Supplementation of Probiotic Butyricicoccus pullicaecorum Mediates Anticancer Effect on Bladder Urothelial Cells by Regulating Butyrate-Responsive Molecular Signatures
Abstract
:1. Introduction
2. Materials and Methods
2.1. Mouse with B. pullicaecorum Administration
2.2. Urinary Bladder Cells and Sodium Butyrate Treatment
2.3. Immunohistochemical Staining
2.4. Change in Growth of HT1376 Cells following NaB Treatment
2.5. Quantitative PCR
2.6. Analyses of Cell Cycle and Apoptosis through Image Cytometry
2.7. Statistical Analysis
3. Results
3.1. In Vivo Evaluation of SCFA-Related Gene Expression in Mouse Bladder after B. pullicaecorum Administration
3.2. Upregulation of Butyrate-Responsive Genes in Urothelial Cancer Cells of the Bladder after NaB Treatment
3.3. Induction of Apoptosis in Bladder Urothelial Cells under a Butyrate-Enriched Microenvironment
3.4. NaB-Induced Inhibition of Cell Proliferation or Growth of Bladder Urothelial Cancer Cells
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Dy, G.W.; Gore, J.L.; Forouzanfar, M.H.; Naghavi, M.; Fitzmaurice, C. Global Burden of Urologic Cancers, 1990–2013. Eur. Urol. 2017, 71, 437–446. [Google Scholar] [CrossRef] [PubMed]
- Bosetti, C.; Bertuccio, P.; Chatenoud, L.; Negri, E.; La Vecchia, C.; Levi, F. Trends in mortality from urologic cancers in Europe, 1970–2008. Eur. Urol. 2011, 60, 1–15. [Google Scholar] [CrossRef]
- Sanli, O.; Dobruch, J.; Knowles, M.A.; Burger, M.; Alemozaffar, M.; Nielsen, M.E.; Lotan, Y. Bladder cancer. Nat. Rev. Dis. Primers 2017, 3, 17022. [Google Scholar] [CrossRef] [PubMed]
- Willis, D.; Kamat, A.M. Nonurothelial bladder cancer and rare variant histologies. Hematol. Oncol. Clin. North. Am. 2015, 29, 237–252. [Google Scholar] [CrossRef]
- Guo, C.C.; Czerniak, B. Bladder Cancer in the Genomic Era. Arch. Pathol. Lab. Med. 2019, 143, 695–704. [Google Scholar] [CrossRef] [Green Version]
- Mansour, B.; Monyok, A.; Makra, N.; Gajdacs, M.; Vadnay, I.; Ligeti, B.; Juhasz, J.; Szabo, D.; Ostorhazi, E. Bladder cancer-related microbiota: Examining differences in urine and tissue samples. Sci. Rep. 2020, 10, 11042. [Google Scholar] [CrossRef]
- Bucevic Popovic, V.; Situm, M.; Chow, C.T.; Chan, L.S.; Roje, B.; Terzic, J. The urinary microbiome associated with bladder cancer. Sci. Rep. 2018, 8, 12157. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, P.; Zhang, G.; Zhao, J.; Chen, J.; Chen, Y.; Huang, W.; Zhong, J.; Zeng, J. Profiling the Urinary Microbiota in Male Patients with Bladder Cancer in China. Front. Cell. Infect. Microbiol. 2018, 8, 167. [Google Scholar] [CrossRef]
- Bi, H.; Tian, Y.; Song, C.; Li, J.; Liu, T.; Chen, Z.; Chen, C.; Huang, Y.; Zhang, Y. Urinary microbiota—A potential biomarker and therapeutic target for bladder cancer. J. Med. Microbiol. 2019, 68, 1471–1478. [Google Scholar] [CrossRef]
- Bajic, P.; Wolfe, A.J.; Gupta, G.N. The Urinary Microbiome: Implications in Bladder Cancer Pathogenesis and Therapeutics. Urology 2019, 126, 10–15. [Google Scholar] [CrossRef]
