Virulence of Metarhizium rileyi Is Determined by Its Growth and Antioxidant Stress and the Protective and Detoxifying Enzymes of Spodoptera frugiperda
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. The Fungi and Insects
2.2. Fungal Isolation and Culture
2.3. Molecular Identification and Phylogenetic Analysis of Metarhizium rileyi
2.4. Morphological Observation and Colony Growth Rate Measurement of Metarhizium rileyi
2.5. Determination of Strain Virulence to Different Stages of Spodoptera frugiperda
2.6. Determining Activity of the Main Protective and Detoxifying Enzymes in S. frugiperda
2.7. Determining SOD and CAT Activity in Fungi
2.8. Fungal RNA Extraction and RT-qPCR
2.9. Data Analysis
3. Results
3.1. XSBN200920 and HNQLZ200714 Isolated from the Affected Spodoptera frugiperda Were Identified as Metarhizium rileyi
3.2. Virulence of Metarhizium rileyi XSBN200920 and HNQLZ200714 for Different Stages of Spodoptera frugiperda
3.3. The Protective Enzyme Activity of S. frugiperda Larvae Infected with XSBN200920 and HNQLZ200714 Was Unbalanced
3.4. XSBN200920 and HNQLZ200714 Demonstrated Significant Effects on the Detoxifying Enzyme Activity of S. frugiperda Larvae
3.5. XSBN200920 and HNQLZ200714 Showed Significant Differences in Response to Carbon Sources, Nitrogen Sources, and Oxidative Stress Agents
3.6. XSBN200920 and HNQLZ200714 Showed Significant Differences in MrSOD and MrCAT Family Gene Expression and Antioxidant Enzyme Activity
4. Discussion
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Farias, J.R.; Horikoshi, R.J.; Santos, A.C.; Omoto, C. Geographical and Temporal Variability in Susceptibility to Cry1F Toxin from Bacillus thuringiensis in Spodoptera frugiperda (Lepidoptera: Noctuidae) Populations in Brazil. J. Econ. Entomol. 2014, 107, 2182–2189. [Google Scholar] [CrossRef]
- Nagoshi, R.N.; Dhanani, I.; Asokan, R.; Mahadevaswamy, H.M.; Kalleshwaraswamy, C.M.; Sharanabasappa; Meagher, R.L. Genetic characterization of fall armyworm infesting South Africa and India indicate recent introduction from a common source population. PLoS ONE 2019, 14, e217755. [Google Scholar] [CrossRef] [Green Version]
- Stokstad, E. New crop pest takes Africa at lightning speed. Science 2017, 356, 473–474. [Google Scholar] [CrossRef]
- Jing, D.P.; Guo, J.F.; Jiang, Y.Y.; Zhao, J.Z.; Sethi, A.; He, K.L.; Wang, Z.Y. Initial detections and spread of invasive Spodoptera frugiperda in China and comparisons with other noctuid larvae in cornfields using molecular techniques. Insect Sci. 2020, 27, 780–790. [Google Scholar] [CrossRef]
- Encinar Del Dedo, J.; Gabrielli, N.; Carmona, M.; Ayté, J.; Hidalgo, E. A Cascade of Iron-Containing Proteins Governs the Genetic Iron Starvation Response to Promote Iron Uptake and Inhibit Iron Storage in Fission Yeast. PLoS Genet. 2015, 11, e1005106. [Google Scholar] [CrossRef] [PubMed]
