee, T.; Shin, S. Two newly recorded invasive alien ascidians (Chordata, Tunicata, Ascidiacea) based on morphological and molecular phylogenetic analysis in Korea. Zootaxa 2012, 3368, 211–228. [Google Scholar] [CrossRef]
  23. Brewin, B.I. Ascidians in the vicinity of the Portobello marine biological station, Otago harbour. Trans. Roy. Soc. N. Z. 1946, 76, 87–131. [Google Scholar]
  24. Brine, O.; Hunt, L.; Costello, M.J. Marine biofouling on recreational boats on swing moorings and berths. Manag. Biol. Invasions 2013, 4, 327. [Google Scholar] [CrossRef]
  25. Osman, R.W.; Whitlatch, R.B. Ecological interactions of invading ascidians within epifaunal communities of southern New England. In Proceedings of the Marine Bioinvasions: Proceedings of the First National Conference, Cambridge, MA, USA, 24–27 January 1999; pp. 164–174. [Google Scholar]
  26. Nydam, M.L.; Nichols, C.L.; Lambert, G. First record of the ascidian Ascidiella aspersa (Müller, 1776) in southern California. Bioinvasions Rec. 2022, 11, 416–427. [Google Scholar] [CrossRef]
  27. Moore, A.M.; Vercaemer, B.; DiBacco, C.; Sephton, D.; Ma, K.C. Invading Nova Scotia: First records of Didemnum vexillum Kott, 2002 and four more non-indigenous invertebrates in 2012 and 2013. Bioinvasions Rec. 2014, 3, 25–234. [Google Scholar] [CrossRef]
  28. Ma, K.C.; Hawk, H.L.; Goodwin, C.; Simard, N. Morphological identification of two invading ascidians: New records of Ascidiella aspersa (Müller, 1776) from Nova Scotia and Diplosoma listerianum (Milne-Edwards, 1841) from New Brunswick and Quebec. Bioinvasions Rec. 2019, 8, 50–64. [Google Scholar] [CrossRef]
  29. Rius, M.; Branch, G.M.; Griffiths, C.L.; Turon, X. Larval settlement behaviour in six gregarious ascidians in relation to adult distribution. Mar. Ecol. Prog. Ser. 2010, 418, 151–163. [Google Scholar] [CrossRef]
  30. Mackenzie, A.B.; Fisheries and Oceans Canada, Centre of Expertise for Aquatic Risk Assessment. Biological Synopsis of the Compound Sea Squirt (Diplosoma listerianum); 0706-6473; DFO: Burlington, ON, Canada, 2011. [Google Scholar]
  31. Currie, D.R.; Cohen, B.; McArthur, M. Exotic Marine Pests in the Port of Geelong, Victoria; Marine and Freshwater Resources Institute: Hafnarfjörður, Iceland, 1998. [Google Scholar]
  32. Park, J.; Lee, T.; Kim, D.; Kim, P.; Kim, D.G.; Shin, S. Monitoring and impact of marine ecological disturbance causing organisms on an oyster and sea squirt farm. Korean J. Environ. Biol. 2017, 35, 677–683. [Google Scholar] [CrossRef]
  33. Stach, T.; Turbeville, J. Phylogeny of Tunicata inferred from molecular and morphological characters. Mol. Phylogenetics Evol. 2002, 25, 408–428. [Google Scholar] [CrossRef]
  34. Nishikawa, T.; Oohara, I.; Saitoh, K.; Shigenobu, Y.; Hasegawa, N.; Kanamori, M.; Baba, K.; Turon, X.; Bishop, J.D. Molecular and morphological discrimination between an invasive ascidian, Ascidiella aspersa, and its congener A. scabra (Urochordata: Ascidiacea). Zool. Sci. 2014, 31, 180–185. [Google Scholar] [CrossRef] [PubMed]
  35. Couton, M.; Comtet, T.; Le Cam, S.; Corre, E.; Viard, F. Metabarcoding on planktonic larval stages: An efficient approach for detecting and investigating life cycle dynamics of benthic aliens. Manag. Biol. Invasions 2019, 10, 657–689. [Google Scholar] [CrossRef]
  36. LeBlanc, F.; Belliveau, V.; Watson, E.; Coomber, C.; Simard, N.; DiBacco, C.; Bernier, R.; Gagné, N. Environmental DNA (eDNA) detection of marine aquatic invasive species (AIS) in Eastern Canada using a targeted species-specific qPCR approach. Manag. Biol. Invasions 2020, 11, 201. [Google Scholar] [CrossRef]
