Molecular Detection of Feline Coronavirus Based on Recombinase Polymerase Amplification Assay
Abstract
:1. Introduction
2. Results
2.1. Selection of RPA Primers and Probe
2.2. Analytical Sensitivity and Specifity
2.3. Clinical Samples
2.4. Sequencing
3. Discussion
4. Materials and Methods
4.1. Clinical Samples and Ethical Statement
4.2. Molecular RNA Standard
4.3. Real-Time RT-PCR
4.4. Real-Time RT-RPA
4.5. Analytical Sensitivity and Specificity
4.6. RT-PCR and Sequencing
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- de Groot, R. Coronaviridae. Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses; King, A.M.Q., Adams, M.J., Carstens, E.B., Lefkowitz, E.J., Eds.; Coronaviridae; Elsevier Academic Press: London, UK, 2011; pp. 806–828. [Google Scholar]
- Pedersen, N.C.; Boyle, J.F.; Floyd, K. Infection studies in kittens, using feline infectious peritonitis virus propagated in cell culture. Am. J. Veter. Res. 1981, 42, 363–367. [Google Scholar]
- Pedersen, N.C.; Boyle, J.F.; Floyd, K.; Fudge, A.; Barker, J. An enteric coronavirus infection of cats and its relationship to feline infectious peritonitis. Am. J. Veter. Res. 1981, 42, 368–377. [Google Scholar]
- Holzworth, J. Some important disorders of cats. Cornell Vet. 1963, 53, 157–160. [Google Scholar] [PubMed]
- Klein-Richers, U.; Hartmann, K.; Hofmann-Lehmann, R.; Unterer, S.; Bergmann, M.; Rieger, A.; Leutenegger, C.; Pantchev, N.; Balzer, J.; Felten, S. Prevalence of Feline Coronavirus Shedding in German Catteries and Associated Risk Factors. Viruses 2020, 12, 1000. [Google Scholar] [CrossRef] [PubMed]
- Hohdatsu, T.; Okada, S.; Koyama, H. Characterization of monoclonal antibodies against feline infectious peritonitis virus type II and antigenic relationship between feline, porcine, and canine coronaviruses. Arch. Virol. 1991, 117, 85–95. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Benetka, V.; Kübber-Heiss, A.; Kolodziejek, J.; Nowotny, N.; Hofmann-Parisot, M.; Möstl, K. Prevalence of feline coronavirus types I and II in cats with histopathologically verified feline infectious peritonitis. Veter. Microbiol. 2004, 99, 31–42. [Google Scholar] [CrossRef] [PubMed]
- Hohdatsu, T.; Okada, S.; Ishizuka, Y.; Yamada, H.; Koyama, H. The Prevalence of Types I and II Feline Coronavirus Infections in Cats. J. Veter. Med Sci. 1992, 54, 557–562. [Google Scholar] [CrossRef] [Green Version]
- Addie, D.D.; Schaap, I.; Nicolson, L.; Jarrett, O. Persistence and transmission of natural type I feline coronavirus infection. J. Gen. Virol. 2003, 84, 2735–2744. [Google Scholar] [CrossRef]
- Rottier, P.J. The molecular dynamics of feline coronaviruses. Veter. Microbiol. 1999, 69, 117–125. [Google Scholar] [CrossRef]
- Pedersen, N. An Overview of Feline Enteric Coronavirus and Infectious Peritonitis Virus Infections. Feline Pract. 1995, 23, 7–20. [Google Scholar]
- Addie, D.D.; Paltrinieri, S.; Pedersen, N.C. Secong international feline coronavirus/feline infectious peritonitis symposium Recommendations from workshops of the second international feline coronavirus/feline infectious peritonitis symposium. J. Feline Med. Surg. 2004, 6, 125–130. [Google Scholar] [CrossRef] [Green Version]
- Cave, T.A.; Golder, M.C.; Simpson, J.; Addie, D.D. Risk factors for feline coronavirus seropositivity in cats relinquished to a UK rescue charity. J. Feline Med. Surg. 2004, 6, 53–58. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pedersen, N.; Sato, R.; Foley, J.; Poland, A. Common virus infections in cats, before and after being placed in shelters, with emphasis on feline enteric coronavirus. J. Feline Med. Surg. 2004, 6, 83–88. [Google Scholar] [CrossRef] [Green Version]
- Pedersen, N.C. A review of feline infectious peritonitis virus infection: 1963–2008. J. Feline Med. Surg. 2009, 11, 225–258. [Google Scholar] [CrossRef]
- Addie, D.D.; Jarrett, O. Use of a reverse-transcriptase polymerase chain reaction for monitoring the shedding of feline coronavirus by healthy cats. Veter. Rec. 2001, 148, 649–653. [Google Scholar] [CrossRef]
- Foley, J.E.; Poland, A.; Carlson, J.; Pedersen, N.C. Patterns of feline coronavirus infection and fecal shedding from cats in multiple-cat environments. J. Am. Vet. Med Assoc. 1997, 210, 1307–1312. [Google Scholar] [PubMed]
- Vogel, L.; Van Der Lubben, M.; Lintelo, E.G.T.; Bekker, C.P.; Geerts, T.; Schuijff, L.S.; Grinwis, G.; Egberink, H.; Rottier, P.J. Pathogenic characteristics of persistent feline enteric coronavirus infection in cats. Veter. Res. 2010, 41, 71. [Google Scholar] [CrossRef] [Green Version]
- Pedersen, N.C.; Allen, C.E.; Lyons, L. Pathogenesis of feline enteric coronavirus infection. J. Feline Med. Surg. 2008, 10, 529–541. [Google Scholar] [CrossRef] [Green Version]
- Chang, H.-W.; Egberink, H.; Halpin, R.; Spiro, D.J.; Rottier, P.J. Spike Protein Fusion Peptide and Feline Coronavirus Virulence. Emerg. Infect. Dis. 2012, 18, 1089–1095. [Google Scholar] [CrossRef]
- Addie, D.D.; Jarrett, O. A study of naturally occurring feline coronavirus infections in kittens. Veter. Rec. 1992, 130, 133–137. [Google Scholar] [CrossRef] [PubMed]
- Ritz, S.; Egberink, H.; Hartmann, K. Effect of feline interferon-omega on the survival time and quality of life of cats with feline infectious peritonitis. J. Vet. Intern. Med. 2007, 21, 1193–1197. [Google Scholar] [CrossRef]
- Dickinson, P.J.; Bannasch, M.; Thomasy, S.M.; Murthy, V.; Vernau, K.M.; Liepnieks, M.; Montgomery, E.; Knickelbein, K.E.; Murphy, B.; Pedersen, N.C. Antiviral treatment using the adenosine nucleoside analogue GS-441524 in cats with clinically diagnosed neurological feline infectious peritonitis. J. Veter. Intern. Med. 2020, 34, 1587–1593. [Google Scholar] [CrossRef]
- Addie, D.; Covell-Ritchie, J.; Jarrett, O.; Fosbery, M. Rapid Resolution of Non-Effusive Feline Infectious Peritonitis Uveitis with an Oral Adenosine Nucleoside Analogue and Feline Interferon Omega. Viruses 2020, 12, 1216. [Google Scholar] [CrossRef]
- Doenges, S.J.; Weber, K.; Dorsch, R.; Fux, R.; Hartmann, K. Comparison of real-time reverse transcriptase polymerase chain reaction of peripheral blood mononuclear cells, serum and cell-free body cavity effusion for the diagnosis of feline infectious peritonitis. J. Feline Med. Surg. 2016, 19, 344–350. [Google Scholar] [CrossRef]
- Dye, C.; Helps, C.R.; Siddell, S.G. Evaluation of real-time RT-PCR for the quantification of FCoV shedding in the faeces of domestic cats. J. Feline Med. Surg. 2008, 10, 167–174. [Google Scholar] [CrossRef] [Green Version]