- Enaud, R.; Prevel, R.; Ciarlo, E.; Beaufils, F.; Wieers, G.; Guery, B.; Delhaes, L. The Gut-Lung Axis in Health and Respiratory Diseases: A Place for Inter-Organ and Inter-Kingdom Crosstalks. Front. Cell. Infect. Microbiol. 2020, 10, 9. [Google Scholar] [CrossRef] [Green Version]
- Fernandez, M.F.; Reina-Perez, I.; Astorga, J.M.; Rodriguez-Carrillo, A.; Plaza-Diaz, J.; Fontana, L. Breast Cancer and Its Relationship with the Microbiota. Int. J. Environ. Res. Public Health 2018, 15, 1747. [Google Scholar] [CrossRef] [Green Version]
- Human Microbiome Project, C. Structure, function and diversity of the healthy human microbiome. Nature 2012, 486, 207–214. [Google Scholar] [CrossRef] [Green Version]
- Klement, R.J.; Pazienza, V. Impact of Different Types of Diet on Gut Microbiota Profiles and Cancer Prevention and Treatment. Medicina 2019, 55, 84. [Google Scholar] [CrossRef] [Green Version]
- He, C.; Li, B.; Huang, L.; Teng, C.; Bao, Y.; Ren, M.; Shan, Y. Gut microbial composition changes in bladder cancer patients: A case-control study in Harbin, China. Asia. Pac. J. Clin. Nutr. 2020, 29, 395–403. [Google Scholar] [CrossRef]
- He, C.; Huang, L.; Lei, P.; Liu, X.; Li, B.; Shan, Y. Sulforaphane Normalizes Intestinal Flora and Enhances Gut Barrier in Mice with BBN-Induced Bladder Cancer. Mol. Nutr. Food Res. 2018, 62, e1800427. [Google Scholar] [CrossRef]
- Vivarelli, S.; Falzone, L.; Leonardi, G.C.; Salmeri, M.; Libra, M. Novel insights on gut microbiota manipulation and immune checkpoint inhibition in cancer (Review). Int. J. Oncol. 2021, 59, 75–91. [Google Scholar] [CrossRef]
- Aso, Y.; Akazan, H. Prophylactic effect of a Lactobacillus casei preparation on the recurrence of superficial bladder cancer. BLP Study Group. Urol. Int. 1992, 49, 125–129. [Google Scholar] [CrossRef]
- Wong, J.M.; Jenkins, D.J. Carbohydrate digestibility and metabolic effects. J. Nutr. 2007, 137, 2539S–2546S. [Google Scholar] [CrossRef]
- Dyer, J.P.; Featherstone, J.M.; Solomon, L.Z.; Crook, T.J.; Cooper, A.J.; Malone, P.S. The effect of short-chain fatty acids butyrate, propionate, and acetate on urothelial cell kinetics in vitro: Potential therapy in augmentation cystoplasty. Pediatr. Surg. Int. 2005, 21, 521–526. [Google Scholar] [CrossRef]
- Aljabery, F.; Shabo, I.; Gimm, O.; Jahnson, S.; Olsson, H. The expression profile of p14, p53 and p21 in tumour cells is associated with disease-specific survival and the outcome of postoperative chemotherapy treatment in muscle-invasive bladder cancer. Urol. Oncol. 2018, 36, 530.e537–530.e518. [Google Scholar] [CrossRef]
- Boesmans, L.; Valles-Colomer, M.; Wang, J.; Eeckhaut, V.; Falony, G.; Ducatelle, R.; Van Immerseel, F.; Raes, J.; Verbeke, K. Butyrate Producers as Potential Next-Generation Probiotics: Safety Assessment of the Administration of Butyricicoccus pullicaecorum to Healthy Volunteers. mSystems 2018, 3, e00094-18. [Google Scholar] [CrossRef] [Green Version]