- Carvalho, R.A.; Omoto, C.; Field, L.M.; Williamson, M.S.; Bass, C. Investigating the molecular mechanisms of organophosphate and pyrethroid resistance in the fall armyworm Spodoptera frugiperda. PLoS ONE 2013, 8, e62268. [Google Scholar] [CrossRef] [Green Version]
- Lacey, L.A.; Grzywacz, D.; Shapiro-Ilan, D.I.; Frutos, R.; Brownbridge, M.; Goettel, M.S. Insect pathogens as biological control agents: Back to the future. J. Invertebr. Pathol. 2015, 132, 9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Harrison, R.D.; Thierfelder, C.; Baudron, F.; Chinwada, P.; Midega, C.; Schaffner, U.; van den Berg, J. Agro-ecological options for fall armyworm (Spodoptera frugiperda JE Smith) management: Providing low-cost, smallholder friendly solutions to an invasive pest. J. Environ. Manag. 2019, 243, 318–330. [Google Scholar] [CrossRef] [PubMed]
- Peng, Y.J.; Wang, J.J.; Lin, H.Y.; Ding, J.L.; Feng, M.G.; Ying, S.H. HapX, an Indispensable bZIP Transcription Factor for Iron Acquisition, Regulates Infection Initiation by Orchestrating Conidial Oleic Acid Homeostasis and Cytomembrane Functionality in Mycopathogen Beauveria bassiana. Msystems 2020, 5, 2379–5077. [Google Scholar] [CrossRef]
- Kepler, R.M.; Humber, R.A.; Bischoff, J.F.; Rehner, S.A. Clarification of generic and species boundaries for Metarhizium and related fungi through multigene phylogenetics. Mycologia 2014, 106, 811–829. [Google Scholar] [CrossRef]
- Binneck, E.; Lastra, C.; Sosa-Gomez, D.R. Genome Sequence of Metarhizium rileyi, a Microbial Control Agent for Lepidoptera. Microbiol. Resour. Ann. 2019, 8, 2576. [Google Scholar] [CrossRef] [Green Version]
- Zhu, S.; Feng, X.; Keyhani, N.O.; Liu, Y.; Jin, D.; Tong, S.; Pei, Y.; Fan, Y. Manipulation of host ecdysteroid hormone levels facilitates infection by the fungal insect pathogen, Metarhizium rileyi. Environ. Microbiol. 2021, 23, 5087–5101. [Google Scholar] [CrossRef] [PubMed]
- Holder, D.J.; Keyhani, N.O. Adhesion of the entomopathogenic fungus Beauveria (Cordyceps) bassiana to substrata. Appl. Environ. Microb. 2005, 71, 5260–5266. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.L.; Yang, K.H.; Wang, S.S.; Li, X.L.; Liu, J.; Yu, Y.X.; Liu, X.S. Infection of the entomopathogenic fungus Metarhizium rileyi suppresses cellular immunity and activates humoral antibacterial immunity of the host Spodoptera frugiperda. Pest Manag. Sci. 2022, 78, 2828–2837. [Google Scholar] [CrossRef] [PubMed]
- Forlani, L.; Juarez, M.P.; Lavarias, S.; Pedrini, N. Toxicological and biochemical response of the entomopathogenic fungus Beauveria bassiana after exposure to deltamethrin. Pest Manag. Sci. 2014, 70, 751–756. [Google Scholar] [CrossRef] [PubMed]
- Zhu, X.G.; Tong, S.M.; Ying, S.H.; Feng, M.G. Antioxidant activities of four superoxide dismutases in Metarhizium robertsii and their contributions to pest control potential. Appl. Microbiol. Biot. 2018, 102, 9221–9230. [Google Scholar] [CrossRef] [PubMed]