- Gut, M.; Leutenegger, C.M.; Huder, J.B.; Pedersen, N.C.; Lutz, H. One-tube fluorogenic reverse transcription-polymerase chain reaction for the quantitation of feline coronaviruses. J. Virol. Methods. 1999, 77, 37–46. [Google Scholar] [CrossRef]
- Herrewegh, A.A. Detection of feline coronavirus RNA in feces, tissues, and body fluids of naturally infected cats by reverse transcriptase PCR. J. Clin. Microbiol. 1995, 33, 684–689. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Barker, E.N.; Stranieri, A.; Helps, C.R.; Porter, E.L.; Davidson, A.D.; Day, M.J.; Knowles, T.; Kipar, A.; Tasker, S. Limitations of using feline coronavirus spike protein gene mutations to diagnose feline infectious peritonitis. Veter. Res. 2017, 48, 1–14. [Google Scholar] [CrossRef] [Green Version]
- Günther, S.; Felten, S.; Wess, G.; Hartmann, K.; Weber, K. Detection of feline Coronavirus in effusions of cats with and without feline infectious peritonitis using loop-mediated isothermal amplification. J. Virol. Methods 2018, 256, 32–36. [Google Scholar] [CrossRef] [PubMed]
- Notomi, T.; Okayama, H.; Masubuchai, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28, E63. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, J.; Macdonald, J.; von Stetten, F. Review: A comprehensive summary of a decade development of the recombinase polymerase amplification. Anal. 2019, 144, 31–67. [Google Scholar] [CrossRef] [Green Version]
- El Wahed, A.A.; El-Deeb, A.; El-Tholoth, M.; El Kader, H.A.; Ahmed, A.; Hassan, S.; Hoffmann, B.; Haas, B.; Shalaby, M.A.; Hufert, F.T.; et al. A Portable Reverse Transcription Recombinase Polymerase Amplification Assay for Rapid Detection of Foot-and-Mouth Disease Virus. PLoS ONE. 2013, 8, e71642. [Google Scholar] [CrossRef] [Green Version]
- El Wahed, A.A.; Patel, P.; Heidenreich, D.; Hufert, F.T.; Weidmann, M. Reverse Transcription Recombinase Polymerase Amplification Assay for the Detection of Middle East Respiratory Syndrome Coronavirus. PLoS Curr. 2013, 5, 5. [Google Scholar] [CrossRef]
- Euler, M.; Wang, Y.; Heidenreich, D.; Patel, P.; Strohmeier, O.; Hakenberg, S.; Niedrig, M.; Hufert, F.T.; Weidmann, M. Development of a Panel of Recombinase Polymerase Amplification Assays for Detection of Biothreat Agents. J. Clin. Microbiol. 2013, 51, 1110–1117. [Google Scholar] [CrossRef] [Green Version]
- Euler, M.; Wang, Y.; Nentwich, O.; Piepenburg, O.; Hufert, F.T.; Weidmann, M. Recombinase polymerase amplification assay for rapid detection of Rift Valley fever virus. J. Clin. Virol. 2012, 54, 308–312. [Google Scholar] [CrossRef]
- Euler, M.; Wang, Y.; Otto, P.; Tomaso, H.; Escudero, R.; Anda, P.; Hufert, F.T.; Weidmann, M. Recombinase Polymerase Amplification Assay for Rapid Detection of Francisella tularensis. J. Clin. Microbiol. 2012, 50, 2234–2238. [Google Scholar] [CrossRef] [Green Version]
- El Wahed, A.A.; Weidmann, M.; Hufert, F.T. Diagnostics-in-a-Suitcase: Development of a portable and rapid assay for the detection of the emerging avian influenza A (H7N9) virus. J. Clin. Virol. 2015, 69, 16–21. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Holland, J.; Spindler, K.; Horodyski, F.; Grabau, E.; Nichol, S.; Vandepol, S. Rapid evolution of RNA genomes. Science. 1982, 215, 1577–1585. [Google Scholar] [CrossRef]
