DNA Barcoding of the Palaearctic Elfin Butterflies (Lepidoptera, Lycaenidae) with a Description of Four New Species from Vietnam †
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Nomenclature Used in This Study
2.2. Sampling, DNA Extraction, PCR and Sequencing
2.3. Sequence Processing and Phylogenetic Analysis
2.4. Morphology and Distribution
3. Results
3.1. Phylogenetic Relationships
3.2. Taxonomy
3.2.1. Callophrys (Ahlbergia) hmong Krupitsky, Shapoval & Shapoval, sp. n. (Figure 2A,B, Figure 3A and Figure 4A)
Diagnosis
Description
3.2.2. Callophrys (Ahlbergia) tay Krupitsky, Shapoval & Shapoval, sp. n. (Figure 2C–E, Figure 3B and Figure 4B)
Diagnosis
Description
3.2.3. Callophrys (Cissatsuma) devyatkini Krupitsky, Shapoval & Shapoval, sp. n. (Figure 2F,G, Figure 3C and Figure 4C)
Diagnosis
Description
3.2.4. Callophrys (Ahlbergia) dao Krupitsky, Shapoval & Shapoval, sp. n. (Figure 2H and Figure 4D)
Diagnosis
Description
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Johnson, K. The Palaearctic «elfin» butterflies (Lycaenidae, Theclinae). Neue Ent. Nachr. 1992, 29, 1–141. [Google Scholar]
- Chou, I. Monographia Rhopalocerorum Sinensium; Henan Scientific and Technological Publishing House: Zhengzhou, China, 1994; p. 854. [Google Scholar]
- Johnson, K. A new elfin butterfly (Lycaenidae: Eumaeini) from northern China with comments on the nomenclature of Palaearctic Elfins. Taxon. Rep. 2000, 2, 1–5. [Google Scholar]
- Huang, H. A list of butterflies collected from Nujiang and Dulongjiang, China with descriptions of new species, new subspecies and revisional notes. Neue Ent. Nachr. 2003, 55, 3–114, 160–177. [Google Scholar]
- Huang, H.; Wuf, C.-S. New and little known Chinese butterflies in the collection of the Institute of Zoology, Academia Sinica, Beijing—1 (Lepidoptera, Rhopalocera). Neue Ent. Nachr. 2003, 55, 115–143. [Google Scholar]
- Huang, H.; Chen, Y.-C. A new species of Ahlbergia Bryk, 1946 from SE China. Atalanta 2005, 36, 161–168. [Google Scholar]
- Huang, H.; Chen, A.-M. Ahlbergia clarolinea spec. nov. from NW Yunnan province, China. Atalanta 2006, 37, 317–321. [Google Scholar]
- Huang, H.; Song, K. New or little known elfin lycaenids from Shaanxi, China. Atalanta 2006, 37, 161–167. [Google Scholar]
- Huang, H.; Zhan, C.-H. A new species of Ahlbergia Bryk, 1946 from Guangdong, SE China. Atalanta 2006, 37, 168–174. [Google Scholar]
- Huang, H.; Chen, Z.; Li, M. Ahlbergia confusa sp. n. from SE China. Atalanta 2006, 37, 175–183. [Google Scholar]
- Huang, H.; Zhou, L.-P. Discovery of two new species of the “elfin” butterflies from Shaanxi province, China. Atalanta 2014, 45, 139–150. [Google Scholar]
- Huang, H.; Sun, W.H. Ahlbergia bijieensis spec. nov. from Guizhou, China (Lepidoptera, Lycaenidae). Atalanta 2016, 47, 151–160. [Google Scholar]
- Huang, H.; Zhu, J.-Q. Ahlbergia maoweiweii sp. n. from Shaanxi, China with revisional notes on similar species (Lepidoptera: Lycaenidae). Zootaxa 2016, 4114, 409–433. [Google Scholar] [CrossRef] [PubMed]
- Yoshino, K. Description of a new species of Elfin Butterfly from Nagaland N.E. India. Butterfly Sci. 2016, 4, 12–19. [Google Scholar]
- Krupitsky, A.V. A new “elfin” butterfly species of Cissatsuma Johnson, 1992 (Lepidoptera, Lycaenidae) from northwestern Sichuan, China. Zootaxa 2018, 4524, 482–488. [Google Scholar] [CrossRef]
- Huang, H. New and little known butterflies from China—4. Atalanta 2021, 52, 345–413. [Google Scholar]