- Chang, S.C.; Shen, M.H.; Liu, C.Y.; Pu, C.M.; Hu, J.M.; Huang, C.J. A gut butyrate-producing bacterium Butyricicoccus pullicaecorum regulates short-chain fatty acid transporter and receptor to reduce the progression of 1,2-dimethylhydrazine-associated colorectal cancer. Oncol. Lett. 2020, 20, 327. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Wu, J.T.; Lin, C.L.; Huang, C.J.; Cheng, Y.C.; Chien, C.C.; Sung, Y.C. Potential synergistic effects of sorafenib and CP-31398 for treating anaplastic thyroid cancer with p53 mutations. Oncol. Lett. 2020, 19, 3021–3026. [Google Scholar] [CrossRef]
- Tang, Q.; Wang, Y.; Huang, R.; You, Q.; Wang, G.; Chen, Y.; Jiang, Z.; Liu, Z.; Yu, L.; Muhammad, S.; et al. Preparation of anti-tumor nanoparticle and its inhibition to peritoneal dissemination of colon cancer. PLoS ONE 2014, 9, e98455. [Google Scholar] [CrossRef]
- Beberok, A.; Rzepka, Z.; Respondek, M.; Rok, J.; Stradowski, M.; Wrzesniok, D. Moxifloxacin as an inducer of apoptosis in melanoma cells: A study at the cellular and molecular level. Toxicol. Vitro 2019, 55, 75–92. [Google Scholar] [CrossRef]
- Rok, J.; Rzepka, Z.; Beberok, A.; Pawlik, J.; Wrzesniok, D. Cellular and Molecular Aspects of Anti-Melanoma Effect of Minocycline-A Study of Cytotoxicity and Apoptosis on Human Melanotic Melanoma Cells. Int. J. Mol. Sci. 2020, 21, 6917. [Google Scholar] [CrossRef]
- Chen, S.K.; Chung, C.A.; Cheng, Y.C.; Huang, C.J.; Ruaan, R.C.; Chen, W.Y.; Li, C.; Tsao, C.W.; Hu, W.W.; Chien, C.C. Hydrostatic pressure enhances mitomycin C induced apoptosis in urothelial carcinoma cells. Urol. Oncol. 2014, 32, 26.e17–26.e24. [Google Scholar] [CrossRef]
- Wu, X.; Wu, Y.; He, L.; Wu, L.; Wang, X.; Liu, Z. Effects of the intestinal microbial metabolite butyrate on the development of colorectal cancer. J. Cancer 2018, 9, 2510–2517. [Google Scholar] [CrossRef]
- Huang, Y.T.; Wu, T.S.; Lu, C.C.; Yu, F.Y.; Liu, B.H. Aristolochic acid I interferes with the expression of BLCAP tumor suppressor gene in human cells. Toxicol. Lett. 2018, 291, 129–137. [Google Scholar] [CrossRef]
- Wu, L.; He, S.; He, Y.; Wang, X.; Lu, L. IC-2 Suppresses Proliferation and Induces Apoptosis of Bladder Cancer Cells via the Wnt/beta-Catenin Pathway. Med. Sci. Monit. 2018, 24, 8074–8080. [Google Scholar] [CrossRef]
- Rieger, A.M.; Nelson, K.L.; Konowalchuk, J.D.; Barreda, D.R. Modified annexin V/propidium iodide apoptosis assay for accurate assessment of cell death. J. Vis. Exp. 2011, 50, e2597. [Google Scholar] [CrossRef]
- Volpe, E.; Sambucci, M.; Battistini, L.; Borsellino, G. Fas-Fas Ligand: Checkpoint of T Cell Functions in Multiple Sclerosis. Front. Immunol. 2016, 7, 382. [Google Scholar] [CrossRef] [Green Version]
- Goranov, A.I.; Cook, M.; Ricicova, M.; Ben-Ari, G.; Gonzalez, C.; Hansen, C.; Tyers, M.; Amon, A. The rate of cell growth is governed by cell cycle stage. Genes Dev. 2009, 23, 1408–1422. [Google Scholar] [CrossRef] [Green Version]
- Gupta, P.; Jain, M.; Kapoor, R.; Muruganandham, K.; Srivastava, A.; Mandhani, A. Impact of age and gender on the clinicopathological characteristics of bladder cancer. Indian J. Urol. 2009, 25, 207–210. [Google Scholar] [CrossRef]
- Cumberbatch, M.G.K.; Noon, A.P. Epidemiology, aetiology and screening of bladder cancer. Transl. Androl. Urol. 2019, 8, 5–11. [Google Scholar] [CrossRef]
- Cumberbatch, M.G.K.; Jubber, I.; Black, P.C.; Esperto, F.; Figueroa, J.D.; Kamat, A.M.; Kiemeney, L.; Lotan, Y.; Pang, K.; Silverman, D.T.; et al. Epidemiology of Bladder Cancer: A Systematic Review and Contemporary Update of Risk Factors in 2018. Eur. Urol. 2018, 74, 784–795. [Google Scholar] [CrossRef] [Green Version]
- Andrew, A.S.; Schned, A.R.; Heaney, J.A.; Karagas, M.R. Bladder cancer risk and personal hair dye use. Int. J. Cancer. 2004, 109, 581–586. [Google Scholar] [CrossRef]
- Orhurhu, V.J.; Vashisht, R.; Claus, L.E.; Cohen, S.P. Ketamine Toxicity; StatPearls: Treasure Island, FL, USA, 2021. [Google Scholar]
- Huang, C.J.; Lee, F.K.; Chen, S.K.; Chien, C.C.; Wu, S.T.; Wang, Y.C. Clinical significance of interleukin6 and inducible nitric oxide synthase in ketamineinduced cystitis. Int. J. Mol. Med. 2018, 41, 836–844. [Google Scholar] [CrossRef] [Green Version]
- Castellani, D.; Pirola, G.M.; Gubbiotti, M.; Rubilotta, E.; Gudaru, K.; Gregori, A.; Dellabella, M. What urologists need to know about ketamine-induced uropathy: A systematic review. Neurourol. Urodyn. 2020, 39, 1049–1062. [Google Scholar] [CrossRef] [PubMed]
- Song, M.; Chan, A.T.; Sun, J. Influence of the Gut Microbiome, Diet, and Environment on Risk of Colorectal Cancer. Gastroenterology 2020, 158, 322–340. [Google Scholar] [CrossRef] [PubMed]
- Perillo, F.; Amoroso, C.; Strati, F.; Giuffre, M.R.; Diaz-Basabe, A.; Lattanzi, G.; Facciotti, F. Gut Microbiota Manipulation as a Tool for Colorectal Cancer Management: Recent Advances in Its Use for Therapeutic Purposes. Int. J. Mol. Sci. 2020, 21, 5389. [Google Scholar] [CrossRef] [PubMed]
- Gao, R.; Gao, Z.; Huang, L.; Qin, H. Gut microbiota and colorectal cancer. Eur. J. Clin. Microbiol. Infect. Dis. 2017, 36, 757–769. [Google Scholar] [CrossRef]
- Garrett, W.S. The gut microbiota and colon cancer. Science 2019, 364, 1133–1135. [Google Scholar] [CrossRef]
- Fong, W.; Li, Q.; Yu, J. Gut microbiota modulation: A novel strategy for prevention and treatment of colorectal cancer. Oncogene 2020, 39, 4925–4943. [Google Scholar] [CrossRef]
- De Almeida, C.V.; de Camargo, M.R.; Russo, E.; Amedei, A. Role of diet and gut microbiota on colorectal cancer immunomodulation. World J. Gastroenterol. 2019, 25, 151–162. [Google Scholar] [CrossRef]
- Liu, J.L.; Segovia, I.; Yuan, X.L.; Gao, Z.H. Controversial Roles of Gut Microbiota-Derived Short-Chain Fatty Acids (SCFAs) on Pancreatic beta-Cell Growth and Insulin Secretion. Int. J. Mol. Sci. 2020, 21, 910. [Google Scholar] [CrossRef] [Green Version]
- Iraporda, C.; Errea, A.; Romanin, D.E.; Cayet, D.; Pereyra, E.; Pignataro, O.; Sirard, J.C.; Garrote, G.L.; Abraham, A.G.; Rumbo, M. Lactate and short chain fatty acids produced by microbial fermentation downregulate proinflammatory responses in intestinal epithelial cells and myeloid cells. Immunobiology 2015, 220, 1161–1169. [Google Scholar] [CrossRef]
- Hijova, E.; Chmelarova, A. Short chain fatty acids and colonic health. Bratisl Lek Listy. 2007, 108, 354–358. [Google Scholar]
- McNabney, S.M.; Henagan, T.M. Short Chain Fatty Acids in the Colon and Peripheral Tissues: A Focus on Butyrate, Colon Cancer, Obesity and Insulin Resistance. Nutrients 2017, 9, 1348. [Google Scholar] [CrossRef] [Green Version]
- Zimmerman, M.A.; Singh, N.; Martin, P.M.; Thangaraju, M.; Ganapathy, V.; Waller, J.L.; Shi, H.; Robertson, K.D.; Munn, D.H.; Liu, K. Butyrate suppresses colonic inflammation through HDAC1-dependent Fas upregulation and Fas-mediated apoptosis of T cells. Am. J. Physiol. Gastrointest. Liver Physiol. 2012, 302, G1405–G1415. [Google Scholar] [CrossRef] [PubMed]
- Stilling, R.M.; van de Wouw, M.; Clarke, G.; Stanton, C.; Dinan, T.G.; Cryan, J.F. The neuropharmacology of butyrate: The bread and butter of the microbiota-gut-brain axis? Neurochem. Int. 2016, 99, 110–132. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Wang, J.; He, T.; Becker, S.; Zhang, G.; Li, D.; Ma, X. Butyrate: A Double-Edged Sword for Health? Adv. Nutr. 2018, 9, 21–29. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cosin-Roger, J.; Ortiz-Masia, D.; Barrachina, M.D.; Calatayud, S. Metabolite Sensing GPCRs: Promising Therapeutic Targets for Cancer Treatment? Cells 2020, 9, 2345. [Google Scholar] [CrossRef]
- Zhang, C.; Chang, J.; Wu, W.; Deng, Y.; Zhou, P.; Jiang, W.; Wang, C.; Huang, F. Activation of GPR43 suppresses TNF-alpha-induced inflammatory response in human fibroblast-like synoviocytes. Arch. Biochem. Biophys. 2020, 684, 108297. [Google Scholar] [CrossRef]
- Nakajima, A.; Nakatani, A.; Hasegawa, S.; Irie, J.; Ozawa, K.; Tsujimoto, G.; Suganami, T.; Itoh, H.; Kimura, I. The short chain fatty acid receptor GPR43 regulates inflammatory signals in adipose tissue M2-type macrophages. PLoS ONE 2017, 12, e0179696. [Google Scholar] [CrossRef] [Green Version]
- Sivaprakasam, S.; Gurav, A.; Paschall, A.V.; Coe, G.L.; Chaudhary, K.; Cai, Y.; Kolhe, R.; Martin, P.; Browning, D.; Huang, L.; et al. An essential role of Ffar2 (Gpr43) in dietary fibre-mediated promotion of healthy composition of gut microbiota and suppression of intestinal carcinogenesis. Oncogenesis 2016, 5, e238. [Google Scholar] [CrossRef] [Green Version]
- Thangaraju, M.; Cresci, G.A.; Liu, K.; Ananth, S.; Gnanaprakasam, J.P.; Browning, D.D.; Mellinger, J.D.; Smith, S.B.; Digby, G.J.; Lambert, N.A.; et al. GPR109A is a G-protein-coupled receptor for the bacterial fermentation product butyrate and functions as a tumor suppressor in colon. Cancer Res. 2009, 69, 2826–2832. [Google Scholar] [CrossRef] [Green Version]
- Staubert, C.; Broom, O.J.; Nordstrom, A. Hydroxycarboxylic acid receptors are essential for breast cancer cells to control their lipid/fatty acid metabolism. Oncotarget 2015, 6, 19706–19720. [Google Scholar] [CrossRef] [Green Version]
- Ahmed, K.; Tunaru, S.; Langhans, C.D.; Hanson, J.; Michalski, C.W.; Kolker, S.; Jones, P.M.; Okun, J.G.; Offermanns, S. Deorphanization of GPR109B as a receptor for the beta-oxidation intermediate 3-OH-octanoic acid and its role in the regulation of lipolysis. J. Biol. Chem. 2009, 284, 21928–21933. [Google Scholar] [CrossRef] [Green Version]
- Skinner, P.J.; Webb, P.J.; Sage, C.R.; Dang, T.H.; Pride, C.C.; Chen, R.; Tamura, S.Y.; Richman, J.G.; Connolly, D.T.; Semple, G. 5-N, N-Disubstituted 5-aminopyrazole-3-carboxylic acids are highly potent agonists of GPR109b. Bioorg. Med. Chem. Lett. 2009, 19, 4207–4209. [Google Scholar] [CrossRef]
- Skinner, P.J.; Cherrier, M.C.; Webb, P.J.; Sage, C.R.; Dang, H.T.; Pride, C.C.; Chen, R.; Tamura, S.Y.; Richman, J.G.; Connolly, D.T.; et al. 3-Nitro-4-amino benzoic acids and 6-amino nicotinic acids are highly selective agonists of GPR109b. Bioorg. Med. Chem. Lett. 2007, 17, 6619–6622. [Google Scholar] [CrossRef] [PubMed]
- Semple, G.; Skinner, P.J.; Cherrier, M.C.; Webb, P.J.; Sage, C.R.; Tamura, S.Y.; Chen, R.; Richman, J.G.; Connolly, D.T. 1-Alkyl-benzotriazole-5-carboxylic acids are highly selective agonists of the human orphan G-protein-coupled receptor GPR109b. J. Med. Chem. 2006, 49, 1227–1230. [Google Scholar] [CrossRef]
- Zaidi, N.; Lupien, L.; Kuemmerle, N.B.; Kinlaw, W.B.; Swinnen, J.V.; Smans, K. Lipogenesis and lipolysis: The pathways exploited by the cancer cells to acquire fatty acids. Prog. Lipid Res. 2013, 52, 585–589. [Google Scholar] [CrossRef] [Green Version]
- Sagar, G.; Sah, R.P.; Javeed, N.; Dutta, S.K.; Smyrk, T.C.; Lau, J.S.; Giorgadze, N.; Tchkonia, T.; Kirkland, J.L.; Chari, S.T.; et al. Pathogenesis of pancreatic cancer exosome-induced lipolysis in adipose tissue. Gut 2016, 65, 1165–1174. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Santos, C.R.; Schulze, A. Lipid metabolism in cancer. FEBS J. 2012, 279, 2610–2623. [Google Scholar] [CrossRef]
- Li, J.; Zhao, S.; Zhou, X.; Zhang, T.; Zhao, L.; Miao, P.; Song, S.; Sun, X.; Liu, J.; Zhao, X.; et al. Inhibition of lipolysis by mercaptoacetate and etomoxir specifically sensitize drug-resistant lung adenocarcinoma cell to paclitaxel. PLoS ONE 2013, 8, e74623. [Google Scholar] [CrossRef] [PubMed]
- Tian, W.; Zhang, W.; Zhang, Y.; Zhu, T.; Hua, Y.; Li, H.; Zhang, Q.; Xia, M. FABP4 promotes invasion and metastasis of colon cancer by regulating fatty acid transport. Cancer Cell Int. 2020, 20, 512. [Google Scholar] [CrossRef]
- Guaita-Esteruelas, S.; Bosquet, A.; Saavedra, P.; Guma, J.; Girona, J.; Lam, E.W.; Amillano, K.; Borras, J.; Masana, L. Exogenous FABP4 increases breast cancer cell proliferation and activates the expression of fatty acid transport proteins. Mol. Carcinog. 2017, 56, 208–217. [Google Scholar] [CrossRef] [Green Version]
- Gharpure, K.M.; Pradeep, S.; Sans, M.; Rupaimoole, R.; Ivan, C.; Wu, S.Y.; Bayraktar, E.; Nagaraja, A.S.; Mangala, L.S.; Zhang, X.; et al. FABP4 as a key determinant of metastatic potential of ovarian cancer. Nat. Commun. 2018, 9, 2923. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Herroon, M.K.; Rajagurubandara, E.; Hardaway, A.L.; Powell, K.; Turchick, A.; Feldmann, D.; Podgorski, I. Bone marrow adipocytes promote tumor growth in bone via FABP4-dependent mechanisms. Oncotarget 2013, 4, 2108–2123. [Google Scholar] [CrossRef] [Green Version]
- Tang, Z.; Shen, Q.; Xie, H.; Zhou, X.; Li, J.; Feng, J.; Liu, H.; Wang, W.; Zhang, S.; Ni, S. Elevated expression of FABP3 and FABP4 cooperatively correlates with poor prognosis in non-small cell lung cancer (NSCLC). Oncotarget 2016, 7, 46253–46262. [Google Scholar] [CrossRef] [Green Version]
- Zhong, C.Q.; Zhang, X.P.; Ma, N.; Zhang, E.B.; Li, J.J.; Jiang, Y.B.; Gao, Y.Z.; Yuan, Y.M.; Lan, S.Q.; Xie, D.; et al. FABP4 suppresses proliferation and invasion of hepatocellular carcinoma cells and predicts a poor prognosis for hepatocellular carcinoma. Cancer. Med. 2018, 7, 2629–2640. [Google Scholar] [CrossRef]
- Chiu, M.; McBeth, L.; Sindhwani, P.; Hinds, T.D. Deciphering the Roles of Thiazolidinediones and PPARgamma in Bladder Cancer. PPAR Res. 2017, 2017, 4810672. [Google Scholar] [CrossRef] [Green Version]
- Mathis, C.; Lascombe, I.; Monnien, F.; Bittard, H.; Kleinclauss, F.; Bedgedjian, I.; Fauconnet, S.; Valmary-Degano, S. Down-regulation of A-FABP predicts non-muscle invasive bladder cancer progression: Investigation with a long term clinical follow-up. BMC. Cancer 2018, 18, 1239. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maruyama, T.; Yamamoto, S.; Qiu, J.; Ueda, Y.; Suzuki, T.; Nojima, M.; Shima, H. Apoptosis of bladder cancer by sodium butyrate and cisplatin. J. Infect. Chemother. 2012, 18, 288–295. [Google Scholar] [CrossRef] [PubMed]
- Matson, V.; Chervin, C.S.; Gajewski, T.F. Cancer and the Microbiome-Influence of the Commensal Microbiota on Cancer, Immune Responses, and Immunotherapy. Gastroenterology 2021, 160, 600–613. [Google Scholar] [CrossRef] [PubMed]
- Yi, M.; Jiao, D.; Qin, S.; Chu, Q.; Li, A.; Wu, K. Manipulating Gut Microbiota Composition to Enhance the Therapeutic Effect of Cancer Immunotherapy. Integr. Cancer. Ther. 2019, 18, 1534735419876351. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene Name | Accession Number | Sequence (From 5′ to 3′) | UPL Number |
---|---|---|---|
FABP4 | NM_001442 | F: CCACCATAAAGAGAAAACGAGAG | #31 |
R: GTGGAAGTGACGCCTTTCAT | |||
BLCAP | NM_006698 | F: CGCCATGGTTCCAAGAAT | #17 |
R: CGCTTTCTTCAACCCTCACT | |||
CDK1 | NM_001786 | F: TGGATCTGAAGAAATACTTGGATTCTA | #79 |
R: CAATCCCCTGTAGGATTTGG | |||
GAPDH | NM_002046 | F: CTCTGCTCCTCCTGTTCGAC | #60 |
R: ACGACCAAATCCGTTGACTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Y.-C.; Ku, W.-C.; Liu, C.-Y.; Cheng, Y.-C.; Chien, C.-C.; Chang, K.-W.; Huang, C.-J. Supplementation of Probiotic Butyricicoccus pullicaecorum Mediates Anticancer Effect on Bladder Urothelial Cells by Regulating Butyrate-Responsive Molecular Signatures. Diagnostics 2021, 11, 2270. https://doi.org/10.3390/diagnostics11122270
Wang Y-C, Ku W-C, Liu C-Y, Cheng Y-C, Chien C-C, Chang K-W, Huang C-J. Supplementation of Probiotic Butyricicoccus pullicaecorum Mediates Anticancer Effect on Bladder Urothelial Cells by Regulating Butyrate-Responsive Molecular Signatures. Diagnostics. 2021; 11(12):2270. https://doi.org/10.3390/diagnostics11122270
Chicago/Turabian StyleWang, Yen-Chieh, Wei-Chi Ku, Chih-Yi Liu, Yu-Che Cheng, Chih-Cheng Chien, Kang-Wei Chang, and Chi-Jung Huang. 2021. "Supplementation of Probiotic Butyricicoccus pullicaecorum Mediates Anticancer Effect on Bladder Urothelial Cells by Regulating Butyrate-Responsive Molecular Signatures" Diagnostics 11, no. 12: 2270. https://doi.org/10.3390/diagnostics11122270