  37. Nichols, C.L.; Lambert, G.; Nydam, M.L. Continued persistence of non-native ascidians in Southern California harbors and marinas. Aquat. Invasions 2023, 18, 1–22. [Google Scholar] [CrossRef]
  38. Murugan, R.; Ananthan, G.; Arunkumar, A. DNA bar coding of Aplousobranchiata and Phlebobranchiata Ascidians (Phylum:Chordata) inferred from mitochondrial cytochrome oxidase subunit I (COI) gene sequence approach in Andaman and Nicobar Islands, India: A first report. Mitochondrial DNA Part A 2020, 31, 285–297. [Google Scholar] [CrossRef] [PubMed]
  39. Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c. oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar] [PubMed]
  40. Carreras-Carbonell, J.; Macpherson, E.; Pascual, M. Rapid radiation and cryptic speciation in Mediterranean triplefin blennies (Pisces: Tripterygiidae) combining multiple genes. Mol. Phylogenetics Evol. 2005, 37, 751–761. [Google Scholar] [CrossRef]
  41. Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef]
  42. Kearse, M.; Moir, R.; Wilson, A.; Stones-Havas, S.; Cheung, M.; Sturrock, S.; Buxton, S.; Cooper, A.; Markowitz, S.; Duran, C. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 2012, 28, 1647–1649. [Google Scholar] [CrossRef] [PubMed]
  43. Rozas, J.; Ferrer-Mata, A.; Sánchez-DelBarrio, J.C.; Guirao-Rico, S.; Librado, P.; Ramos-Onsins, S.E.; Sánchez-Gracia, A. DnaSP 6: DNA sequence polymorphism analysis of large data sets. Mol. Biol. Evol. 2017, 34, 3299–3302. [Google Scholar] [CrossRef]
  44. Excoffier, L.; Lischer, H.E. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour. 2010, 10, 564–567. [Google Scholar] [CrossRef]
  45. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
  46. Clement, M.; Snell, Q.; Walker, P.; Posada, D.; Crandall, K. TCS: Estimating gene genealogies. Parallel Distrib. Process. Symp. Int. Proc. 2002, 2, 184. [Google Scholar]
  47. Leigh, J.W.; Bryant, D. POPART: Full-feature software for haplotype network construction. Methods Ecol. Evol. 2015, 6, 1110–1116. [Google Scholar] [CrossRef]
  48. Sathish Kumar, R.; Ananthan, G.; Selva Prabhu, A.; Jenifer, E. Molecular Identification of Ascidians from Andaman and Nicobar Islands; The Centre of Advanced Study (CAS) in Marine Biology, Annamalai University, Faculty of Marine Sciences: Parangipettai, India, 2014; Unpublished. [Google Scholar]
  49. Zhan, A.; Briski, E.; Bock, D.G.; Ghabooli, S.; MacIsaac, H.J. Ascidians as models for studying invasion success. Mar. Biol. 2015, 162, 2449–2470. [Google Scholar] [CrossRef]
  50. Darling, J.A.; Bagley, M.J.; Roman, J.; Tepolt, C.K.; Geller, J.B. Genetic patterns across multiple introductions of the globally invasive crab genus Carcinus. Mol. Ecol. 2008, 17, 4992–5007. [Google Scholar] [CrossRef] [PubMed]
Water 15 03886 g001
Figure 1. Overview of Ascidiella aspersa specimens collected from the Korean coast. Please see Table 1 for detailed information.
Figure 1. Overview of Ascidiella aspersa specimens collected from the Korean coast. Please see Table 1 for detailed information.
Water 15 03886 g001
Water 15 03886 g002
Figure 2. TCS networks of Ascidiella aspersa cytochrome oxidase I (mt-COI) haplotypes in the Korean population. Areas of circles are proportional to the frequency of each haplotype in the dataset. Small black circles on the branches indicate hypothetical intermediate haplotypes that were not observed.