- Pelham, J.P. A catalogue of the butterflies of the United States and Canada, with a complete bibliography of the descriptive and systematic literature. J. Res. Lepid. 2008, 40, 1–652. [Google Scholar] [CrossRef]
- Zhang, J.; Cong, Q.; Shen, J.; Opler, P.; Grishin, N. Genomics-guided refinement of butterfly taxonomy. Taxon. Rep. 2021, 9, 1–54. [Google Scholar] [CrossRef]
- ten Hagen, W.; Miller, M.A. Molekulargenetische Untersuchungen der paläarktischen Arten des Genus Callophrys Billberg, 1820 mit Hilfe von mtDNA-COI-Barcodes und taxonomische Überlegungen (Lepidoptera: Lycaenidae). Nachr. Entomol. Ver. Apollo 2012, 30, 177–197. [Google Scholar]
- Valencia-Montoya, W.A.; Quental, T.B.; Tonini, J.F.R.; Talavera, G.; Crall, J.D.; Lamas, G.; Busby, R.C.; Carvalho, A.P.S.; Morais, A.B.; Oliveira, M.N.; et al. Evolutionary trade-offs between male secondary sexual traits revealed by a phylogeny of the hyperdiverse tribe Eumaeini (Lepidoptera: Lycaenidae). Proc. Royal Soc. B Biol. Sci. 2021, 288, 20202512. [Google Scholar] [CrossRef]
- Robbins, R.K.; Cong, Q.; Zhang, J.; Shen, J.; Busby, R.C.; Faynel, C.; Duarte, M.; Martins, A.R.P.; Prieto, C.; Lamas, G.; et al. Genomics-based higher classification of the species-rich hairstreaks (Lepidoptera: Lycaenidae: Eumaeini). Sys. Ent. 2022, 47, 445–469. [Google Scholar] [CrossRef]
- Shapoval, N.A.; Yakovlev, R.V.; Kuftina, G.N.; Lukhtanov, V.A.; Knyazev, S.A.; Romanovich, A.E.; Krupitsky, A.V. Identification of natural hybrids between Ahlbergia frivaldszkyi (Lederer, 1853) and Callophrys rubi (Linnaeus, 1758) (Lepidoptera, Lycaenidae) using mitochondrial and nuclear markers. Insects 2021, 12, 1124. [Google Scholar] [CrossRef] [PubMed]
- Ek-Amnuay, P. Butterflies of Thailand, 1st ed.; Amarin Printing and Publishing: Bangkok, Thailand, 2006; Volume 2, p. 849. [Google Scholar]
- Ek-Amnuay, P. Butterflies of Thailand, 2nd ed; Baan Lae Suan, Amarin Printing and Publishing: Bangkok, Thailand, 2012; p. 943. [Google Scholar]
- Ek-Amnuay, P.; Chiba, H.; Kimura, Y.; Inayoshi, Y.; Saito, K.; Seki, Y.; Uémura, Y. Corrigenda to “Butterflies of Thailand” (Ek-Amnuay, 2006). Yadoriga 2007, 213, 2–20. [Google Scholar]
- Nakamura, N.; Miyamoto, T.; Wakahara, H. Notes on the butterflies of Laos (6): Butterfly fauna of the montane region of central Laos including new records of twelve species. Butterflies (Teinopalpus) 2010, 55, 20–33. [Google Scholar]
- Monastyrskii, A.L. On the origin of the recent fauna of butterflies (Lepidoptera, Rhopalocera) of Vietnam. Entomol. Rev. 2010, 90, 39–58. [Google Scholar] [CrossRef]
- Monastyrskii, A.L.; Holloway, J.D. The biogeography of the butterfly fauna of Vietnam with a focus on the endemic species (Lepidoptera). In Current Progress in Biological Research; IntechOpen: London, UK, 2013; pp. 95–123. [Google Scholar] [CrossRef] [Green Version]
- Monastyrskii, A.L.; Devyatkin, A.L. Butterflies of Vietnam (An Illustrated Checklist), 2nd ed.; Vietnam Publishing House of Natural Resources, Environment and Cartography: Hanoi, Vietnam, 2015; p. 95. [Google Scholar]
- Van Lien, V. Species list and conservation priority of butterflies (Lepidoptera, Rhopalocera) in Dong Van Karst Plateau, Ha Giang Province. Acad. J. Biol. 2014, 36, 444–450. [Google Scholar]
- Catalogue of the Suguru Igarashi Insect Collection, The University Museum, The University of Tokyo. Part IV. Lepidoptera: Lycaenidae & Riodinidae. Available online: http://umdb.um.u-tokyo.ac.jp/DDoubutu/igarashi04/en/index.php (accessed on 13 January 2023).
- Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R.C. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar]
- Hajibabaei, M.; Janzen, D.H.; Burns, J.M.; Hallwachs, W.; Hebert, P.D.N. DNA barcodes distinguish species of tropical Lepidoptera. Proc. Nat. Acad. Sci. USA 2006, 103, 968–971. [Google Scholar] [CrossRef] [Green Version]
- Lukhtanov, V.A.; Sourakov, A.; Zakharov, E.V.; Hebert, P.D.N. DNA barcoding Central Asian butterflies: Increasing geographical dimension does not significantly reduce the success of species identification. Mol. Ecol. Res. 2009, 9, 1302–1313. [Google Scholar] [CrossRef]
- Kearse, M.; Moir, R.; Wilson, A.; Stones-Havas, S.; Cheung, M.; Sturrock, S.; Buxton, S.; Cooper, A.; Markowitz, S.; Duran, C.; et al. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 2012, 28, 1647–1649. [Google Scholar] [CrossRef] [Green Version]
- Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [Green Version]
- Lanfear, R.; Calcott, B.; Ho, S.Y.W.; Guindon, S. PartitionFinder: Combined selection of partitioning schemes and substitution models for phylogenetic analyses. Mol. Biol. Evol. 2012, 29, 1695–1701. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Miller, L.D. Nomenclature of wing weins and cells. J. Res. Lepid. 1970, 8, 37–48. [Google Scholar] [CrossRef]
- Igarashi, S. Ahlbergia haradai, a new Lycaenid Butterfly from Nepal. Trans. Lepidopterol. Soc. Jpn. 1973, 23, 68–74. [Google Scholar]
- van der Poel, P.; Limbu, S. Re-discovery of the prickly ash elfin Ahlbergia haradai Igarashi, 1973 (Insecta: Lepidoptera: Lycaenidae) in Nepal. Bionotes 2019, 21, 61–62. [Google Scholar]
- Hsu, Y.-F. A new species of Chrysozephyrus associated with Lithocarpus corneus (Lepidoptera: Lycaenidae: Theclini). Zootaxa 2018, 4377, 143–150. [Google Scholar] [CrossRef]
- Shirôzu, T.; Yamamoto, H. A generic revision and the phylogeny of the tribe Theclini (Lepidoptera: Lycaenidae). Sieboldia 1956, 1, 329–421. [Google Scholar]
- ten Hagen, W. Beitrag zur Kenntnis von Callophrys mystaphia Miller, 1913 (Lepidoptera: Lycaenidae). Nachr. Entomol. Ver. Apollo 2006, 27, 131–137. [Google Scholar]
- Krupitsky, A.V.; Kolesnichenko, K.A. A new species of the Callophrys mystaphia Miller, 1913—Group from Iran (Lepidoptera: Lycaenidae: Eumaeini). Zootaxa 2013, 3619, 460–466. [Google Scholar] [CrossRef] [Green Version]
- Hebert, P.D.N.; Cywinska, A.; Ball, S.L.; DeWaard, J.R. Biological identifications through DNA barcodes. Proc. R. Soc. Lond. B Biol. Sci. 2003, 270, 313–321. [Google Scholar] [CrossRef] [Green Version]
- Krupitsky, A.V.; Shapoval, N.A.; Schepetov, D.M.; Ekimova, I.A.; Lukhtanov, V.A. Phylogeny, species delimitation and biogeography of the endemic Palaearctic tribe Tomarini (Lepidoptera: Lycaenidae). Zool. J. Linn. Soc. 2022, 196, 630–646. [Google Scholar] [CrossRef]