- Gao, Y.P.; Luo, M.; Wang, X.Y.; He, X.Z.; Lu, W.; Zheng, X.L. Pathogenicity of Beauveria bassiana PfBb and Immune Responses of a Non-Target Host, Spodoptera frugiperda (Lepidoptera: Noctuidae). Insects 2022, 13, 914. [Google Scholar] [CrossRef]
- Rodrigues, J.; Bergamini, C.; Montalva, C.; Humber, R.A.; Luz, C. Simple method to detect and to isolate entomopathogenic fungi (Hypocreales) from mosquito larvae. J. Invertebr. Pathol. 2021, 182, 107581. [Google Scholar] [CrossRef]
- Peng, Y.J.; Ding, J.L.; Lin, H.Y.; Feng, M.G.; Ying, S.H. A virulence-related lectin traffics into eisosome and contributes to functionality of cytomembrane and cell-wall in the insect-pathogenic fungus Beauveria bassiana. Fungal Biol. 2021, 125, 914–922. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Green Version]
- Khudhair, M.W.; Khalaf, M.Z.; Alrubeai, H.F.; Shbar, A.K.; Hamad, B.S.; Khalaf, H.S. Evaluating the virulence of Metarhizium anisopliae (Deuteromycotina: Hyphomycetes) and Beauveria bassiana (Ascomycota: Hypocreales) isolates to Arabian rhinoceros beetle, Oryctes agamemnon arabicus. J. Entomol. Acarol. Res. 2015, 47, 117–122. [Google Scholar] [CrossRef]
- Yu, H.; Yang, X.; Dai, J.; Li, Y.; Veeran, S.; Lin, J.; Shu, B. Effects of azadirachtin on detoxification-related gene expression in the fat bodies of the fall armyworm, Spodoptera frugiperda. Environ. Sci. Pollut. Res. 2022, 15, 0944–1344. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.B.; Tang, L.; Ying, S.H.; Feng, M.G. Regulative roles of glutathione reductase and four glutaredoxins in glutathione redox, antioxidant activity, and iron homeostasis of Beauveria bassiana. Appl. Microbiol. Biot. 2016, 100, 5907–5917. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.; Kim, J.C.; Lee, S.J.; Lee, M.R.; Park, S.E.; Li, D.; Baek, S.; Shin, T.Y.; Kim, J.S. Beauveria bassiana ERL836 and JEF-007 with similar virulence show different gene expression when interacting with cuticles of western flower thrips, Frankniella occidentalis. BMC Genom. 2020, 21, 836. [Google Scholar] [CrossRef]
- Rajula, J.; Pittarate, S.; Suwannarach, N.; Kumla, J.; Ptaszynska, A.A.; Thungrabeab, M.; Mekchay, S.; Krutmuang, P. Evaluation of Native Entomopathogenic Fungi for the Control of Fall Armyworm (Spodoptera frugiperda) in Thailand: A Sustainable Way for Eco-Friendly Agriculture. J. Fungi 2021, 7, 73. [Google Scholar] [CrossRef] [PubMed]
- Xin, C.; Xing, X.; Wang, F.; Liu, J.; Ran, Z.; Chen, W.; Wang, G.; Song, Z. MrMid2, encoding a cell wall stress sensor protein, is required for conidium production, stress tolerance, microsclerotium formation and virulence in the entomopathogenic fungus Metarhizium rileyi. Fungal Genet. Biol. 2020, 134, 103278. [Google Scholar] [CrossRef] [PubMed]
- Saheb, Y.P.; Manjula, K.; Devaki, K.; Jaya Lakshmi, R.S.; Reddy, B.R.; Venkateswarlu, N.C. Evaluation of Metarhizium (Nomuraea) rileyi (Farlow) Samson isolates against Spodoptera litura F. under in vitro conditions. J. Biol. Control. 2021, 35, 33–36. [Google Scholar] [CrossRef]
- Wang, Q.; Rui, C.; Wang, L.; Huang, W.; Zhu, J.; Ji, X.; Yang, Q.; Liang, P.; Yuan, H.; Cui, L. Comparative Toxicity and Joint Effects of Chlorantraniliprole and Carbaryl Against the Invasive Spodioptera frugiperda (Lepidoptera: Noctuidae). J. Econ. Entomol. 2022, 115, 1257–1267. [Google Scholar] [CrossRef]
- Hafeez, M.; Li, X.; Zhang, Z.; Huang, J.; Wang, L.; Zhang, J.; Shah, S.; Khan, M.M.; Xu, F.; Fernandez-Grandon, G.M.; et al. De Novo Transcriptomic Analyses Revealed Some Detoxification Genes and Related Pathways Responsive to Noposion Yihaogong((R)) 5% EC (Lambda-Cyhalothrin 5%) Exposure in Spodoptera frugiperda Third-Instar Larvae. Insects 2021, 12, 132. [Google Scholar] [CrossRef]
- Yoshida, Y.; Maeda, T.; Lee, B.; Hasunuma, K. Conidiation rhythm and light entrainment in superoxide dismutase mutant in Neurospora crassa. Mol. Genet. Genom. 2008, 279, 193–202. [Google Scholar] [CrossRef]
- Li, F.; Shi, H.Q.; Ying, S.H.; Feng, M.G. Distinct contributions of one Fe- and two Cu/Zn-cofactored superoxide dismutases to antioxidation, UV tolerance and virulence of Beauveria bassiana. Fungal Genet. Biol. 2015, 81, 160–171. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Chen, Y.; He, Y.; Zheng, L.; Fu, J.; Shi, M. Infection of Metarhizium anisopliae Ma6 and defense responses of host Phyllotreta striolata adults. Arch. Insect Biochem. 2022, 110, e21908. [Google Scholar] [CrossRef] [PubMed]
- Xie, X.Q.; Wang, J.; Huang, B.F.; Ying, S.H.; Feng, M.G. A new manganese superoxide dismutase identified from Beauveria bassiana enhances virulence and stress tolerance when overexpressed in the fungal pathogen. Appl. Microbiol. Biot. 2010, 86, 1543–1553. [Google Scholar] [CrossRef] [PubMed]
- Chu, X.L.; Dong, W.X.; Ding, J.L.; Feng, M.G.; Ying, S.H. Interactome analysis of transcriptional coactivator multiprotein bridging factor 1 unveils a yeast AP-1-like transcription factor involved in oxidation tolerance of mycopathogen Beauveria bassiana. Curr. Genet. 2018, 64, 275–284. [Google Scholar] [CrossRef]
- Zhou, Y.H.; Zhang, Y.J.; Luo, Z.B.; Fan, Y.H.; Tang, G.R.; Liu, L.J.; Pei, Y. Selection of optimal reference genes for expression analysis in the entomopathogenic fungus Beauveria bassiana during development, under changing nutrient conditions, and after exposure to abiotic stresses. Appl. Microbiol. Biot. 2012, 93, 679–685. [Google Scholar] [CrossRef] [PubMed]
- Lin, H.Y.; Wang, J.J.; Feng, M.G.; Ying, S.H. Autophagy-related gene ATG7 participates in the asexual development, stress response and virulence of filamentous insect pathogenic fungus Beauveria bassiana. Curr. Genet. 2019, 65, 1015–1024. [Google Scholar] [CrossRef]
- Zanella-Saenz, I.; Herniou, E.A.; Ibarra, J.E.; Huerta-Arredondo, I.A.; Del, R.M. Virulence and genetic characterization of six baculovirus strains isolated from different populations of Spodoptera frugiperda (Lepidoptera: Noctuidae). Arch. Microbiol. 2022, 204, 108. [Google Scholar] [CrossRef]