Figure 2. TCS networks of Ascidiella aspersa cytochrome oxidase I (mt-COI) haplotypes in the Korean population. Areas of circles are proportional to the frequency of each haplotype in the dataset. Small black circles on the branches indicate hypothetical intermediate haplotypes that were not observed.
Water 15 03886 g002
Water 15 03886 g003
Figure 3. TCS networks of Ascidiella aspersa mitochondrial cytochrome oxidase I (mt-COI) and 18S-rDNA haplotypes in the world population. Areas of circles are proportional to the frequency of each haplotype in the dataset, and differing shading indicates the nine different geographic regions.
Figure 3. TCS networks of Ascidiella aspersa mitochondrial cytochrome oxidase I (mt-COI) and 18S-rDNA haplotypes in the world population. Areas of circles are proportional to the frequency of each haplotype in the dataset, and differing shading indicates the nine different geographic regions.
Water 15 03886 g003
Table 1. Collection information, haplotype code, and GenBank accession Nos. of specimens in Republic of Korea used in this study.
Table 1. Collection information, haplotype code, and GenBank accession Nos. of specimens in Republic of Korea used in this study.
SpeciesLocality CodeLocalityGPSNo. of SpecimensHaplotype CodeGenBank Accession Number
COICOICOI18S
Ascidiella aspersaICIncheon37°46′49.83″ N, 126°62′26.88″ EH_1, H_3, H_5, H_6, H_85, 2, 1, 1, 1OR131201-OR131210OR453015-OR453022
BUBieung35°93′66.81″ N, 126°52′76.53″ EH_1, H_2, H_3, H_4, H_53, 1, 3, 1, 1OQ722425-OQ722433OR453000-OR453007
WDWando34°31′8761″ N, 126°75′32.31″ EH_3, H_11, H_12, H_134, 1, 1, 1OR131242-OR131248OR453055-OR453062
YSYeosu34°74′26.76″ N, 127°75′46.28″ EH_1, H_3, H_8, H_11, H_142, 3, 1, 1, 1OR131257-OR131264OR453071-OR453078
TYTongyeong34°82′80.55″ N, 128°43′64.44″ EH_3, H_7, H_9, H_105, 1, 1, 1OR131227-OR131234OR453039-OR453046
USUlsan35°51′46.72″ N, 129°37′59.00″ EH_1, H_3, H_5, H_111, 4, 1, 1OR131235-OR131241OR453047-OR453054
YPYangpo35°87′84.86″ N, 129°52′02.29″ EH_3, H_5, H_8, H_92, 1, 3, 2OR131249-OR131256OR453063-OR453070
JBJukbyeon37°05′53.00″ N, 129°41′73.98″ EH_3, H_5, H_7, H_94, 1, 1, 2OR131211-OR131218OR453023-OR453030
DHDonghae37°49′06.97″ N, 129°12′498.08″ EH_1, H_3, H_6, H_71, 4, 1, 1OR131195-OR131200OR453008- OR453014
SCSokcho38°19′79.70″ N, 128°59′30.33″ EH_1, H_3, H_5, H_92, 2, 1, 3OR131219-OR131226OR453031-OR453038
Table 2. Primers used for the amplification of 18S rDNA and mt-COI sequences.
Table 2. Primers used for the amplification of 18S rDNA and mt-COI sequences.
GenePrimer NamePrimer Sequence (5′–3′)Reference
COILCO1490GGTCAACAAATCATAAAGATATTGGFolmer et al. 1994 [39]
HCO2198TAAACTTCAGGGTGACCAAAAAATCA
18S rDNA18S-TFAAACGGCTACCACATCCAAGCarreras-Carbonell et al. 2005 [40]
18S-TRAACTAAGAACGGCCATGCAC
Table 3. Collection information, haplotype code, and GenBank accession Nos. of specimens in the global population used in this study.
Table 3. Collection information, haplotype code, and GenBank accession Nos. of specimens in the global population used in this study.