- Talavera, G.; Lukhtanov, V.A.; Rieppel, L.; Pierce, N.E.; Vila, R. In the shadow of phylogenetic uncertainty: The recent diversification of Lysandra butterflies through chromosomal change. Mol. Phylogenet. Evol. 2013, 69, 469–478. [Google Scholar] [CrossRef]
- Lukhtanov, V.A.; Dantchenko, A.V.; Vishnevskaya, M.S.; Saifitdinova, A.F. Detecting cryptic species in sympatry and allopatry: Analysis of hidden diversity in Polyommatus (Agrodiaetus) butterflies (Lepidoptera: Lycaenidae). Biol. J. Linn. Soc. 2015, 116, 468–485. [Google Scholar] [CrossRef] [Green Version]
- Lukhtanov, V.A.; Shapoval, N.A.; Anokhin, B.A.; Saifitdinova, A.F.; Kuznetsova, V.G. Homoploid hybrid speciation and genome evolution via chromosome sorting. Proc. R. Soc. Lond. B Biol. Sci. 2015, 282, 20150157. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Whitworth, T.L.; Dawson, R.D.; Magalon, H.; Baudry, E. DNA barcoding cannot reliably identify species of the blowfly genus Protocalliphora (Diptera: Calliphoridae). Proc. R. Soc. Lond. B Biol. Sci. 2007, 274, 1731–1739. [Google Scholar] [CrossRef] [Green Version]
Code | Genus | Subgenus | Species | Locality | Accession No. | Note |
---|---|---|---|---|---|---|
CAL141 * | Callophrys | Ahlbergia | hmong sp. n. | VIETNAM, Ha Giang Prov., Dong Van | OM630550 | HT |
CAL071 * | Callophrys | Ahlbergia | hmong sp. n. | VIETNAM, Ha Giang Prov., Dong Van | OM630537 | PT |
CAL123 | Callophrys | Ahlbergia | hmong sp. n. | VIETNAM, Ha Giang Prov., Dong Van | OM630538 | PT |
CAL125 * | Callophrys | Ahlbergia | hmong sp. n. | VIETNAM, Ha Giang Prov., Dong Van | OM630539 | PT |
CAL126 * | Callophrys | Ahlbergia | hmong sp. n. | VIETNAM, Ha Giang Prov., Dong Van | OM630540 | PT |
CAL128 * | Callophrys | Ahlbergia | hmong sp. n. | VIETNAM, Ha Giang Prov., Dong Van | OM630541 | PT |
CAL129 | Callophrys | Ahlbergia | hmong sp. n. | VIETNAM, Ha Giang Prov., Dong Van | OM630542 | PT |
CAL130 | Callophrys | Ahlbergia | hmong sp. n. | VIETNAM, Ha Giang Prov., Dong Van | OM630543 | PT |
CAL132 | Callophrys | Ahlbergia | hmong sp. n. | VIETNAM, Ha Giang Prov., Dong Van | OM630544 | PT |
CAL133 | Callophrys | Ahlbergia | hmong sp. n. | VIETNAM, Ha Giang Prov., Dong Van | OM630545 | PT |
CAL134 | Callophrys | Ahlbergia | hmong sp. n. | VIETNAM, Ha Giang Prov., Dong Van | OM630546 | PT |
CAL135 * | Callophrys | Ahlbergia | hmong sp. n. | VIETNAM, Ha Giang Prov., Dong Van | OM630547 | PT |
CAL139 | Callophrys | Ahlbergia | hmong sp. n. | VIETNAM, Ha Giang Prov., Dong Van | OM630548 | PT |
CAL140 | Callophrys | Ahlbergia | hmong sp. n. | VIETNAM, Ha Giang Prov., Dong Van | OM630549 | PT |
CAL147 | Callophrys | Ahlbergia | hmong sp. n. | VIETNAM, Ha Giang Prov., Dong Van | n/a | PT |