- Vennema, H.; Heijnen, L.; Rottier, P.J.; Horzinek, M.C.; Spaan, W.J. A novel glycoprotein of feline infectious peritonitis coronavirus contains a KDEL-like endoplasmic reticulum retention signal. J. Virol. 1992, 66, 4951–4956. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dunbar, D.; Kwok, W.; Graham, E.; Armitage, A.; Irvine, R.; Johnston, P.; McDonald, M.; Montgomery, D.; Nicolson, L.; Robertson, E.; et al. Diagnosis of non-effusive feline infectious peritonitis by reverse transcriptase quantitative PCR from mesenteric lymph node fine-needle aspirates. J. Feline Med. Surg. 2019, 21, 910–921. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kipar, A.; Baptiste, K.; Barth, A.; Reinacher, M. Natural FCoV infection: Cats with FIP exhibit significantly higher viral loads than healthy infected cats. J. Feline Med. Surg. 2006, 8, 69–72. [Google Scholar] [CrossRef] [PubMed]
- TwistDx™. TwistAmp® DNA Amplification Kits Assay Design Manual. Available online: https://www.twistdx.co.uk (accessed on 4 August 2021).
- El Wahed, A.A. Suitcase Lab for rapid detection of SARS-CoV-2 based on recombinase polymerase amplification assay. Anal. Chem. 2021, 93, 2627–2634. [Google Scholar] [CrossRef] [PubMed]
- Horsburgh, B.C.; Brierley, I.; Brown, T.D.K. Analysis of a 9.6 kb sequence from the 3′ end of canine coronavirus genomic RNA. J. Gen. Virol. 1992, 73, 2849–2862. [Google Scholar] [CrossRef] [PubMed]
- Vennema, H.; Rossen, J.; Wesseling, J.; Horzinek, M.; Rottier, P. Genomic organization and expression of the 3′ end of the canine and feline enteric coronaviruses. Virology 1992, 191, 134–140. [Google Scholar] [CrossRef]
- De Groot, R.J.; Ter Haar, R.J.; Horzinek, M.C.; Van Der Zeijst, B.A.M. Intracellular RNAs of the Feline Infectious Peritonitis Coronavirus Strain 79-1146. J. Gen. Virol. 1987, 68, 995–1002. [Google Scholar] [CrossRef] [PubMed]
- E Barlough, J.; A Stoddart, C.; Sorresso, G.P.; Jacobson, R.H.; Scott, F.W. Experimental inoculation of cats with canine coronavirus and subsequent challenge with feline infectious peritonitis virus. Lab. Anim. Sci. 1984, 34, 592–597. [Google Scholar]
- Graham, R.L.; Baric, R.S. Recombination, Reservoirs, and the Modular Spike: Mechanisms of Coronavirus Cross-Species Transmission. J. Virol. 2010, 84, 3134–3146. [Google Scholar] [CrossRef] [Green Version]
- Bonney, L.C.; Watson, R.J.; Afrough, B.; Mullojonova, M.; Dzhuraeva, V.; Tishkova, F.; Hewson, R. A recombinase polymerase amplification assay for rapid detection of Crimean-Congo Haemorrhagic fever Virus infection. PLOS Negl. Trop. Dis. 2017, 11, e0006013. [Google Scholar] [CrossRef] [Green Version]
- El Wahed, A.A.; Patel, P.; Faye, O.; Thaloengsok, S.; Heidenreich, D.; Matangkasombut, P.; Manopwisedjaroen, K.; Sakuntabhai, A.; Sall, A.A.; Hufert, F.T.; et al. Recombinase Polymerase Amplification Assay for Rapid Diagnostics of Dengue Infection. PLoS ONE. 2015, 10, e0129682. [Google Scholar] [CrossRef]
- Stranieri, A.; Lauzi, S.; Giordano, A.; Paltrinieri, S. Reverse transcriptase loop-mediated isothermal amplification for the detection of feline coronavirus. J. Virol. Methods 2017, 243, 105–108. [Google Scholar] [CrossRef]
- tamaVet GmbH. tamaVet® Schnelltests für Katzen—Coronavirus. Available online: https://www.tamavet-diagnostics.com/produkte/schnelltests/katze (accessed on 4 August 2021).
- Fassisi GmbH. Fassisi ParCo. Available online: https://www.fassisi.de/produkte/kleintiere/hunde-katzen-parco/ (accessed on 4 August 2021).
- Shirato, K.; Nao, N.; Matsuyama, S.; Kageyama, T.; Kazuya, S. Ultra-Rapid Real-Time RT-PCR Method for Detecting Middle East Respiratory Syndrome Coronavirus Using a Mobile PCR Device, PCR1100. Jpn. J. Infect. Dis. 2020, 73, 181–186. [Google Scholar] [CrossRef] [Green Version]
- Kim, B.; Kim, J.; Kim, S.; Kim, M.; Truong, A.T.; Cho, K.; Yoon, B. Detection of chronic bee paralysis virus using ultra-rapid PCR and nested ultra-rapid PCR. J. Apic. Res. 2018, 58, 133–140. [Google Scholar] [CrossRef]
- Hilscher, C.; Vahrson, W.; Dittmer, D.P. Faster quantitative real-time PCR protocols may lose sensitivity and show increased variability. Nucleic Acids Res. 2005, 33, e182. [Google Scholar] [CrossRef] [Green Version]
- Gregorini, M.; Mikutis, G.; Grass, R.N.; Stark, W.J. Small-Size Polymerase Chain Reaction Device with Improved Heat Transfer and Combined Feedforward/Feedback Control Strategy. Ind. Eng. Chem. Res. 2019, 58, 9665–9674. [Google Scholar] [CrossRef]
- Zhou, L.; Peng, N.; Hu, F. Temperature-uniformity study on transverse flux induction heating applied to rapid PCR. In IOP Conference Series: Earth and Environmental Science; IOP Publishing: Bristol, UK, 2019; Volume 242, p. 032009. [Google Scholar]
- Shalaby, M.A.; El-Deeb, A.; El-Tholoth, M.; Hoffmann, D.; Czerny, C.-P.; Hufert, F.T.; Weidmann, M.; El Wahed, A.A. Recombinase polymerase amplification assay for rapid detection of lumpy skin disease virus. BMC Veter. Res. 2016, 12, 1–6. [Google Scholar] [CrossRef] [Green Version]
- Hu, X.; Xiao, L.; Cong, X.; Zhu, Y.; Huang, B.; Cong, F. Development of a recombinase polymerase amplification fluorescence assay to detect feline coronavirus. Mol. Cell. Probes. 2020, 54, 101669. [Google Scholar] [CrossRef]
- Liljander, A.; Yu, M.; O’Brien, E.; Heller, M.; Nepper, J.; Weibel, D.B.; Gluecks, I.; Younan, M.; Frey, J.; Falquet, L.; et al. Field-Applicable Recombinase Polymerase Amplification Assay for Rapid Detection of Mycoplasma capricolum subsp. capripneumoniae. J. Clin. Microbiol. 2015, 53, 2810–2815. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Daher, R.K.; Stewart, G.; Boissinot, M.; Bergeron, M.G. Recombinase Polymerase Amplification for Diagnostic Applications. Clin. Chem. 2016, 62, 947–958. [Google Scholar] [CrossRef] [PubMed]
- R.C. Team. R: A Language and Environment for Statistical Computing. 2013. Available online: http://r.meteo.uni.wroc.pl/web/packages/dplR/vignettes/intro-dplR.pdf (accessed on 4 November 2020).
- Hadley, W. Ggplot2: Elegrant Graphics for Data Analysis; Springer: Berlin/Heidelberg, Germany, 2016. [Google Scholar]
- Lin, C.-N.; Su, B.-L.; Huang, H.-P.; Lee, J.-J.; Hsieh, M.-W.; Chueh, L.-L. Field strain feline coronaviruses with small deletions in ORF7b associated with both enteric infection and feline infectious peritonitis. J. Feline Med. Surg. 2009, 11, 413–419. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Virus | Real-Time RT-PCR (Ct) | RT-RPA (TT) |
---|---|---|
Feline infectious peritonitis virus ++++ | 13.42 | 120 |
Canine coronavirus strain 1-71 RVB + | 15.97 | 160 |
Transmissible gastroenteritis virus strain 70 RVB + | 18.38 | 180 |
Transmissible gastroenteritis virus strain 545 RVB + | No Ct | Neg |
Feline calicivirus ++++ | No Ct | Neg |
Feline herpesvirus ++++ | No Ct | Neg |
Feline parvovirus ++++ | No Ct | Neg |
Canine parvovirus ++++ | No Ct | Neg |
Canine herpesvirus ++++ | No Ct | Neg |
Canine minute virus ++++ | No Ct | Neg |
Canine adenovirus ++++ | No Ct | Neg |
Canine distemper virus ++++ | No Ct | Neg |
Bovine coronavirus V321.2 + | No Ct | Neg |
Severe acute respiratory syndrome coronavirus +++ | No Ct | Neg |
Severe acute respiratory syndrome coronavirus 2 +++ | No Ct | Neg |
Human coronavirus 229E ++ | No Ct | Neg |
Human coronavirus NL63 ++ | No Ct | Neg |
Human coronavirus OC43 ++ | No Ct | Neg |
Middle East respiratory syndrome coronavirus ++ | No Ct | Neg |
RT-RPA | Real-Time RT-PCR | |
---|---|---|
Sensitivity (n = 22) | 90.9% | 100% |
Specificity (n = 17) | 100% | 100% |
Names | Sequences (5′-3′) |
---|---|
Forward primer 1 (FP1) | TCATCGCGCTGCCTACTCTTGTACAGAATGGTAAG |
Forward primer 2 (FP2) | CCGATGTCTAAAACTTGTCTTTCCGAGGAATTAC |
Forward primer 3 (FP3) | ACTTGAAGCAATTCAGAAGCAAGAAGGTCTTCGAC |
Reverse primer 1 (RP1) | AATCTAGCATTGCCAAATCAAATCTAAACTTCCTA |
Reverse primer 2 (RP 2) | GTCATAGCGGATCTTTAAACTTCTCTAAATTACTA |
Reverse primer 3 (RP 3) | ACTAGATCCAGACGTTAGCTCTTCCATTGTTGGCTC |
ExoProbe (P) | ATCTAAACTTCCTAA (BHQ1-dT, Tetrahydrofuran and FAM-dT) GCAATAGGGTTGCTTGTACCTCCTATTACACG--Phosphate |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kobialka, R.M.; Ceruti, A.; Bergmann, M.; Hartmann, K.; Truyen, U.; Abd El Wahed, A. Molecular Detection of Feline Coronavirus Based on Recombinase Polymerase Amplification Assay. Pathogens 2021, 10, 1237. https://doi.org/10.3390/pathogens10101237
Kobialka RM, Ceruti A, Bergmann M, Hartmann K, Truyen U, Abd El Wahed A. Molecular Detection of Feline Coronavirus Based on Recombinase Polymerase Amplification Assay. Pathogens. 2021; 10(10):1237. https://doi.org/10.3390/pathogens10101237
Chicago/Turabian StyleKobialka, Rea Maja, Arianna Ceruti, Michelle Bergmann, Katrin Hartmann, Uwe Truyen, and Ahmed Abd El Wahed. 2021. "Molecular Detection of Feline Coronavirus Based on Recombinase Polymerase Amplification Assay" Pathogens 10, no. 10: 1237. https://doi.org/10.3390/pathogens10101237