SpeciesLocality CodeLocality/State and CountryHaplotype Code No. of SpecimensGenBank Accession NumberReference
COI18S-rDNACOI18S-rDNACOI18S-rDNA
Ascidiella aspersaKOKoreaH_1, H_2, H_3, H_4, H_8, H_10, H_11, H_12, H_21H_1, H_523, 36, 1, 2, 6, 9, 1, 1, 381, 2OQ722425-OQ722433,
JQ742948-9		OR453000-OR453078, JN573230- JN573233This study
Pyo, et al., 2012 [22]
JAJapanH_1, H_2, H_3, H_10H_11, 4, 2, 18AB794912-19AB811877-AB811884Nishikawa et al., 2014 [34]
SPSpainH_2, H_ H_3, H_4, H_10, H_13, H_14, H_15, H_16, H_17, H_18, H_19, H_20H_1, H_26, 7, 1, 3, 3, 6, 1, 4, 1, 1, 1, 121,1AB794920-41
KF309529
KF309533
KF309534
KF309555
KF309559
KF309562
KF309568
KF309594
KF309606
KF309617
KF309631
KF309637
KF309653
KF309661		AB811885-AB811906Nishikawa, et al., 2014 [34]
López-Legentil, Susanna, et al., 2015 [6]
ENEnglandH_1, H_2, H_5, H_6H_1, H_3, H_42, 8, 1, 110,1,1AB794942-53AB811907-AB811918Nishikawa, et al., 2014 [34]
SWSwedenH_1, H_10H_11, 12AB794954
AB794955		AB811919-AB811920Nishikawa, et al., 2014 [34]
USUSAH_1, H_2-2, 8-KF886702
MW872258
MW872260
MW872267
MW872271
MW872272
MW872276
MW872277
MW872307
MW872313		-Nichols, et al., 2023 [37]
INIndiaH_9-1-KJ725163-Sathish et al., 2014 [48]
FRFranceH_2, H_3, H_7-1, 1, 1-AY116600
MN064594
MN064595		-Stach, & Turbeville, 2002 [33];
Couton, et al., 2019 [35]
CACanadaH_1-1-MN718193-LeBlanc et al., 2020 [36]
Table 4. Summary statistics of mt-COI genetic variations in Ascidiella aspersa along the coast of Republic of Korea.
Table 4. Summary statistics of mt-COI genetic variations in Ascidiella aspersa along the coast of Republic of Korea.
LocationnShHdπPiSSDSSD
p-Value		RagRag
p-Value		Fu’s Fs StatisticFu’s Fs p-ValueTajima’s DTajima’s D p-Value
Incheon
(IC)		10650.7556 ± 0.12950.00325 ± 0.002223.000000.066230.230.173330.31−0.455350.328000.024220.53700
Bieung
(BU)		9750.8333 ± 0.09800.00389 ± 0.002613.400000.029910.370.086420.45−0.305680.36000−0.034640.50300
Wando
(WD)		72340.7143 ± 0.18090.01029 ± 0.0063311.666670.058380.580.099770.832.428420.87200−1.580230.01900
Yeosu
(YS)		82350.8571 ± 0.10830.01017 ± 0.006119.800000.060500.390.112240.571.429610.75000−1.295480.09600
Tongyeong (TY)8440.6429 ± 0.18410.00223 ± 0.001712.166670.090590.190.308670.25−0.469600.25500−0.221750.44300
Ulsan
(US)		72340.7143 ± 0.18090.01116 ± 0.0068211.666670.125420.290.226760.352.626960.88800−1.236350.28000
Yangpo
(YP)		8640.8214 ± 0.10070.00343 ± 0.002393.166670.005910.930.029340.990.395130.57000−0.129020.48200
Jukbyeon
(JB)		8540.7500 ± 0.13910.00294 ± 0.002122.666670.192170.030.728320.030.081490.470000.000460.53900
Donghae
(DH)		7440.7143 ± 0.18090.00246 ± 0.001892.166670.086960.120.294780.25−0.538070.21900−0.039840.47300
Sokcho
(SC)		8540.8214 ± 0.10070.00348 ± 0.002422.833330.038410.200.116070.500.427530.561000.840310.82100
Table 5. Summary statistics of mt-COI genetic variations in Ascidiella aspersa in the global population.
Table 5. Summary statistics of mt-COI genetic variations in Ascidiella aspersa in the global population.