CAL148 | Callophrys | Ahlbergia | hmong sp. n. | VIETNAM, Ha Giang Prov., Dong Van | n/a | PT |
CAL122 * | Callophrys | Ahlbergia | tay sp. n. | VIETNAM, Ha Giang Prov., Dong Van | OM630557 | HT |
CAL096 * | Callophrys | Ahlbergia | tay sp. n. | VIETNAM, Ha Giang Prov., Dong Van | OM630553 | PT |
CAL121 * | Callophrys | Ahlbergia | tay sp. n. | VIETNAM, Ha Giang Prov., Dong Van | OM630552 | PT |
CAL124 * | Callophrys | Ahlbergia | tay sp. n. | VIETNAM, Ha Giang Prov., Dong Van | OM630554 | PT |
CAL131 * | Callophrys | Ahlbergia | tay sp. n. | VIETNAM, Ha Giang Prov., Dong Van | OM630555 | PT |
CAL136 * | Callophrys | Ahlbergia | tay sp. n. | VIETNAM, Ha Giang Prov., Dong Van | OM630551 | PT |
CAL138 * | Callophrys | Ahlbergia | tay sp. n. | VIETNAM, Ha Giang Prov., Dong Van | OM630556 | PT |
CAL142 | Callophrys | Ahlbergia | tay sp. n. | VIETNAM, Ha Giang Prov., Dong Van | n/a | PT |
CAL144 | Callophrys | Ahlbergia | tay sp. n. | VIETNAM, Ha Giang Prov., Dong Van | n/a | PT |
CAL145 | Callophrys | Ahlbergia | tay sp. n. | VIETNAM, Ha Giang Prov., Dong Van | n/a | PT |
CAL146 | Callophrys | Ahlbergia | tay sp. n. | VIETNAM, Ha Giang Prov., Dong Van | n/a | PT |
CAL137 * | Callophrys | Ahlbergia | dao sp. n. | VIETNAM, Ha Giang Prov., Dong Van | OM641843 | HT |
GS119 * | Callophrys | Ahlbergia | clarolinea comb. nov. | CHINA, NW Yunnan, Lijiang | OM630558 | |
GS120 * | Callophrys | Ahlbergia | clarolinea comb. nov. | CHINA, NW Yunnan, Lijiang | OM630559 | |
CAL065 | Callophrys | Ahlbergia | ferrea | JAPAN, Hokkaido, Kato-gun | OM630560 | |
CAL066 | Callophrys | Ahlbergia | ferrea | JAPAN, Hokkaido, Kato-gun | OM630561 | |
CAL069 * | Callophrys | Cissatsuma | devyatkini sp. n. | VIETNAM, Ha Giang Prov., Dong Van | OM630566 | HT |
CAL070 * | Callophrys | Cissatsuma | devyatkini sp. n. | VIETNAM, Ha Giang Prov., Dong Van | OM630567 | PT |
CAL143 * | Callophrys | Cissatsuma | devyatkini sp. n. | VIETNAM, Ha Giang Prov., Dong Van | OM630568 | PT |
CAL127 | Callophrys | Cissatsuma | devyatkini sp. n. | VIETNAM, Ha Giang Prov., Dong Van | OM630569 | PT |
CAL149 * | Callophrys | Cissatsuma | devyatkini sp. n. | VIETNAM, Ha Giang Prov., Dong Van | n/a | PT |
CAL072 * | Callophrys | Cissatsuma | berezowskii comb nov. | CHINA, Sichuan Prov., Aba Pref., Chuanzhusi | OM630564 | |
CAL073 * | Callophrys | Cissatsuma | berezowskii comb nov. | CHINA, Sichuan Prov., Aba Pref., Chuanzhusi | OM630565 | |
CAL074 * | Callophrys | Ahlbergia | sp. | CHINA, Sichuan Prov., Wenchuan env. | OM630562 | |
CAL075 * | Callophrys | Ahlbergia | sp. | CHINA, Sichuan Prov., Jinchuan County | OM630563 | |
CAL094 * | Callophrys | Novosatsuma | prodiga comb. nov. | CHINA, Yunnan Prov., Dali | OM630570 | |
CAL095 * | Callophrys | Novosatsuma | collosa comb. nov. | CHINA, Shaanxi Prov., Taibaishan Mts. | OM630572 | |
CAL097 * | Callophrys | Novosatsuma | magnapurpurea comb. nov. | CHINA, Yunnan Prov., Wumeng Mt. | OM630571 | |
Callophrys | Ahlbergia | frivaldszkyi | RUSSIA, Omsk Oblast | OL457026 | ||
Callophrys | Ahlbergia | frivaldszkyi | RUSSIA, Irkutsk Oblast | MW785858 | ||
Callophrys | Ahlbergia | frivaldszkyi | RUSSIA, Irkutsk Oblast | MW785859 | ||
Callophrys | Callophrys | rubi | MOROCCO, Ifrane | MT260503 | ||
Callophrys | Callophrys | rubi | RUSSIA, Moscow Oblast | MW502280 | ||
Callophrys | Callophrys | avis | SPAIN, Barcelona | GU676347 | ||
Callophrys | Callophrys | avis | SPAIN, Barcelona | GU676532 | ||
Callophrys | Cisincisalia | johnsoni | USA | JN000833 | ||
Callophrys | Incisalia | augustinus | USA, California | HQ561190 | ||
Callophrys | Incisalia | henrici | USA, Maryland | KP150273 | ||
Callophrys | Incisalia | eryphon | USA, Colorado | HQ583526 | ||
Callophrys | Incisalia | niphon | USA, Maryland | KP150297 | ||
Callophrys | Incisalia | irus | USA, Maryland | KP150284 | ||
Callophrys | Incisalia | polios | CANADA, Manitoba | KT129894 | ||
Callophrys | Mitoura | gryneus | CANADA, Ontario | KT133344 | ||
Neolycaena | Rhymnaria | baidula | KYRGYZSTAN, Inner Tian Shan | MW785936 |
Primer Pair | Fragment Length (bp) | Reference |
---|---|---|
LepF (ATTCAACCAATCATAAAGATATTGG) LepR (TAAACTTCTGGATGTCCAAAAAATCA) | 658 | [33] |
LCO1490 (GGTCAACAAATCATAAAGATATTGG) HCO2198 (TAAACTTCAGGGTGACCAAAAAATCA) | 658 | [32] |
LepF (ATTCAACCAATCATAAAGATATTGG) MH-MR1 (CCTGTTCCAGCTCCATTTTC) | 307 | [34] |
LCO1490 (GGTCAACAAATCATAAAGATATTGG) MH-MR1 (CCTGTTCCAGCTCCATTTTC) | 307 | [34] |
MH-MF1 (GCTTTCCCACGA ATAAATAATA) LepR (TAAACTTCTGGATGTCCAAAAAATCA) | 407 | [34] |
MH-MF1 (GCTTTCCCACGA ATAAATAATA) HCO2198 (TAAACTT CAGGGTGACCAAAAAATCA) | 407 | [34] |
LepF (ATTCAACCAATCATAAAGATATTGG) Ahl01R (RGGTATAACTATRAAAAAAATTAT) | 145 | [33]/this study |
LCO1490 (GGTCAACAAATCATAAAGATATTGG) Ahl01R (RGGTATAACTATRAAAAAAATTAT) | 145 | [32]/this study |
Ahl02F (ATTGGAGATGATCAAATTTATAAT) Ahl02R (TCAAAATCTYATATTATTTATTCG) | 120 | This study |
Ahl03F (TTATAATTGGAGGATTTGGAAATTG) Ahl03R (AGTGGGGGGTAAACTGTTCATCC) | 130 | This study |
Ahl04F (AGTAGAATTGTAGAAAATGG) Ahl04R (GTTGTAATAAAATTAATRGCTCC) | 114 | This study |
Ahlfwd372F (GATCATCAGTTGATTTAGCTATT) Ahl05R (GTTAATARTATAGTAATAGCTCC) | 168 | This study |
Ahl05F (ATTTTTTCTCTYCATTTAGCTGG) Ahl05R (GTTAATARTATAGTAATAGCTCC) | 148 | This study |
Ahl06F (TATTTATTTGATCYGTAGGWATTAC) LepR (TAAACTTCTGGATGTCCAAAAAATCA) | 133 | This study/ [33] |
Ahl06F (TATTTATTTGATCYGTAGGWATTAC) HCO2198 (TAAACTT CAGGGTGACCAAAAAATCA) | 133 | This study/ [32] |
