Qualitative and Quantitative Detection of Potentially Virulent Vibrio parahaemolyticus in Drinking Water and Commonly Consumed Aquatic Products by Loop-Mediated Isothermal Amplification

Abstract

Vibrio parahaemolyticus can cause acute gastroenteritis, wound infection, and septicemia in humans. In this study, a simple, specific, and user-friendly diagnostic tool was developed for the first time for the qualitative and quantitative detection of toxins and infection process-associated genes opaR, vpadF, tlh, and ureC in V. parahaemolyticus using the loop-mediated isothermal amplification (LAMP) technique. Three pairs of specific inner, outer, and loop primers were designed for targeting each of these genes, and the results showed no cross-reaction with the other common Vibrios and non-Vibrios pathogenic bacteria. Positive results in the one-step LAMP reaction (at 65 °C for 45 min) were identified by a change to light green and the emission of bright green fluorescence under visible light and UV light (302 nm), respectively. The lowest limit of detection (LOD) for the target genes ranged from 1.46 × 10⁻⁵ to 1.85 × 10⁻³ ng/reaction (25 µL) for the genomic DNA, and from 1.03 × 10⁻² to 1.73 × 10⁰ CFU/reaction (25 µL) for the cell culture of V. parahaemolyticus. The usefulness of the developed method was demonstrated by the fact that the bacterium could be detected in water from various sources and commonly consumed aquatic product samples. The presence of opaR and tlh genes in the Parabramis pekinensis intestine indicated a risk of potentially virulent V. parahaemolyticus in the fish.

1. Introduction

V. parahaemolyticus is a Gram-negative bacterium that can cause acute gastroenteritis, wound infection, and septicemia in humans [1]. The bacterium inhabits estuarine and marine environments worldwide, and is also frequently detected in aquatic products [2]. Clinical V. parahaemolyticus isolates produce two major toxins, thermostable direct hemolysin (TDH) and TDH-related hemolysins (TRH), both of which cause hemolysis and cytotoxicity of the host cells [3]. Their encoding genes trh and tdh, sharing approximately 70% homology, are molecular markers for the diagnosis of virulent V. parahaemolyticus isolates [4].

Previous studies have also revealed very important virulence-associated genes in V. parahaemolyticus; for example, an ureC gene encodes urease subunit alpha, which is known to be associated with enterotoxicity, a reasonably good clinical diagnostic marker for trh-positive V. parahaemolyticus isolates [5]. A tlh gene encodes a thermolabile hemolysin (TLH) that is present in pathogenic and non-pathogenic V. parahaemolyticus isolates [6]. The TLH is one of the phospholipases that can hydrolyze glycerophospholipids, the major component of the eukaryotic cell membrane, and disrupt the host cells. Therefore, it is a key virulence factor in many pathogenic bacteria [7]. Pathogen adhesion subverts the host actin cytoskeleton and triggers cellular signaling pathways to facilitate subsequent pathogen invasion [8]; for example, a vpadF gene encodes an adhesion factor that enables V. parahaemolyticus to interact with type I collagen and mediate a type III secretion system on chromosome 2 (T3SS2)-dependent host cell invasion [9]. Additionally, an opaR gene encodes a master quorum sensing (QS) regulator of V. parahaemolyticus, and regulates the transcription of many genes involved in virulence, motility, and biofilm formation [10]. It is regarded as an attractive target to combat bacterial pathogenicity, with the potential to be used as a vaccine candidate [8]. Thus, the diagnosis of these virulence-associated genes in V. parahaemolyticus is imperative for food safety control and human health.

Many methods have been developed to detect pathogenic bacteria, based on microbiology, biochemistry, immunology, spectroscopy, and molecular biology technology [11]. These methods are usually laborious, time consuming, or require costly and bulky equipment [12]. Conversely, the loop-mediated isothermal amplification (LAMP) technique, originally developed by Notomi et al. [13,14], can amplify target genes at a constant temperature with a one-step reaction, exclusion of a thermal cycler that is needed by the standard polymerase chain reaction (PCR), and reverse transcription-PCR (RT-PCR) assays [15]. Successful amplification in LAMP reactions can be directly visualized via a variety of visual indicators, such as hydroxynaphthol blue, phenol red dye, hydroxy naphthol blue and leuco crystal violet, and the nucleic acid dyes SYBR Green I and SYTO 9 [16,17,18,19,20]. Recently, a MnCl₂–calcein dye has been applied in LAMP to circumvent the instability problem of other dyes [21]. Calcein can combine with divalent metal ions (such as Ca²⁺ and Mg²⁺) to form complexes, and produces strong fluorescence [18]. In the LAMP reaction system, if no target gene amplification occurs, calcein binds with Mn²⁺ to cause fluorescence quenching, and the reaction is orange–yellow. In contrast, when the target sequence is amplified, the Mn²⁺ bound to calcein is deprived by the newly generated pyrophosphate ions, and calcein binds to the residual Mg²⁺ in the reaction system. Consequently, the fluorescence is enhanced and the reaction is green [22]. LAMP technology has been applied in the detection of human infectious diseases, such as severe acute respiratory syndrome (SARS) [23], avian influenza virus (AIV) [24], hemagglutinin 1 neuraminidase 1 (H1N1) [25], coronavirus disease 2019 (COVID-19) [26], as well as common foodborne pathogenic bacteria, e.g., Vibrio cholerae [27,28], Staphylococcus aureus [29], and Salmonella species [30]. Studies have been conducted to test the toxin-associated genes of V. parahaemolyticus by LAMP, such as tdh, trh, toxR, and groEL [3,31,32,33]; nevertheless, current literature in this field for the opaR, tlh, vpadF and ureC genes is rare.

In our previous studies, the LAMP reaction system was well established in our research group; for example, an sssvLAMP method was developed to detect the causative agent of cholera, the V. cholerae-specific gene lolb, the toxin genes ctxA and tcpA, and the virulence-associated genes hapA, mshA, pilA, tlh, nanH, and cri [27,28]. In this study, the qualitative and quantitative detection of the very important virulence-related genes opaR, tlh, vpadF, and ureC of V. parahaemolyticus in drinking water and commonly consumed aquatic products was developed for the first time using the LAMP technique. The objectives of this study were as follows: (1) to design three pairs of specific primers targeting each of the opaR, tlh, ureC, and vpadF genes of V. parahaemolyticus; (2) to determine the specificity and sensitivity of the LAMP method for the detection of cell culture and genomic DNA, as well as spiked samples of V. parahaemolyticus, and compare these with the standard PCR assay; (3) to rapidly screen potentially virulent V. parahaemolyticus in drinking water and commonly consumed fish, shrimp, and shellfish specimens by the LAMP method. The results of this study provide a simple, specific, and user-friendly molecular diagnostic tool for early diagnosis, particularly for the large-scale screening of drinking water and aquatic products contaminated by V. parahaemolyticus, a leading sea foodborne pathogen worldwide.

2. Results

2.1. Specificity of the LAMP Method

A total of 50 bacterial strains were employed in the exclusivity tests, including 7 species of Vibrios (n = 16 strains) and 20 species of non-Vibrios (n = 34 strains) (Table S1). Some common pathogenic bacteria were included, e.g., Vibrio alginolyticus, Vibrio fluvialis, Vibrio harveyi, and Vibrio vulnificus, as well as Aeromonas hydrophila, Enterobacter sakazakii, Klebsiella oxytoca, Klebsiella pneumoniae, Listeria monocytogenes, Pseudomonas aeruginosa, Enterobacter cloacae, and Staphylococcus aureus (Table S1). Pathogenic V. parahaemolyticus ATCC17802 (opaR⁺/vpadF⁺/tlh⁺/ureC⁺) was used as a positive control strain. For the target gene opaR, the LAMP reaction tube containing the genomic DNA sample extracted from V. parahaemolyticus ATCC17802 (opaR⁺) showed a color change from orange to light green under visible light, after being reacted at 65 °C for 45 min, whereas the other 50 tubes containing each of the DNA templates extracted from the 50 bacterial strains showed the original color of orange (Figure 1A). The positive reaction tube was also observed under ultraviolet (UV) light (302 nm), which emitted bright green fluorescence, whereas the 50 negative reaction tubes had no fluorescence (Figure 1B).

Similarly, for the target genes tlh, ureC, and vpadF in the exclusivity tests, only the LAMP reaction tubes containing the genomic DNA of V. parahaemolyticus ATCC17802 (vpadF⁺/tlh⁺/ureC⁺) showed the color change and emitted bright green fluorescence, while the other 50 tubes containing the other DNA templates were orange with no emission of fluorescence (figures not shown).

These results were confirmed by standard agarose gel electrophoresis analyses, in which the LAMP products from the positive reaction tube formed characteristic ladder-like DNA patterns [22], while those from the negative reaction tubes showed no DNA bands. Taken together, the LAMP method was highly specific to target each of the opaR, tlh, ureC, and vpadF genes of V. parahaemolyticus (

Table 1. The primers designed and used in this study.

Primer	Target Gene	Reaction	Sequence (5′–3′)	Product Size (bp)	Source
FIP-opaR	opaR	LAMP	CAGTGACAATCTTGGCTTACGA-CGTGAAAACATCGCAAACA		This study
BIP-opaR	opaR	LAMP	GTTCGAGTGGAGCGCATCAA-TGGTTAGTGCGGTTGGTA
F3-opaR	opaR	LAMP	TATCGACCTAGACATACACG
B3-opaR	opaR	LAMP	TTCAATCGCTTTAATGAACATG
LF-opaR	opaR	LAMP	CTCGATCATCGCATTGGTG
LB-opaR	opaR	LAMP	TTCGAGTGGAGCGCATCAAC
F-opaR	opaR	PCR	GTGGTGGTCACGCAGATA	417	This study
B-opaR	opaR	PCR	CGAACAGCGAGTAACAAA
FIP-vpadF	vpadF	LAMP	CACGCCTGCGGTATTAGTGAGTACCACCAAAGGCTTATGTGT		This study
BIP-vpadF	vpadF	LAMP	ACCATGCGTACTGGTTAAGCCAACCGCACAAGATGAGGGT
F3-vpadF	vpadF	LAMP	TCGCTCAACGTTCCCATG
B3-vpadF	vpadF	LAMP	TTGTAGCGTTGTCATGCCA
LF-vpadF	vpadF	LAMP	ACCGCACTGGAAATGCC
LB-vpadF	vpadF	LAMP	TCAAGCTCGGCATAGAT
F-vpadF	vpadF	PCR	TGCGGTATTAGTGAGTATGG	198	This study
B-vpadF	vpadF	PCR	AACGCTGTTCCTTTATGTTT
FIP-tlh	tlh	LAMP	CGCAATGCGTGGGTGTACATGTGGTTTCGTGAACGCGAGT		This study
BIP-tlh	tlh	LAMP	CTCTGAGTGTGCGGCGTCTGTGAGTTGCTGTTGTTGGGT
F3-tlh	tlh	LAMP	CTTCTGCGCCAGAAGAGC
B3-tlh	tlh	LAMP	TTTCTCTGCGACATAGCGG
LF-tlh	tlh	LAMP	CGGTTGATGTCCAAACAAG
LB-tlh	tlh	LAMP	AAGTTTGTGTTCTGGGATG
F-tlh	tlh	PCR	AGAACTTCATCTTGATGACACTGC	401	[34]
B-tlh	tlh	PCR	GCTACTTTCTAGCATTTTCTCTGC
FIP-ureC	ureC	LAMP	GCCAGGGGTGACTGTTGTAGCTTTTATCGGTGGTGGCACTG		This study
BIP-ureC	ureC	LAMP	TGTTGGAAGCAGTCGATGAGCTCGCTTCTGGTTGACTCACA
F3-ureC	ureC	LAMP	GGCTTGTCATCGGGTGTC
B3-ureC	ureC	LAMP	GCTTCAATCTGCTCACGGAT
LF-ureC	ureC	LAMP	ATTAGTACCAGCTACAGGG
LB-ureC	ureC	LAMP	ATCAACGTCGGGCTATTC
F-ureC	ureC	PCR	GACAAAGCCAAGTGACGA	312	This study
B-ureC	ureC	PCR	CAGTGCCACCACCGATAA

), and no cross-reaction was observed with the other 7 species of Vibrios and 20 species of non-Vibrios strains tested in this study.

2.2. Sensitivity of the LAMP Method

2.2.1. For the Detection of Cell Culture of V. parahaemolyticus

A total of 51 V. parahaemolyticus strains were employed in the inclusivity tests, and the results are presented in

Table 2. Sensitivity of the LAMP method targeting the opaR gene in genomic DNA and cell culture of V. parahaemolyticus strains and comparison with the PCR assay.