LocationnShHdπPiSSDSSD
p-Value		RagRag
p-Value		Fu’s Fs StatisticFu’s Fs p-ValueTajima’s DTajima’s D p-Value
Incheon
(IC)		10650.7556 ± 0.12950.00325 ± 0.002223.000000.066230.230.173330.31−0.455350.328000.024220.53700
Bieung
(BU)		9750.8333 ± 0.09800.00389 ± 0.002613.400000.029910.370.086420.45−0.305680.36000−0.034640.50300
Wando
(WD)		72340.7143 ± 0.18090.01029 ± 0.0063311.666670.058380.580.099770.832.428420.87200−1.580230.01900
Yeosu
(YS)		82350.8571 ± 0.10830.01017 ± 0.006119.800000.060500.390.112240.571.429610.75000−1.295480.09600
Tongyeong (TY)8440.6429 ± 0.18410.00223 ± 0.001712.166670.090590.190.308670.25−0.469600.25500−0.221750.44300
Ulsan
(US)		72340.7143 ± 0.18090.01116 ± 0.0068211.666670.125420.290.226760.352.626960.88800−1.236350.28000
Yangpo
(YP)		8640.8214 ± 0.10070.00343 ± 0.002393.166670.005910.930.029340.990.395130.57000−0.129020.48200
Jukbyeon
(JB)		8540.7500 ± 0.13910.00294 ± 0.002122.666670.192170.030.728320.030.081490.470000.000460.53900
Donghae
(DH)		7440.7143 ± 0.18090.00246 ± 0.001892.166670.086960.120.294780.25−0.538070.21900−0.039840.47300
Sokcho
(SC)		8540.8214 ± 0.10070.00348 ± 0.002422.833330.038410.200.116070.500.427530.561000.840310.82100
Table 6. Summary statistics of 18S-rDNA genetic variations in Ascidiella aspersa in the global population.
Table 6. Summary statistics of 18S-rDNA genetic variations in Ascidiella aspersa in the global population.
LocationnShHdπPiSSDSSD
p-Value		RagRag
p-Value		Fu’s Fs StatisticFu’s Fs p-ValueTajima’s DTajima’s D p-Value
Korea
(KO)		83020.04761 ± 0.03210.000081 ± 0.0002200.047610.000010.0830.820910.93000−1.324830.066000.000001.00000
England
(EN)		12230.3182 ± 0.16370.000568 ± 0.0006840.333330.002830.1320.226580.78300−1.324840.02500−1.451380.05800
Japan
(JA)		8010.000000 ± 0.0000000.000000 ± 0.0000000.000000.000000.0000.000000.000000.00000N.A.0.000001.00000
Spain
(SP)		22120.0909 ± 0.08090.000155 ± 0.0003200.000190.000040.1170.677690.92400−0.956760.06500−1.162400.15800
Sweden
(SW)		2010.000000 ± 0.0000000.000000 ± 0.0000000.000000.000000.0000.000000.000000.00000N.A.0.000001.00000
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lee, J.; Kwon, S.; Ubagan, M.D.; Lee, T.; Shin, S. Genetic Diversity and Population Dynamics of Invasive Ascidiella aspersa: Insights from Cytochrome Oxidase Subunit I and 18S rDNA Analyses in Korean and Global Populations. Water 2023, 15, 3886. https://doi.org/10.3390/w15223886

AMA Style

Lee J, Kwon S, Ubagan MD, Lee T, Shin S. Genetic Diversity and Population Dynamics of Invasive Ascidiella aspersa: Insights from Cytochrome Oxidase Subunit I and 18S rDNA Analyses in Korean and Global Populations. Water. 2023; 15(22):3886. https://doi.org/10.3390/w15223886

Chicago/Turabian Style

Lee, Jeounghee, Soyeon Kwon, Michael Dadole Ubagan, Taekjun Lee, and Sook Shin. 2023. "Genetic Diversity and Population Dynamics of Invasive Ascidiella aspersa: Insights from Cytochrome Oxidase Subunit I and 18S rDNA Analyses in Korean and Global Populations" Water 15, no. 22: 3886. https://doi.org/10.3390/w15223886

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop