Identification and Validation of Reference Genes for Expression Analysis Using RT-qPCR in Leptocybe invasa Fisher and La Salle (Hymenoptera: Eulophidae)
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Insect Rearing and Plant Preparing
2.2. Experimental Treatments
2.2.1. Different Sex
2.2.2. Adult Somite
2.2.3. Temperature Treatments
2.2.4. Diet Treatments
2.2.5. Pesticide Treatments
2.3. RNA Extraction and cDNA Synthesis
2.4. Reference Gene Selection and Primer Design
2.5. RT-qPCR
2.6. Analyzing Reference Genes and Handling Data
2.7. Verification of Reference Gene Stability
3. Results
3.1. RNA Quality and Amplification Efficiency
3.2. Levels of Expression of Reference Genes
3.3. geNorm Analysis
3.4. Comparative ∆Ct Analysis
3.5. NormFinder Analysis
3.6. BestKeeper Analysis
3.7. Comprehensive Ranking of Reference Genes
3.8. Verification of Reference Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hua, L.S.; Chen, L.W.; Antov, P.; Kristak, L.; Tahir, P.M. Engineering wood products from Eucalyptus spp. Adv. Mater. Sci. 2022, 2022, 8000780. [Google Scholar]
- Mendel, Z.; Protasov, A.; Fisher, N.; La Salle, J. Taxonomy and biology of Leptocybe invasa gen. & sp. n. (Hymenoptera: Eulophidae), an invasive gall inducer on Eucalyptus. Austral. Entom. 2004, 43, 101–113. [Google Scholar]
- Zhang, H.; Song, J.Y.; Zhao, H.X.; Li, M.; Han, W.H. Predicting the distribution of the invasive species Leptocybe invasa: Combining MaxEnt and Geodetector models. Insects 2021, 12, 92. [Google Scholar] [CrossRef] [PubMed]
- Carvalho, M.A.F.; Pinto, I.O.; Sarmento, M.I.; Carvalho, P.H.N.; da Silva, R.S.; Rocha, J.P.L.; Sarmento, R.A. Assessment performance of Eucalyptus clones attacked by the recent invasion of Leptocybe invasa (Hymenoptera: Eulophidae): Implications to invasion pest management. J. Asia-Pacif. Entomol. 2022, 25, 101939. [Google Scholar] [CrossRef]
- Zheng, X.L.; Li, J.; Yang, Z.D.; Xian, Z.H.; Wei, J.G.; Lei, C.L.; Wang, X.P.; Lu, W. A review of invasive biology, prevalence and management of Leptocybe invase Fisher & La Salle (Hymenoptera: Eulophidae). Afr. Entomol. 2015, 22, 68–79. [Google Scholar]
- Peng, X.; Wang, H.T.; Guo, C.H.; Hu, P.; Xu, L.; Zhou, J.; Ding, Z.R.; Yang, Z.D. Genetic diversity analysis of the invasive gall pest Leptocybe invasa (Hymenoptera: Apodemidae) from China. PLoS ONE 2021, 16, e0258610. [Google Scholar] [CrossRef]
- Guo, C.H.; Peng, X.; Wang, H.T.; Zheng, X.L.; Hu, P.; Zhou, J.; Ding, Z.R.; Wang, X.; Yang, Z.D. Bacterial diversity of Leptocybe invasa Fisher & La Salle (Hymenoptera: Eulophidae) from different geographical conditions in China. Arch. Ins. Biochem. Phys. 2021, 108, e21847. [Google Scholar]
- Bustin, S.A. Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): Trends and problems. J. Mol. Endocrinol. 2002, 29, 23–39. [Google Scholar] [CrossRef]
- Valasek, M.A.; Repa, J.J. The power of real-time PCR. Adv. Physiol. Educ. 2005, 29, 151–159. [Google Scholar] [CrossRef]
- Vandesompele, J.; Preter, K.D.; Pattyn, F.; Poppe, B.; Roy, N.V.; Paepe, A.D.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, research0034.1. [Google Scholar] [CrossRef]
- Jain, M.; Nijhawan, A.; Tyagi, A.K.; Khurana, J.P. Validation of housekeeping genes as internal control for studying gene expression in rice by quantitative real-time PCR. Biochem. Biophys. Res. Commun. 2006, 345, 646–651. [Google Scholar] [CrossRef] [PubMed]
- Sękalska, B.; Ciechanowicz, A.; Dołęgowska, B.; Naruszewicz, M. Optimized RT-PCR method for assaying expression of monocyte chemotactic protein type 1 (MCP-1) in Rabbit Aorta. Biochem. Genet. 2006, 44, 129–139. [Google Scholar] [CrossRef]
- Yang, C.X.; Pan, H.P.; Liu, Y.; Zhou, X.G. Selection of reference genes for expression analysis using quantitative Real-Time PCR in the Pea Aphid, Acyrthosiphon pisum (Harris) (Hemiptera, Aphidiae). PLoS ONE 2014, 9, e110454. [Google Scholar] [CrossRef]
- Zhang, Y.; Liu, F.J.; Guo, H.Y.; Ma, H.; Chen, H.; Song, Y.Y.; Chen, P.; Xu, Q.L. Selection of reference genes for quantitative real-time PCR analysis in Lathyrus sativus L. under different development stages and drought stress. Gene Resour. Crop Evol. 2022, 69, 2319–2330. [Google Scholar] [CrossRef]
- He, Y.D.; Zhong, Y.; Bao, Z.Z.; Wang, W.Q.; Xu, X.Q.; Gai, Y.N.; Wu, J. Evaluation of Angelica decursiva reference genes under various stimuli for RT-qPCR data normalization. Sci. Rep. 2021, 11, 18993. [Google Scholar] [CrossRef]
- Liu, Q.X.; Qi, X.; Yan, H.D.; Huang, L.K.; Nie, G.; Zhang, X.Q. Reference gene selection for quantitative Real-Time reverse-transcriptase PCR in Annual Ryegrass (Lolium multiflorum) subjected to various abiotic stresses. Molecules 2018, 23, 172. [Google Scholar] [CrossRef]
- Liu, Z.X.; Xiao, J.J.; Xia, Y.; Wu, Q.F.; Zhao, C.; Li, D.S. Selection and validation of reference genes for RT-qPCR-based analyses of Anastatus japonicus Ashmead (Hymenoptera: Helicopteridae). Front. Physiol. 2022, 13, 1046204. [Google Scholar] [CrossRef]
- Wei, H.S.; Qiao, H.; Liu, S.; Yuan, X.Q.; Xu, C.Q. Transcriptome-based selection and validation of reference genes for gene expression in Goji Fruit Fly (Neoceratitis asiatica Becker) under developmental stages and five abiotic stresses. Int. J. Mol. Sci. 2022, 24, 451. [Google Scholar] [CrossRef]
- Xie, F.L.; Sun, G.L.; Stiller, J.W.; Zhang, B.H. Genome-wide functional analysis of the cotton transcriptome by creating an integrated EST database. PLoS ONE 2011, 6, e26980. [Google Scholar] [CrossRef]
- Andersen, C.L.; Jensen, J.L.; Ørntoft, T.F. Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004, 64, 5245–5250. [Google Scholar] [CrossRef]
- Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper--Excel-based tool using pair-wise correlations. Biotechnol. Lett. 2004, 26, 509–515. [Google Scholar] [CrossRef]
- Silver, N.; Best, S.; Jiang, J.; Thein, S.L. Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR. BMC Mol. 2006, 7, 33. [Google Scholar] [CrossRef]
- Su, W.B.; Yuan, Y.; Zhang, L.; Jiang, Y.Y.; Gan, X.Q.; Bai, Y.L.; Peng, J.G.; Wu, J.C.; Liu, Y.X.; Lin, S.Q. Selection of the optimal reference genes for expression analyses in different materials of Eriobotrya japonica. Plant. Methods 2019, 15, 7. [Google Scholar] [CrossRef]
- Radoni, A.; Thulke, S.; Mackay, I.M.; Landt, O.; Siegert, W.G.; Nitsche, A. Guideline to reference gene selection for quantitative real-time PCR. Biochem. Biophys. Res. Commun. 2004, 313, 856–862. [Google Scholar] [CrossRef]
- Meuer, M.S.; Wittwer, C.; Nakagawara, K.I. Rapid Cycle Real-Time PCR; Springer: Berlin/Heidelberg, Germany, 2001. [Google Scholar]
- Hu, C.; Yang, J.; Qi, Z.P.; Wu, H.; Wang, B.L.; Zou, F.M.; Mei, H.S.; Liu, J.; Wang, W.C.; Liu, Q.S. Heat shock proteins: Biological functions, pathological roles, and therapeutic opportunities. MedComm 2022, 3, e161. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)). Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Pihur, V.; Datta, S.; Datta, S. RankAggreg, an R package for weighted rank aggregation. BMC Bioinform. 2009, 10, 62. [Google Scholar] [CrossRef]
- Niaz, Z.S.; Sui, Z.H.; Riaz, S.; Liu, Y.; Shang, E.; Xing, Q.K.; Khan, S.; Du, Q.W.; Zhou, W.; Wang, J.G. Identification of valid reference genes for the normalization of RT-qPCR gene expression data in Alexandrium catenella under different nutritional conditions. J. Appl. Phycol. 2019, 31, 1819–1833. [Google Scholar] [CrossRef]
- Wang, M.; Ren, T.T.; Marowa, P.; Du, H.N.; Xu, Z.C. Identification and selection of reference genes for gene expression analysis by quantitative real-time PCR in Suaeda glauca’s response to salinity. Sci. Rep. 2021, 11, 8569. [Google Scholar] [CrossRef]
- Zhao, X.Y.; Guo, J.W.; Lu, Y.H.; Sun, T.Y.; Tian, J.; Huang, J.L.; Xu, H.X.; Wang, Z.L.; Lu, Z.X. Reference genes for expression analysis using RT-qPCR in Cnaphalocrocis medinalis (Lepidoptera: Pyralidae). Insects 2022, 13, 1046. [Google Scholar] [CrossRef]
- Cheng, D.F.; Zhang, Z.L.; He, X.F.; Liang, G.W. Validation of reference genes in Solenopsis invicta in different developmental stages, castes and tissues. PLoS ONE 2013, 8, e57718. [Google Scholar] [CrossRef] [PubMed]
- Gao, X.K.; Zhang, S.; Luo, J.Y.; Wang, C.Y.; Lv, L.M.; Zhang, L.J.; Zhu, X.Z.; Wang, L.; Cui, J.J. Identification and validation of reference genes for gene expression analysis in Aphidius gifuensis (Hymenoptera: Aphidiidae). PLoS ONE 2017, 12, e0188477. [Google Scholar] [CrossRef] [PubMed]
- Lourenco, A.P.; Mackert, A.; Cristino, A.D.S.; Simoes, Z.L.P. Validation of reference genes for gene expression studies in the honey bee, Apis mellifera, by quantitative real-time RT-PCR. Apidologie 2008, 39, 372–385. [Google Scholar] [CrossRef]
- Wang, B.; Duan, H.R.; Chong, P.F.; Su, S.P.; Shan, L.S.; Yi, D.; Wang, L.R.; Li, Y. Systematic selection and validation of suitable reference genes for quantitative real-time PCR normalization studies of gene expression in Nitraria tangutorum. Sci. Rep. 2020, 10, 15891. [Google Scholar] [CrossRef] [PubMed]
- Shakeel, M.; Rodriguez, A.; Tahir, U.B.; Jin, F.L. Gene expression studies of reference genes for quantitative real-time PCR: An overview in insects. Biotechnol. Lett. 2018, 40, 227–236. [Google Scholar] [CrossRef]
- Wang, J.X.; Manzar, A.; Wen, Y.Z.; Niu, D.S.; Ling, W.; Sun, Y.H.; Li, Y.; Joe, H.J. Selection and validation of reference genes for quantitative gene expression analyses in black locust (Robinia pseudoacacia L.) using real-time quantitative PCR. PLoS ONE 2018, 13, e0193076. [Google Scholar] [CrossRef]
- Ponton, F.; Chapuis, M.P.; Pernice, M.; Sword, G.A.; Simpson, S.J. Evaluation of potential reference genes for reverse transcription-qPCR studies of physiological responses in Drosophila melanogaster. J. Insect Physiol. 2011, 57, 840–850. [Google Scholar] [CrossRef]
- Zhang, J.S.; Xia, Y.W.; Wang, C.L.; Han, D.L.; Ren, D.S.; Zheng, J.; Xu, X.; He, Y.R.; Wang, D.S. Morphological and molecular identification of tropical bed bugs from two cities of the Pearl River Delta in China. J. Med. Entomol. 2021, 58, 471–474. [Google Scholar] [CrossRef]
- Yang, Q.P.; Li, Z.; Cao, J.J.; Zhang, S.D.; Zhang, X.; Wu, Q.; Zhang, H.J.; Wu, X.Y.; Zhang, Q.W.; Liu, X.X. Selection and assessment of reference genes for quantitative PCR normalization in migratory locust Locusta migratoria (Orthoptera: Acrididae). PLoS ONE 2014, 9, e98164. [Google Scholar] [CrossRef]
- Shu, B.S.; Zhang, J.J.; Cui, G.F.; Sun, R.R.; Sethuraman, V.R.; Yi, X.; Zhong, G.H. Evaluation of reference genes for Real-Time quantitative PCR analysis in larvae of Spodoptera litura exposed to azadirachtin stress conditions. Front. Physiol. 2018, 9, 372. [Google Scholar] [CrossRef]
- Niu, K.J.; Shi, Y.; Ma, H.L. Selection of candidate reference genes for gene expression analysis in Kentucky Bluegrass (Poa pratensis L.) under Abiotic Stress. Front. Plant. Sci. 2017, 8, 193. [Google Scholar] [CrossRef] [PubMed]
- Chatelain, P.; Blanchard, C.; Astier, J.; Klinguer, A.; Wendehenne, D.; Jeandroz, S.; Rosnoblet, C. Reliable reference genes and abiotic stress marker genes in Klebsormidium nitens. Sci. Rep. 2022, 12, 18988. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Gene Symbol | Primer Sequences (5′ to 3′) | Tm (°C) | Length (bp) | Efficiency (%) | R2 |
---|---|---|---|---|---|---|
Ribosomal protein S 30 | RPS30 | F:AACGCCAAAGGTTGAGAAGC | 54 | 141 | 95.6 | 0.991 |
R:TATGGGTTAGGGTTGGCGTT | ||||||
Actin-related protein | ACTR | F:GCAAAACACAGCCACCACT R: TGCCAAACCTAACAATCCGA | 54 | 138 | 99.4 | 0.993 |
18S ribosomal RNA | 18S rRNA | F:CCAGTGCAAAATGAAACGCC R:CATCGGGTGTGGATCAGGAT | 55 | 165 | 99.7 | 1.000 |
Actin | ACT | F: CTACTGTACCACTCCGTCGC R:GGTCATTGGAAGTGGAGGCA | 55 | 300 | 102.1 | 0.996 |
Ribosomal protein L 18 | RPL18 | F:ATGAAGAAGCCAGGACGTA R:CTTGGATCAGCACGGTCTTG | 55 | 214 | 97.6 | 0.995 |
Glyceraldehyde-3-phosphate dehydrogenase | GAPDH | F:GCGATCAAGGCTAAGGTCAA | 55 | 169 | 99.2 | 0.990 |
R:ACGAGATGAGCTTGACGAAC | ||||||
28S ribosomal RNA | 28S rRNA | F: GCCTCCCATCTGAAGACCTT R:GGTCGTGTGGTATTGAAGGC | 55 | 179 | 101.2 | 1.000 |
B-tubulin | TUB | F:TACTGGATTCAAGGTCGGCA R: ACCTTCCTCCATACCTTCGC | 56 | 205 | 98.8 | 0.996 |
Heat shock protein 90 | HSP90 | F: AGCTCTCTGAACTTCTGCGT R: GAAACCACGCTTCCTCACTC | 57 | 176 | 99.1 | 0.997 |
Condition | Rank | ∆Ct | geNorm | NormFinder | BestKeeper | ||||
---|---|---|---|---|---|---|---|---|---|
Sex | 1 | ACT | 0.542 | ACT/ACTR | 0.139 | ACT | 0.069 | GAPDH | 0.160 |
2 | RPS30 | 0.556 | - | - | ACTR | 0.075 | ACTR | 0.815 | |
3 | ACTR | 0.576 | RPS30 | 0.206 | 18S rRNA | 0.087 | 28S rRNA | 0.918 | |
4 | 18S rRNA | 0.614 | 28S rRNA | 0.274 | RPS30 | 0.093 | ACT | 0.933 | |
5 | 28S rRNA | 0.662 | 18S rRNA | 0.329 | 28S rRNA | 0.334 | 18S rRNA | 1.017 | |
6 | RPL18 | 0.849 | RPL18 | 0.476 | RPL18 | 0.718 | RPS30 | 1.055 | |
7 | TUB | 0.999 | TUB | 0.579 | TUB | 0.941 | RPL18 | 1.557 | |
8 | GAPDH | 1.325 | GAPDH | 0.765 | GAPDH | 1.293 | TUB | 1.767 | |
Somite | 1 | 28S rRNA | 0.540 | RPS30/28S rRNA | 0.206 | RPL18 | 0.072 | GAPDH | 0.366 |
2 | RPL18 | 0.575 | - | - | 28S rRNA | 0.217 | ACT | 0.385 | |
3 | RPS30 | 0.590 | ACTR | 0.251 | RPS30 | 0.364 | RPL18 | 0.639 | |
4 | ACTR | 0.633 | 18S rRNA | 0.291 | TUB | 0.450 | 28S rRNA | 0.757 | |
5 | 18S rRNA | 0.699 | RPL18 | 0.341 | ACTR | 0.468 | TUB | 0.773 | |
6 | TUB | 0.710 | TUB | 0.440 | ACT | 0.514 | RPS30 | 0.850 | |
7 | ACT | 0.778 | ACT | 0.533 | 18S rRNA | 0.557 | ACTR | 0.924 | |
8 | GAPDH | 1.328 | GAPDH | 0.732 | GAPDH | 1.283 | 18S rRNA | 0.968 | |
1 | 28S rRNA | 0.440 | ACTR/18S rRNA | 0.141 | RPS30 | 0.065 | ACT | 0.227 | |
2 | RPS30 | 0.462 | - | - | 28S rRNA | 0.097 | GAPDH | 0.432 | |
Temperature | 3 | ACTR | 0.483 | 28S rRNA | 0.221 | ACTR | 0.277 | 28S rRNA | 0.476 |
4 | 18S rRNA | 0.496 | RPS30 | 0.277 | 18S rRNA | 0.295 | RPS30 | 0.519 | |
5 | GAPDH | 0.542 | ACT | 0.348 | GAPDH | 0.297 | TUB | 0.530 | |
6 | TUB | 0.623 | GAPDH | 0.394 | TUB | 0.440 | ACTR | 0.532 | |
7 | ACT | 0.648 | TUB | 0.448 | ACT | 0.564 | 18S rRNA | 0.535 | |
8 | RPL18 | 1.009 | RPL18 | 0.588 | RPL18 | 0.965 | RPL18 | 1.139 | |
Diet | 1 | ACT | 0.631 | ACT/GAPDH | 0.322 | ACT | 0.317 | ACT | 0.267 |
2 | GAPDH | 0.662 | - | - | RPL18 | 0.356 | ACTR | 0.276 | |
3 | RPL18 | 0.662 | RPL18 | 0.364 | GAPDH | 0.395 | 28S rRNA | 0.277 | |
4 | RPS30 | 0.709 | RPS30 | 0.412 | RPS30 | 0.413 | GAPDH | 0.294 | |
5 | ACTR | 0.734 | ACTR | 0.508 | 28S rRNA | 0.439 | RPL18 | 0.318 | |
6 | 28S rRNA | 0.755 | 28S rRNA | 0.555 | ACTR | 0.459 | 18S rRNA | 0.319 | |
7 | 18S rRNA | 0.811 | 18S rRNA | 0.596 | 18S rRNA | 0.597 | RPS30 | 0.373 | |
8 | TUB | 1.390 | TUB | 0.794 | TUB | 1.326 | TUB | 0.719 | |
Pesticide | 1 | 28S rRNA | 0.765 | GAPDH/18S rRNA | 0.235 | GAPDH | 0.118 | RPL18 | 0.339 |
2 | GAPDH | 0.768 | - | - | 28S rRNA | 0.135 | ACTR | 0.460 | |
3 | RPL18 | 0.814 | 28S rRNA | 0.320 | RPL18 | 0.136 | 28S rRNA | 0.460 | |
4 | 18S rRNA | 0.838 | RPL18 | 0.373 | 18S rRNA | 0.306 | RPS30 | 0.607 | |
5 | TUB | 0.962 | TUB | 0.457 | TUB | 0.603 | GAPDH | 0.673 | |
6 | ACTR | 1.301 | ACTR | 0.727 | ACTR | 1.189 | 18S rRNA | 0.813 | |
7 | RPS30 | 1.452 | RPS30 | 0.877 | RPS30 | 1.401 | TUB | 0.976 | |
8 | ACT | 1.641 | ACT | 1.068 | ACT | 1.604 | ACT | 1.752 |
Gene | |||||||||
---|---|---|---|---|---|---|---|---|---|
Conditions | RPS30 | ACTR | ACT | RPL18 | GAPDH | 18S rRNA | 28S rRNA | TUB | |
Sex | SD (CP) | 1.06 | 0.81 | 0.93 | 1.56 | 0.16 | 1.02 | 0.92 | 1.77 |
CV (CP) % | 4.19 | 2.82 | 3.78 | 5.75 | 0.73 | 3.76 | 3.41 | 7.61 | |
CC (r) | 0.991 | 0.995 | 0.991 | 0.991 | 0.001 | 0.981 | 0.942 | 0.999 | |
P | 0.001 | 0.001 | 0.001 | 0.001 | 0.904 | 0.001 | 0.005 | 0.001 | |
Somite | SD (CP) | 0.85 | 0.92 | 0.39 | 0.64 | 0.37 | 0.97 | 0.76 | 0.77 |
CV (CP) % | 3.83 | 3.61 | 1.68 | 2.50 | 1.69 | 3.99 | 3.05 | 3.48 | |
CC (r) | 0.997 | 0.965 | 0.720 | 0.964 | 0.001 | 0.939 | 0.988 | 0.877 | |
P | 0.001 | 0.001 | 0.029 | 0.001 | 0.001 | 0.001 | 0.001 | 0.002 | |
Temperature | SD (CP) | 0.52 | 0.53 | 0.23 | 1.14 | 0.43 | 0.54 | 0.48 | 0.53 |
CV (CP) % | 2.34 | 2.05 | 1.07 | 4.99 | 2.12 | 2.24 | 1.93 | 2.71 | |
CC (r) | 0.959 | 0.878 | 0.525 | 0.964 | 0.876 | 0.87 | 0.951 | 0.857 | |
P | 0.001 | 0.002 | 0.147 | 0.001 | 0.002 | 0.002 | 0.001 | 0.003 | |
Diet | SD (CP) | 0.37 | 0.28 | 0.27 | 0.32 | 0.29 | 0.32 | 0.28 | 0.72 |
CV (CP) % | 1.62 | 1.02 | 1.19 | 1.33 | 1.38 | 1.29 | 1.09 | 3.44 | |
CC (r) | 0.685 | 0.001 | 0.232 | 0.442 | 0.097 | 0.174 | 0.178 | 0.659 | |
P | 0.014 | 0.412 | 0.468 | 0.150 | 0.764 | 0.588 | 0.580 | 0.020 | |
Pesticide | SD (CP) | 0.61 | 0.46 | 1.75 | 0.34 | 0.67 | 0.81 | 0.46 | 0.98 |
CV (CP) % | 2.58 | 1.68 | 7.23 | 1.38 | 2.99 | 3.12 | 1.76 | 4.60 | |
CC (r) | 0.001 | 0.001 | 0.989 | 0.922 | 0.986 | 0.965 | 0.988 | 0.979 | |
P | 0.002 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 | 0.001 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, Y.; Zhou, J.; Qiu, Z.; Hu, P.; Chen, X.; Yang, Z. Identification and Validation of Reference Genes for Expression Analysis Using RT-qPCR in Leptocybe invasa Fisher and La Salle (Hymenoptera: Eulophidae). Insects 2023, 14, 456. https://doi.org/10.3390/insects14050456
Liu Y, Zhou J, Qiu Z, Hu P, Chen X, Yang Z. Identification and Validation of Reference Genes for Expression Analysis Using RT-qPCR in Leptocybe invasa Fisher and La Salle (Hymenoptera: Eulophidae). Insects. 2023; 14(5):456. https://doi.org/10.3390/insects14050456
Chicago/Turabian StyleLiu, Ya, Jing Zhou, Zhisong Qiu, Ping Hu, Xiao Chen, and Zhende Yang. 2023. "Identification and Validation of Reference Genes for Expression Analysis Using RT-qPCR in Leptocybe invasa Fisher and La Salle (Hymenoptera: Eulophidae)" Insects 14, no. 5: 456. https://doi.org/10.3390/insects14050456