Strain	Target Gene	Genomic DNA Dilutions (ng/μL)	LOD (ng/Reaction)		Rate of LOD for Genomic DNA (LAMP/PCR)	Cell Culture Dilutions (CFU/mL)	LOD (CFU/Reaction)		Rate of LOD for Cell Culture (LAMP/PCR)
			LAMP	PCR			LAMP	PCR
B1-22	opaR	4.95 × 102–4.95 × 10−5	9.90 × 10−3	9.90 × 10−2	1.00 × 101	1.56 × 109–1.56	5.20 × 103	5.20 × 104	1.00 × 101
B3-8	opaR	1.08 × 102–1.08 × 10−5	2.16 × 10−1	2.16 × 101	1.00 × 102	1.20 × 109–1.20	4.00 × 102	4.00 × 106	1.00 × 104
B4-13	opaR	1.83 × 102–1.83 × 10−5	3.66 × 10−2	3.66 × 10−1	1.00 × 101	1.32 ×109–1.32	4.40 × 100	4.40 × 104	1.00 × 104
B4-28	opaR	1.34 × 102–1.34 × 10−5	2.68 × 10−2	2.68 × 101	1.00 × 103	1.34 × 108–1.34	4.47 × 101	4.47 × 105	1.00 × 104
B6-13	opaR	3.02 × 102–3.02 × 10−5	6.04 × 10−1	6.04 × 100	1.00 × 101	1.25 × 109–1.25	4.17 × 103	4.20 × 104	1.00 × 101
B7-16	opaR	2.59 × 102–2.59 × 10−5	5.18 × 10−4	5.18 × 100	1.00 × 104	2.34 × 108–2.34	7.80 × 102	7.80 × 104	1.00 × 102
B9-31	opaR	6.58 × 101–6.58 × 10−6	1.32 × 10−2	1.32 × 101	1.00 × 103	1.16 × 109–1.16	3.87 × 102	3.87 × 104	1.00 × 102
B9-42	opaR	1.60 × 102–1.60 × 10−5	3.21 × 10−4	3.21 × 100	1.00 × 104	5.20 × 107–5.20	1.73 × 102	1.73 × 105	1.00 × 103
B10-61	opaR	2.30 × 102–2.30 × 10−5	4.61 × 10−3	4.61 × 10−1	1.00 × 102	6.40 × 108–6.40	2.13 × 102	2.13 × 104	1.00 × 102
B11-3	opaR	1.41 × 102–1.41 × 10−5	2.83 × 10−2	2.83 × 100	1.00 × 102	7.00 × 108–7.00	2.33 × 101	2.33 × 105	1.00 × 104
L5-1	opaR	2.10 × 102–2.10 × 10−5	4.21 × 10−5	4.21 × 10−1	1.00 × 104	1.71 × 108–1.71	5.70 × 101	5.70 × 104	1.00 × 103
L7-7	opaR	2.15 × 102–2.15 × 10−5	4.30 × 10−1	4.30 × 101	1.00 × 102	2.14 × 109–2.14	7.13 × 103	7.13 × 106	1.00 × 103
L7-45	opaR	1.24 × 102–1.24 × 10−5	2.49 × 10−4	2.49 × 100	1.00 × 104	1.29 × 109–1.29	4.30 × 103	4.30 × 105	1.00 × 102
L10-15	opaR	1.49 × 102–1.49 × 10−5	2.98 × 10−3	2.98 × 10−1	1.00 × 102	2.59 × 108–2.59	8.63 × 101	8.63 × 104	1.00 × 103
N2-8	opaR	2.36 × 102–2.36 × 10−5	4.72 × 10−3	4.72 × 10−1	1.00 × 102	3.10 × 108–3.10	1.03 × 103	1.03 × 105	1.00 × 102
N2-11	opaR	9.36 × 101–9.36 × 10−6	1.87 × 10−1	1.87 × 101	1.00 × 102	7.40 × 107–7.40	2.47 × 103	2.47 × 104	1.00 × 101
N2-20	opaR	1.43 × 102–1.43 × 10−5	2.85 × 10−3	2.85 × 10−1	1.00 × 102	1.14 × 109–1.14	3.80 × 102	3.80 × 103	1.00 × 101
N2-25	opaR	1.44 × 102–1.44 × 10−5	2.89 × 10−5	2.89 × 10−1	1.00 × 104	6.40 × 108–6.40	2.13 × 103	2.13 × 105	1.00 × 102
N3-2	opaR	1.20 × 102–1.20 × 10−5	2.39 × 10−5	2.39 × 101	1.00 × 106	1.23 × 109–1.23	4.10 × 102	4.10 × 104	1.00 × 102
N3-3	opaR	1.11 × 102–1.11 × 10−5	2.22 × 10−5	2.22 × 100	1.00 × 105	9.10 × 107–9.10	3.03 × 10−1	3.03 × 104	1.00 × 105
N3-11	opaR	1.67 × 102–1.67 × 10−5	3.35 × 10−2	3.35 × 10−1	1.00 × 101	8.00 × 108–8.00	2.67 × 101	2.67 × 105	1.00 × 104
N3-13	opaR	1.95 × 102–1.95 × 10−5	3.90 × 10−4	3.90 × 10−2	1.00 × 102	6.60 × 107–6.60	2.20 × 101	2.20 × 104	1.00 × 103
N3-29	opaR	1.29 × 102–1.29 × 10−5	2.57 × 10−5	2.57 × 10−1	1.00 × 104	7.50 × 107–7.50	2.50 × 100	2.50 × 105	1.00 × 105
N3-30	opaR	1.47 × 102–1.47 × 10−5	2.94 × 10−1	2.94 × 101	1.00 × 102	2.10 × 108–2.10	7.00 × 102	7.00 × 104	1.00 × 102
N3-32	opaR	6.95 × 101–6.95 × 10−6	1.39 × 10−3	1.39 × 10−1	1.00 × 102	2.40 × 108–2.40	8.00 × 101	8.00 × 104	1.00 × 103
N3-33	opaR	9.60 × 101–9.60 × 10−6	1.92 × 10−2	1.92 × 10−1	1.00 × 101	3.80 × 107–3.80	1.27 × 101	1.27 × 105	1.00 × 104
N4-9	opaR	9.72 × 101–9.72 × 10−6	1.94 × 10−5	1.94 × 10−1	1.00 × 104	9.40 × 107–9.40	3.13 × 100	3.13 × 103	1.00 × 103
N4-26	opaR	7.31 × 101–7.31 × 10−6	1.46 × 10−5	1.46 × 10−1	1.00 × 104	8.30 × 107–8.30	2.77 × 10−1	2.77 × 105	1.00 × 106
N4-31	opaR	9.37 × 101–9.37 × 10−6	1.87 × 10−5	1.87 × 10−1	1.00 × 104	2.70 × 108–2.70	9.00 × 100	9.00 × 103	1.00 × 103
N4-46	opaR	8.34 × 101–8.34 × 10−6	1.67 × 10−1	1.67 × 101	1.00 × 102	8.60 × 107–8.60	2.87 × 102	2.87 × 105	1.00 × 103
N5-15	opaR	7.26 × 101–7.26 × 10−6	1.45 × 10−2	1.45 × 10−1	1.00 × 101	1.30 × 108–1.30	4.33 × 100	4.33 × 103	1.00 × 103
N6-7	opaR	1.79 × 102–1.79 × 10−5	3.58 × 10−5	3.58 × 10−2	1.00 × 103	1.61 × 108–1.61	5.37 × 10−2	5.37 × 105	1.00 × 107
N6-10	opaR	1.21 × 102–1.21 × 10−5	2.42 × 10−2	2.42 × 10−1	1.00 × 101	1.41 × 108–1.41	4.70 × 101	4.70 × 104	1.00 × 103
N6-16	opaR	9.80 × 101–9.80 × 10−6	1.96 × 10−3	1.96 × 10−2	1.00 × 101	2.54 × 108–2.4	8.47 × 101	8.47 × 104	1.00 × 103
N6-26	opaR	1.20 × 102–1.20 × 10−5	2.39 × 10−2	2.39 × 100	1.00 × 102	1.76 × 108–1.76	5.87 × 101	5.87 × 104	1.00 × 103
N7-3	opaR	8.79 × 101–8.79 × 10−6	1.76 × 10−2	1.76 × 101	1.00 × 103	9.50 × 107–9.50	3.17 × 100	3.17 × 105	1.00 × 105
N7-9	opaR	1.53 × 102–1.53 × 10−5	3.05 × 10−3	3.05 × 10−1	1.00 × 102	3.60 × 108–3.60	1.20 × 101	1.20 × 105	1.00 × 104
N7-45	opaR	1.22 × 102–1.22 × 10−5	2.43 × 10−3	2.43 × 100	1.00 × 103	2.76 × 108–2.76	9.20 × 10−2	9.20 × 104	1.00 × 106
N7-19	opaR	1.54 × 102–1.54 × 10−5	3.07 × 10−5	3.07 × 10−1	1.00 × 104	1.02 × 109–1.02	3.40 × 103	3.40 × 104	1.00 × 101
N8-9	opaR	1.09 × 102–1.09 × 10−5	2.18 × 10−3	2.18 × 100	1.00 × 103	1.34 × 108–1.34	4.47 × 101	4.47 × 105	1.00 × 104
N8-13	opaR	1.82 × 102–1.82 × 10−5	3.64 × 10−2	3.64 × 10−1	1.00 × 101	2.45 × 108–2.45	8.17 × 10−1	8.17 × 104	1.00 × 105
N8-36	opaR	9.17 × 101–9.17 × 10−6	1.83 × 10−5	1.83 × 10−1	1.00 × 104	2.18 × 108–2.18	7.27 × 10−1	7.27 × 105	1.00 × 106
N9-24	opaR	1.02 × 102–1.02 × 10−5	2.05 × 10−2	2.05 × 10−1	1.00 × 101	3.10 × 107–3.10	1.03 × 10−2	1.03 × 105	1.00 × 107
N9-31	opaR	2.08 × 102–2.08 × 10−5	4.16 × 10−4	4.16 × 100	1.00 × 104	2.60 × 108–2.60	8.67 × 100	8.67 × 103	1.00 × 103
N10-20	opaR	1.00 × 102–1.00 × 10−5	2.00 × 10−3	2.00 × 10−2	1.00 × 101	2.53 × 108–2.53	8.43 × 100	8.43 × 103	1.00 × 103
N10-48	opaR	1.16 × 102–1.16 × 10−5	2.32 × 10−3	2.32 × 10−2	1.00 × 101	2.56 × 108–2.56	8.53 × 10−2	8.53 × 104	1.00 × 106
Q5-6	opaR	2.23 × 102–2.23 × 10−5	4.46 × 10−5	4.46 × 100	1.00 × 105	1.68 × 108–1.68	5.60 × 100	5.60 × 105	1.00 × 105
Q8-2	opaR	8.83 × 101–8.83 × 10−6	1.77 × 10−2	1.77 × 102	1.00 × 104	8.90 × 107–8.90	2.97 × 101	2.97 × 104	1.00 × 103
Q8-7	opaR	1.89 × 102–1.90 × 10−5	3.79 × 10−1	3.79 × 102	1.00 × 103	4.10 × 107–4.10	1.37 × 100	1.37 × 103	1.00 × 103
ATCC 17802	opaR	9.26 × 101–9.26 × 10−6	1.85 × 100	1.85 × 102	1.00 × 102	1.32 × 108–1.32	4.40 × 103	4.40 × 105	1.00 × 102

,

Table 3. Sensitivity of the LAMP method targeting the vpadF gene in genomic DNA and cell culture of V. parahaemolyticus strains and comparison with the PCR assay.

Strain	Target Gene	Genomic DNA Dilutions (ng/μL)	LOD (ng/Reaction)		Rate of LOD for Genomic DNA (LAMP/PCR)	Cell Culture Dilutions (CFU/mL)	LOD (CFU/Reaction)		Rate of LOD for Cell Culture (LAMP/PCR)
			LAMP	PCR			LAMP	PCR
B1-22	vpadF	4.95 × 102–4.95 ×10−5	9.90 × 10−3	9.90 × 100	1.00 × 103	1.56 × 109–1.56	5.20 × 101	5.20 × 104	1.00 × 103
B3-8	vpadF	1.08 × 102–1.08 × 10−5	2.16 × 10−3	2.16 × 100	1.00 × 103	1.20 × 109–1.20	4.00 × 102	4.00 × 104	1.00 × 102
B4-13	vpadF	1.83 × 102–1.83 × 10−5	3.66 × 10−3	3.66 × 100	1.00 × 103	1.32 × 109–1.32	4.40 × 102	4.40 × 104	1.00 × 102
B4-28	vpadF	1.34 × 102–1.34 × 10−5	2.68 × 10−4	2.68 × 10−1	1.00 × 103	1.34 × 108–1.34	4.47 × 101	4.47 × 103	1.00 × 102
B7-16	vpadF	2.59 × 102–2.59 × 10−5	5.18 × 10−2	5.18 × 100	1.00 × 102	2.34 × 108–2.34	7.80 × 101	7.80 × 104	1.00 × 103
B9-31	vpadF	6.58 × 101–6.58 × 10−6	1.32 × 10−1	1.32 × 101	1.00 × 102	1.16 × 109–1.16	3.87 × 102	3.87 × 104	1.00 × 102
B9-42	vpadF	1.60 × 102–1.60 × 10−5	3.21 × 10−1	3.21 × 101	1.00 × 102	5.20 × 107–5.20	1.73 × 100	1.73 × 102	1.00 × 102
B11-3	vpadF	1.41 × 102–1.41 × 10−5	2.83 × 10−3	2.83 × 100	1.00 × 103	7.00 × 108–7.00	2.33 × 102	2.33 × 104	1.00 × 102
L5-1	vpadF	2.10 × 102–2.10 × 10−5	4.21 × 10−1	4.21 × 101	1.00 × 102	1.71 × 108–1.71	5.70 × 102	5.70 × 104	1.00 × 102
L7-7	vpadF	2.15 × 102–2.15 × 10−5	4.30 × 10−1	4.30 × 101	1.00 × 102	2.14 × 109–2.14	7.13 × 102	7.13 × 104	1.00 × 102
L7-45	vpadF	1.24 × 102–1.24 × 10−5	2.49 × 10−3	2.49 × 100	1.00 × 103	1.29 × 109–1.29	4.30 × 103	4.30 × 105	1.00 × 102
L10-15	vpadF	1.49 × 102–1.49 × 10−5	2.98 × 10−2	2.98 × 101	1.00 × 103	2.59 × 108–2.59	8.63 × 103	8.63 × 105	1.00 × 102
N2-8	vpadF	2.36 × 102–2.36 × 10−5	4.72 × 10−3	4.72 × 100	1.00 × 103	3.10 × 108–3.10	1.03 × 102	1.03 × 105	1.00 × 103
N2-11	vpadF	9.36 × 101–9.36 × 10−6	1.87 × 10−1	1.87 × 101	1.00 × 102	7.40 × 107–7.40	2.47 × 102	2.47 × 104	1.00 × 102
N2-20	vpadF	1.43 × 102–1.43 × 10−5	2.85 × 10−3	2.85 × 100	1.00 × 103	1.14 × 109–1.14	3.80 × 102	3.80 × 104	1.00 × 102
N3-2	vpadF	1.20 × 102–1.20 × 10−5	2.39 × 10−2	2.39 × 100	1.00 × 102	1.23 × 109–1.23	4.10 × 102	4.10 × 104	1.00 × 102
N3-3	vpadF	1.11 × 102–1.11 × 10−5	2.22 × 10−2	2.22 × 101	1.00 × 103	9.10 × 107–9.10	3.03 × 102	3.03 × 104	1.00 × 102
N3-11	vpadF	1.67 × 102–1.67 × 10−5	3.35 × 10−2	3.35 × 101	1.00 × 103	8.00 × 108–8.00	2.67 × 103	2.67 × 105	1.00 × 102
N3-13	vpadF	1.95 × 102–1.95 × 10−5	3.89 × 10−2	3.89 × 100	1.00 × 102	6.60 × 107–6.60	2.20 × 101	2.20 × 103	1.00 × 102
N3-29	vpadF	1.29 × 102–1.29 × 10−5	2.57 × 10−3	2.57 × 100	1.00 × 103	7.50 × 107–7.50	2.50 × 102	2.50 × 104	1.00 × 102
N3-30	vpadF	1.47 × 102–1.47 × 10−5	2.94 × 10−1	2.94 × 101	1.00 × 102	2.10 × 108–2.10	7.00 × 102	7.00 × 105	1.00 × 103
N3-32	vpadF	6.95 × 101–6.95 × 10−6	1.39 × 10−2	1.39 × 100	1.00 × 102	2.40 × 108–2.40	8.00 × 103	8.00 × 105	1.00 × 102
N4-9	vpadF	9.72 × 101–9.72 × 10−6	1.94 × 10−3	1.94 × 100	1.00 × 103	9.40 × 107–9.40	3.13 × 103	3.13 × 105	1.00 × 102
N4-26	vpadF	7.31 × 101–7.31 × 10−6	1.46 × 10−2	1.46 × 101	1.00 × 103	8.30 × 107–8.30	2.77 × 103	2.77 × 104	1.00 × 101
N4-31	vpadF	9.37 × 101–9.37 × 10−6	1.87 × 10−1	1.87 × 101	1.00 × 102	2.70 × 108–2.70	9.00 × 102	9.00 × 104	1.00 × 102
N4-46	vpadF	8.34 × 101–8.34 × 10−6	1.67 × 10−3	1.67 × 100	1.00 × 103	8.60 × 107–8.60	2.87 × 102	2.87 × 104	1.00 × 102
N5-15	vpadF	7.26 × 101–7.26 × 10−6	1.45 × 10−2	1.45 × 100	1.00 × 102	1.30 × 108–1.30	4.33 × 103	4.33 × 105	1.00 × 102
N6-16	vpadF	9.80 × 101–9.80 × 10−6	1.96 × 10−2	1.96 × 101	1.00 × 103	2.54 × 108–2.40	8.47 × 103	8.47 × 104	1.00 × 101
N6-26	vpadF	1.20 × 102–1.20 × 10−5	2.39 × 10−3	2.39 × 100	1.00 × 103	1.76 × 108–1.76	5.87 × 102	5.87 × 104	1.00 × 102
N7-45	vpadF	1.22 × 102–1.22 × 10−5	2.43 × 10−1	2.43 × 101	1.00 × 102	2.76 × 108–2.76	9.20 × 102	9.20 × 104	1.00 × 102
N7-19	vpadF	1.54 × 102–1.54 × 10−5	3.07 × 10−4	3.07 × 10−1	1.00 × 103	1.02 × 107–1.02	3.40 × 102	3.40 × 105	1.00 × 103
N8-9	vpadF	1.09 × 102–1.09 × 10−5	2.18 × 10−3	2.18 × 100	1.00 × 103	1.34 × 108–1.34	4.47 × 102	4.47 × 104	1.00 × 102
N8-13	vpadF	1.82 × 102–1.82 × 10−5	3.64 × 10−3	3.64 × 100	1.00 × 103	2.45 × 108–2.45	8.17 × 102	8.17 × 104	1.00 × 102
N8-36	vpadF	9.17 × 101–9.17 × 10−6	1.83 × 10−1	1.83 × 100	1.00 × 101	2.18 × 108–2.18	7.27 × 102	7.27 × 104	1.00 × 102
N9-24	vpadF	1.02 × 102–1.02 × 10−5	2.05 × 10−1	2.05 × 101	1.00 × 102	3.10 × 107–3.10	1.03 × 103	1.03 × 104	1.00 × 101
N9-31	vpadF	2.08 × 102–2.08 × 10−5	4.16 × 10−1	4.16 × 102	1.00 × 103	2.60 × 108–2.60	8.67 × 101	8.67 × 104	1.00 × 103
Q5-6	vpadF	2.23 × 102–2.23 × 10−5	4.46 × 10−4	4.46 × 100	1.00 × 104	1.68 × 108–1.68	5.60 × 102	5.60 × 105	1.00 × 103
Q8-15	vpadF	1.10 × 102–1.10 × 10−5	2.21 × 10−2	2.21 × 101	1.00 × 103	2.37 × 108–2.37	7.90 × 102	7.90 × 104	1.00 × 102
ATCC 17802	vpadF	9.26 × 101–9.26 × 10−6	1.85 × 10−4	1.85 × 100	1.00 × 104	1.32 × 108–1.32	4.40 × 102	4.40 × 103	1.00 × 101

and

Table 4. Sensitivity of the LAMP method targeting the tlh and ureC genes in genomic DNA and cell culture of V. parahaemolyticus strains and comparison with the PCR assay.

Strain	Target Gene	Genomic DNA Dilutions (ng/μL)	LOD (ng/Reaction)		Rate of LOD for Genomic DNA (LAMP/PCR)	Cell Culture Dilutions (CFU/mL)	LOD (CFU/Reaction)		Rate of LOD for Cell Culture (LAMP/PCR)
			LAMP	PCR			LAMP	PCR
B1-22	tlh	4.95 × 102–4.95 × 10−5	9.90 × 10−2	9.90 × 101	1.00 × 103	1.56 × 109–1.56	5.20 × 101	5.20 × 103	1.00 × 102
B3-8	tlh	1.08 × 102–1.08 × 10−5	2.16 × 10−1	2.16 × 100	1.00 × 101	1.20 × 109–1.20	4.00 × 102	4.00 × 105	1.00 × 103
B4-13	tlh	1.83 × 102–1.83 × 10−5	3.66 × 100	3.66 × 101	1.00 × 101	1.32 × 109–1.32	4.40 × 102	4.40 × 105	1.00 × 103
B4-28	tlh	1.34 × 102–1.34 × 10−5	2.68 × 101	2.68 × 102	1.00 × 101	1.34 × 108–1.34	4.47 × 101	4.47 × 102	1.00 × 101
B6-13	tlh	3.02 × 102–3.02 × 10−5	6.04 × 100	6.04 × 102	1.00 × 102	1.25 × 109–1.25	4.17 × 103	4.17 × 105	1.00 × 102
B7-16	tlh	2.59 × 102–2.59 × 10−5	5.18 × 10−3	5.18 × 101	1.00 × 104	2.34 × 108–2.34	7.80 × 101	7.80 × 102	1.00 × 101
B9-31	tlh	6.58 × 101–6.58 × 10−6	1.32 × 10−1	1.32 × 100	1.00 × 101	1.16 × 109–1.16	3.87 × 102	3.87 × 105	1.00 × 103
B9-42	tlh	1.60 × 102–1.60 × 10−5	3.21 × 100	3.21 × 101	1.00 × 101	5.20 × 107–5.20	1.73 × 103	1.73 × 105	1.00 × 102
B10-61	tlh	2.30 × 102–2.30 × 10−5	4.61 × 10−3	4.61 × 10−1	1.00 × 102	6.40 × 108–6.40	2.13 × 103	2.13 × 106	1.00 × 103
B11-3	tlh	1.41 × 102–1.41 × 10−5	2.83 × 10−1	2.83 × 102	1.00 × 103	7.00 × 108–7.00	2.33 × 102	2.33 × 105	1.00 × 103
L5-1	tlh	2.10 × 102–2.10 × 10−5	4.21 × 10−2	4.21 × 100	1.00 × 102	1.71 × 108–1.71	5.70 × 103	5.70 × 105	1.00 × 102
L7-7	tlh	2.15 × 102–2.15 × 10−5	4.29 × 10−1	4.29 × 101	1.00 × 102	2.14 × 109–2.14	7.13 × 103	7.13 × 106	1.00 × 103
L7-45	tlh	1.24 × 102–1.24 × 10−5	2.49 × 100	2.49 × 102	1.00 × 102	1.29 × 109–1.29	4.30 × 102	4.30 × 105	1.00 × 103
L10-15	tlh	1.49 × 102–1.49 × 10−5	2.98 × 101	2.98 × 102	1.00 × 101	2.59 × 108–2.59	8.63 × 103	8.63 × 105	1.00 × 102
N2-8	tlh	2.36 × 102–2.36 × 10−5	4.72 × 10−2	4.72 × 10−1	1.00 × 101	3.10 × 108–3.10	1.03 × 102	1.03 × 103	1.00 × 101
N2-11	tlh	9.36 × 101–9.36 × 10−6	1.87 × 101	1.87 × 102	1.00 × 101	7.40 × 107–7.40	2.47 × 103	2.47 × 105	1.00 × 102
N2-20	tlh	1.43 × 102–1.43 × 10−5	2.85 × 10−2	2.85 × 101	1.00 × 103	1.14 × 109–1.14	3.80 × 103	3.80 × 106	1.00 × 103
N2-25	tlh	1.44 × 102–1.45 × 10−5	2.89 × 100	2.89 × 101	1.00 × 101	6.40 × 107–6.40	2.13 × 103	2.13 × 105	1.00 × 102
N3-2	tlh	1.20 × 102–1.20 × 10−5	2.39 × 10−2	2.39 × 101	1.00 × 103	1.23 × 109–1.23	4.10 × 102	4.10 × 105	1.00 × 103
N3-3	tlh	1.11 × 102–1.11 × 10−5	2.22 × 10−1	2.22 × 101	1.00 × 102	9.10 × 107–9.10	3.03 × 103	3.03 × 105	1.00 × 102
N3-11	tlh	1.67 × 102–1.67 × 10−5	3.35 × 101	3.35 × 102	1.00 × 101	8.00 × 108–8.00	2.67 × 102	2.67 × 105	1.00 × 103
N3-13	tlh	1.95 × 102–1.95 × 10−5	3.90 × 10−2	3.90 × 101	1.00 × 103	6.60 × 107–6.60	2.20 × 102	2.20 × 105	1.00 × 103
N3-29	tlh	1.29 × 102–1.29 × 10−5	2.57 × 101	2.57 × 102	1.00 × 101	7.50 × 107–7.50	2.50 × 103	2.50 × 104	1.00 × 101
N3-30	tlh	1.47 × 102–1.47 × 10−5	2.94 × 101	2.94 × 102	1.00 × 101	2.10 × 108–2.10	7.00 × 103	7.00 × 104	1.00 × 101
N3-32	tlh	6.95 × 101–6.95 × 10−6	1.39 × 10−1	1.39 × 101	1.00 × 102	2.40 × 108–2.40	8.00 × 103	8.00 × 104	1.00 × 101
N3-33	tlh	9.60 × 101–9.60 × 10−6	1.92 × 100	1.92 × 101	1.00 × 101	3.80 × 107–3.80	1.27 × 102	1.27 × 104	1.00 × 102
N4-9	tlh	9.72 × 101–9.72 × 10−6	1.94 × 101	1.94 × 102	1.00 × 101	9.40 × 107–9.40	3.13 × 102	3.13 × 105	1.00 × 103
N4-26	tlh	7.31 × 101–7.31 × 10−6	1.46 × 100	1.46 × 102	1.00 × 102	8.30 × 107–8.30	2.77 × 103	2.77 × 105	1.00 × 102
N4-31	tlh	9.37 × 101–9.37 × 10−6	1.87 × 10−4	1.87 × 100	1.00 × 104	2.70 × 108–2.70	9.00 × 103	9.00 × 105	1.00 × 102
N4-46	tlh	8.34 × 101–8.34 × 10−6	1.67 × 10−2	1.67 × 100	1.00 × 102	8.60 × 107–8.60	2.87 × 103	2.87 × 104	1.00 × 101
N5-15	tlh	7.26 × 101–7.26 × 10−6	1.45 × 10−3	1.45 × 10−1	1.00 × 102	1.30 × 108–1.30	4.33 × 103	4.33 × 104	1.00 × 101
N6-7	tlh	1.79 × 102–1.79 × 10−5	3.58 × 10−2	3.58 × 100	1.00 × 102	1.61 × 108–1.61	5.37 × 103	5.37 × 104	1.00 × 101
N6- 10	tlh	1.21 × 102–1.21 × 10−5	2.42 × 10−3	2.42 × 10−1	1.00 × 102	1.41 × 108–1.41	4.70 × 103	4.70 × 105	1.00 × 102
N6-16	tlh	9.80 × 101–9.80 × 10−6	1.96 × 101	1.96 × 102	1.00 × 101	2.54 × 108–2.40	8.47 × 102	8.47 × 103	1.00 × 101
N6-26	tlh	1.20 × 102–1.20 × 10−5	2.39 × 10−1	2.39 × 101	1.00 × 102	1.76 × 108–1.76	5.87 × 103	5.87 × 104	1.00 × 101
N7-3	tlh	8.79 × 101–8.79 × 10−6	1.76 × 100	1.76 × 101	1.00 × 101	9.50 × 107–9.50	3.17 × 103	3.17 × 105	1.00 × 102
N7-9	tlh	1.53 × 102–1.53 × 10−5	3.05 × 10−3	3.05 × 10−2	1.00 × 101	3.60 × 108–3.60	1.20 × 103	1.20 × 106	1.00 × 103
N7-45	tlh	1.22 × 102–1.22 × 10−5	2.43 × 10−1	2.43 × 100	1.00 × 101	2.76 × 108–2.76	9.20 × 102	9.20 × 106	1.00 × 104
N7-19	tlh	1.54 × 102–1.54 × 10−5	3.07 × 10−1	3.07 × 102	1.00 × 103	1.02 × 109–1.02	3.40 × 102	3.40 × 105	1.00 × 103
N8-9	tlh	1.09 × 102–1.09 × 10−5	2.18 × 10−1	2.18 × 101	1.00 × 102	1.34 × 108–1.34	4.47 × 103	4.47 × 105	1.00 × 102
N8-13	tlh	1.82 × 102–1.82 × 10−5	3.64 × 100	3.64 × 102	1.00 × 102	2.45 × 108–2.45	8.17 × 103	8.17 × 105	1.00 × 102
N8-36	tlh	9.17 × 101–9.17 × 10−6	1.83 × 10−1	1.83 × 102	1.00 × 103	2.18 × 108–2.18	7.27 × 102	7.27 × 105	1.00 × 103
N9-24	tlh	1.02 × 102–1.02 × 10−5	2.05 × 10−1	2.05 × 101	1.00 × 102	3.10 × 107–3.10	1.03 × 102	1.03 × 105	1.00 × 103
N9-31	tlh	2.08 × 102–2.08 × 10−5	4.16 × 10−1	4.16 × 102	1.00 × 103	2.60 × 108–2.60	8.67 × 103	8.67 × 104	1.00 × 101
N10-20	tlh	1.00 × 102–1.00 × 10−5	2.00 × 100	2.00 × 102	1.00 × 102	2.53 × 108–2.53	8.43 × 103	8.43 × 105	1.00 × 102
N10-48	tlh	1.16 × 102–1.16 × 10−5	2.32 × 10−1	2.32 × 102	1.00 × 103	2.56 × 108–2.56	8.53 × 102	8.53 × 104	1.00 × 102
Q5-6	tlh	2.23 × 102–2.23 × 10−5	4.46 × 10−3	4.46 × 100	1.00 × 103	1.68 × 108–1.68	5.60 × 101	5.60 × 103	1.00 × 102
Q8-7	tlh	1.89 × 102–1.90 × 10−5	3.79 × 10−2	3.79 × 100	1.00 × 102	4.10 × 107–4.10	1.37 × 100	1.37 × 102	1.00 × 102
Q8-15	tlh	1.10 × 102–1.10 × 10−5	2.21 × 10−1	2.21 × 101	1.00 × 102	2.37 × 108–2.37	7.90 × 100	7.90 × 101	1.00 × 101
ATCC 17802	tlh	9.26 × 101–9.26 × 10−6	1.85 × 10−4	1.85 × 10−1	1.00 × 103	1.32 × 108–1.32	4.40 × 101	4.40 × 103	1.00 × 102
ATCC 17802	ureC	9.26 × 101–9.26 ×10−6	1.85 × 10−3	1.85 × 10−1	1.00 × 102	1.32 × 108–1.32	4.40 × 10−1	4.40 × 100	1.00 × 101

. For the target gene opaR, for example, serial dilutions of V. parahaemolyticus B4-13 cell culture (1.32 × 10⁹ to 1.32 × 10⁰ CFU/mL) were added into the LAMP reaction tubes. After being reacted at 65 °C for 45 min, the limit of detection (LOD) was observed in the tube containing 4.40 CFU/reaction (25 µL) of V. parahaemolyticus B4-13 cells, which changed color to light green and emitted bright green fluorescence under visible light and UV light, respectively (Figure 2A(r1 and r2)). The LOD tube also formed characteristic ladder-like DNA patterns in the agarose gel electrophoresis analyses (Figure 2A(r3)). Similarly, for the detection of the V. parahaemolyticus B11-3 cell culture (7.00 × 10⁸–7.00 × 10⁰ CFU/mL), the observed LOD was 2.33 × 10¹ CFU/reaction, while for the V. parahaemolyticus N3-3 cell culture (9.10 × 10⁷–9.10 × 10⁰ CFU/mL), the LOD was 3.03 × 10⁻¹ CFU/reaction (Figure 2B,C). Additionally, the cell cultures of the other 47 V. parahaemolyticus strains (opaR⁺) were all tested in the inclusivity tests. For the target gene opaR, the observed LOD values of the LAMP method ranged from 1.03 × 10⁻² to 7.13 × 10³ CFU/reaction for the detection of the cell cultures of the 50 V. parahaemolyticus strains (Table 2).