Primer Name | Primer Sequence (5′-3′) | Accession Number | Purpose |
---|---|---|---|
MrCAT 1 | F:GAAGTTGACGATGGCGATGC R:TCACTTCTCGTCCTGCGCAA | OAA38085.1 | RT-qPCR |
MrCAT 2 | F:CGCACACAACAACTTCTGGG R:GAAAGGCCTTCCAGTTCTCG | OAA43715.1 | RT-qPCR |
MrCAT 3 | F:CGCACACAACAACTTCTGGG R:GTTCTTCGCGTTCTTCGTCG | OAA44228.1 | RT-qPCR |
MrSOD 1 | F:CTTGGGTGGATGAAGGGCAT R:ACTCCTCGTTGTCACCCTTG | OAA47014.1 | RT-qPCR |
MrSOD2 | F:AACGGCGAGATAGTATCCCA R:TCCTATACGCACTATCGACG | OAA42094.1 | RT-qPCR |
MrSOD3 | F:TCGTGATGACTCATTGCAGC R:CGCATCCTCCAGCTTGATAT | OAA42645.1 | RT-qPCR |
MrSOD 4 | F:GCTACATACGACTCCAGCCC R:TCAACGATCCGTCCTCGCAA | OAA40597.1 | RT-qPCR |
ACTIN | F:CTTTTAATCGGCGCACGGAG R:CGAAGCTTGGCGCTATTGTC | OAA40333.1 | RT-qPCR (reference gene) |
Strain | Conidia Concentrations (Conidia/Ml) | Regression Equation | Correlation Coefficient (R Squared) |
---|---|---|---|
XSBN200920 | 1.0 × 104 | Y = 2.719X − 5.013 | 0.7479 |
1.0 × 105 | Y = 5.207X − 8.824 | 0.7578 | |
1.0 × 106 | Y = 7.923X − 13.50 | 0.8455 | |
1.0 × 107 | Y = 13.64X − 21.49 | 0.9041 | |
1.0 × 108 | Y = 15.59X − 17.75 | 0.9499 | |
HNQLZ200714 | 1.0 × 104 | Y = 1.506X − 2.704 | 0.7816 |
1.0 × 105 | Y = 2.742X − 4.629 | 0.9247 | |
1.0 × 106 | Y = 4.038X − 5.752 | 0.9397 | |
1.0 × 107 | Y = 6.900X − 7.681 | 0.9737 | |
1.0 × 108 | Y = 8.395X − 8.214 | 0.9697 |
Strain | Conidia Concentrations (Conidia/mL) | Regression Equation | Correlation Coefficient (R Squared) |
---|---|---|---|
XSBN200920 | 1.0 × 104 | Y = 1.739X − 2.725 | 0.8677 |
1.0 × 105 | Y = 3.092X − 5.164 | 0.9155 | |
1.0 × 106 | Y = 5.664X − 10.28 | 0.9414 | |
1.0 × 107 | Y = 8.313X − 9.786 | 0.9704 | |
1.0 × 108 | Y = 9.554X − 9.090 | 0.9661 | |
HNQLZ200714 | 1.0 × 104 | Y = 1.506X − 2.704 | 0.7816 |
1.0 × 105 | Y = 2.742X − 4.629 | 0.9247 | |
1.0 × 106 | Y = 4.038X − 5.752 | 0.9397 | |
1.0 × 107 | Y = 6.900X − 7.681 | 0.9737 | |
1.0 × 108 | Y = 8.395X − 8.214 | 0.9697 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pang, J.; Peng, Y.; Di, T.; Du, G.; Chen, B. Virulence of Metarhizium rileyi Is Determined by Its Growth and Antioxidant Stress and the Protective and Detoxifying Enzymes of Spodoptera frugiperda. Insects 2023, 14, 260. https://doi.org/10.3390/insects14030260
Pang J, Peng Y, Di T, Du G, Chen B. Virulence of Metarhizium rileyi Is Determined by Its Growth and Antioxidant Stress and the Protective and Detoxifying Enzymes of Spodoptera frugiperda. Insects. 2023; 14(3):260. https://doi.org/10.3390/insects14030260
Chicago/Turabian StylePang, Jixin, Yuejin Peng, Teng Di, Guangzu Du, and Bin Chen. 2023. "Virulence of Metarhizium rileyi Is Determined by Its Growth and Antioxidant Stress and the Protective and Detoxifying Enzymes of Spodoptera frugiperda" Insects 14, no. 3: 260. https://doi.org/10.3390/insects14030260