Taxon | 1 | 2 | 3 | 4 | 5 | 6 | 7 | 8 | 9 | 10 | 11 | 12 | 13 | |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
1 | Callophrys (Ahlbergia) hmong sp.n. | 0.02 ± 0.02 | ||||||||||||
2 | Callophrys (Ahlbergia) tay sp. n. (incl. C. (A.) dao sp. n.) | 1.10 ± 0.39 | 0.07 ± 0.07 | |||||||||||
3 | Callophrys (Ahlbergia) clarolinea | 0.60 ± 0.29 | 0.80 ± 0.33 | 0.00 ± 0.00 | ||||||||||
4 | Callophrys (Ahlbergia) ferrea | 1.05 ± 0.38 | 0.96 ± 0.37 | 0.76 ± 0.34 | 0.00 ± 0.00 | |||||||||
5 | Callophrys (Ahlbergia) frivaldszkyi | 2.42 ± 0.58 | 1.87 ± 0.52 | 2.13 ± 0.55 | 1.98 ± 0.53 | 0.00 ± 0.00 | ||||||||
6 | Callophrys (Ahlbergia) sp. | 2.12 ± 0.55 | 1.56 ± 0.47 | 1.82 ± 0.51 | 1.67 ± 0.50 | 0.61 ± 0.29 | 0.00 ± 0.00 | |||||||
7 | Callophrys (Cissatsuma) berezowskii | 2.19 ± 0.55 | 1.79 ± 0.49 | 1.90 ± 0.50 | 1.90 ± 0.51 | 0.53 ± 0.27 | 0.46 ± 0.24 | 0.15 ± 0.15 | ||||||
8 | Callophrys (Cissatsuma) devyatkini sp. n. | 2.42 ± 0.58 | 1.87 ± 0.51 | 2.13 ± 0.54 | 1.98 ± 0.52 | 0.61 ± 0.30 | 0.61 ± 0.29 | 0.53 ± 0.26 | 0.00 ± 0.00 | |||||
9 | Callophrys (Novosatsuma) prodiga | 2.72 ± 0.64 | 2.17 ± 0.56 | 2.42 ± 0.59 | 2.28 ± 0.57 | 1.22 ± 0.45 | 0.91 ± 0.37 | 1.14 ±0.41 | 1.22 ± 0.43 | n/a | ||||
10 | Callophrys (Novosatsuma) collosa | 1.96 ± 0.53 | 1.41 ± 0.44 | 1.67 ± 0.48 | 1.52 ± 0.46 | 0.46 ± 0.26 | 0.15 ± 0.15 | 0.38 ± 0.21 | 0.46 ± 0.26 | 0.76 ± 0.34 | n/a | |||
11 | Callophrys (Novosatsuma) magnapurpurea | 2.42 ± 0.59 | 1.87 ± 0.51 | 2.13 ± 0.54 | 1.98 ± 0.52 | 0.91 ± 0.38 | 0.61 ± 0.29 | 0.84 ± 0.34 | 0.91 ± 0.37 | 0.30 ± 0.22 | 0.46 ± 0.26 | n/a | ||
12 | Callophrys (Callophrys) rubi | 2.12 ± 0.55 | 1.56 ± 0.47 | 1.82 ± 0.50 | 1.67 ± 0.49 | 0.61 ± 0.29 | 0.30 ± 0.20 | 0.53 ± 0.25 | 0.61 ± 0.30 | 0.91 ± 0.37 | 0.15 ± 0.15 | 0.61 ± 0.30 | 0.00 ± 0.00 | |
13 | Callophrys (Callophrys) avis | 1.66 ± 0.50 | 1.56 ± 0.49 | 1.37 ± 0.46 | 0.91 ± 0.36 | 2.13 ± 0.57 | 1.67 ± 0.51 | 1.90 ± 0.52 | 1.82 ± 0.52 | 2.43 ± 0.60 | 1.67 ± 0.51 | 2.13 ± 0.56 | 1.82 ± 0.53 | 0.00 ± 0.00 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Krupitsky, A.; Shapoval, N.; Shapoval, G. DNA Barcoding of the Palaearctic Elfin Butterflies (Lepidoptera, Lycaenidae) with a Description of Four New Species from Vietnam. Insects 2023, 14, 352. https://doi.org/10.3390/insects14040352
Krupitsky A, Shapoval N, Shapoval G. DNA Barcoding of the Palaearctic Elfin Butterflies (Lepidoptera, Lycaenidae) with a Description of Four New Species from Vietnam. Insects. 2023; 14(4):352. https://doi.org/10.3390/insects14040352
Chicago/Turabian StyleKrupitsky, Anatoly, Nazar Shapoval, and Galina Shapoval. 2023. "DNA Barcoding of the Palaearctic Elfin Butterflies (Lepidoptera, Lycaenidae) with a Description of Four New Species from Vietnam" Insects 14, no. 4: 352. https://doi.org/10.3390/insects14040352