For the target gene vpadF, the cell culture of 39 V. parahaemolyticus strains (vpadF⁺) was examined in the inclusivity tests (Table 3); for example, serial dilutions of V. parahaemolyticus B7-16 (2.34 × 10⁸ to 2.34× 10⁰ CFU/mL), B9-42 (5.20 × 10⁷ to 5.20× 10⁰ CFU/mL), and N4-46 (8.60 × 10⁷ to 8.60 × 10⁰ CFU/mL) were examined by the LAMP method. The results showed that their LOD tubes contained 7.80 × 10¹ CFU/reaction, 1.73 CFU/reaction, and 2.87 × 10² CFU/reaction of V. parahaemolyticus, respectively (figures not shown). Similarly, each of the other 36 V. parahaemolyticus strains (vpadF⁺) were all tested in the inclusivity tests. The results indicated that for the target gene vpadF, the LODs of the LAMP method ranged from 1.73 × 10⁰ to 8.63 × 10³ CFU/reaction (Table 3).

For the target gene tlh, the cell culture of 50 V. parahaemolyticus strains (tlh⁺) was tested in the inclusivity tests. Serial dilutions of their cell culture ranged from 2.14 × 10⁹ to 1.02 × 10⁰ CFU/mL. The results showed that the LODs of the LAMP method targeting the tlh gene ranged from 1.37 × 10⁰ to 9.00 × 10³ CFU/reaction (Table 4).

For the target gene ureC, serial dilutions of V. parahaemolyticus ATCC17802 (ureC ⁺, 1.32 × 10⁸ to 1.32 × 10⁰) were tested, and the observed LOD was 4.40 × 10⁻¹ CFU/reaction by the LAMP method (Table 4, figures not shown).

Additionally, the target genes amplified from representative V. parahaemolyticus strains were confirmed by PCR and DNA sequencing analyses. The resulting sequences were deposited in GenBank under the accession numbers listed in Table S2.

Taken together, approximately 41.2% of the V. parahaemolyticus strains (21 of the 51 strains) could be detected in less than 10 CFU/reaction (25 µL) by the LAMP method developed in this study, and the average detection time was 1.5 h, which highlighted the high sensitivity of the LAMP method for the detection of a cell culture of V. parahaemolyticus.

2.2.2. For the Detection of Genomic DNA of V. parahaemolyticus

The sensitivity of the LAMP method for the detection of the genomic DNA of the 50 V. parahaemolyticus strains was also determined (Table 2, Table 3 and Table 4). For the target gene opaR, genomic DNA samples extracted from each of the 50 V. parahaemolyticus strains (opaR⁺) were serially diluted with concentrations ranging from 6.58 × 10⁻⁶ to 4.95 × 10² ng/µL, and examined by the LAMP method. To conduct this sensitivity test, genomic DNA dilutions of V. parahaemolyticus L5-1 (2.10 × 10² to 2.10 × 10⁻⁵ ng/µL) were added into LAMP reaction tubes. After being reacted at 65 °C for 45 min, eight tubes had positive reactions, showing a light green color, bright green fluorescence, and characteristic ladder-like DNA patterns (Figure 3A). The LOD tube contained 4.21 × 10⁻⁵ ng/reaction (25 µL) of genomic DNA. Similarly, genomic DNA dilutions of each of the other 49 V. parahaemolyticus strains were examined by the LAMP method. The results indicated that the LODs targeting the opaR gene ranged from 1.46 × 10⁻⁵ to 1.85 × 10⁰ ng/reaction of genomic DNA of V. parahaemolyticus using the LAMP method (Table 2).

Similarly, for the target gene vpadF, genomic DNA dilutions (6.58 × 10⁻⁶ to 4.95 × 10² ng/µL) of each of the 39 V. parahaemolyticus strains (vpadF⁺) were tested in the LAMP tubes. The results showed that the LODs targeting the vpadF gene ranged from 1.85 × 10⁻⁴ to 4.30 × 10⁻¹ ng/reaction using the LAMP method (Table 3, Figure 3B).

For the target gene tlh, genomic DNA dilutions of each of the 50 V. parahaemolyticus strains (tlh⁺) were tested in the LAMP tubes. The results showed that the LODs of the LAMP method for the vpadF gene ranged from 1.85 × 10⁻⁴ to 3.35 × 10¹ ng/reaction (Table 4, Figure 3C).

For the target gene ureC, genomic DNA dilutions (9.26 × 10¹ to 9.26 × 10⁻⁶ ng/μL) of V. parahaemolyticus ATCC17802 (ureC⁺) were examined by the LAMP method. The LOD tube contained 1.85 × 10⁻³ ng/reaction of genomic DNA for the ureC gene (Table 4, figures not shown).

Taken together, approximately 76.5% of the genomic DNA samples from all the V. parahaemolyticus strains (39 of the 51 strains) could be detected at less than 10 pg/reaction (25 µL) by the LAMP method developed in this study, which demonstrated the high sensitivity of the LAMP method for the detection of the genomic DNA of V. parahaemolyticus.

2.3. Sensitivity Comparison of the LAMP Method with the Standard PCR Assay

2.3.1. For the Detection of Cell Culture of V. parahaemolyticus

To compare the sensitivity of the LAMP method with the standard PCR assay, serial dilutions of each of the 50 V. parahaemolyticus cell cultures (2.14 × 10⁹ to 1.02 × 10⁰ CFU/mL) were examined by the PCR assay. For the target gene opaR, the observed LOD values of the PCR assay ranged from 7.13 × 10⁶ to 1.37 × 10³ CFU/reaction via the routine agarose gel electrophoresis analysis (Table 2); for example, when serial dilutions of V. parahaemolyticus B4-13 cell culture were tested, the observed LOD of the PCR assay was 4.40 × 10⁴ CFU/reaction (Figure 2D), which was 1.00 × 10⁴-fold lower than that of the LAMP method (4.40 CFU/reaction) (Figure 2A(r4)).

Similarly, for the target gene vpadF, the cell culture of the 39 V. parahaemolyticus strains (vpadF⁺, 2.14 × 10⁹ to 1.02 × 10⁰ CFU/mL) was tested by the PCR assay. The resulting LODs of the PCR assay were 1.73 × 10² to 8.63 × 10⁵ CFU/reaction (Table 3). Serial dilutions of V. parahaemolyticus B7-16, B9-42, and N4-46 were also examined by the PCR assay. The results showed that their LODs were 7.80 × 10⁴, 1.73 × 10², and 2.87 × 10⁴, which were 1000-, 100-, and 100-fold lower than those obtained by the LAMP method (7.80 × 10¹ CFU/reaction, 1.73 CFU/reaction, and 2.87 × 10² CFU/reaction), respectively (Table 3, figures not shown).

For the target gene tlh, the cell culture of the 50 V. parahaemolyticus strains (tlh⁺) was tested by the PCR assay, and the observed LODs were recorded to range from 7.90 × 10¹ to 9.20 × 10⁶ CFU/reaction. The LAMP method was 1.00 × 10¹- to 1.00 × 10⁴-fold more sensitive than the PCR assay (Table 4).

For the target gene ureC, serial dilutions of V. parahaemolyticus ATCC17802 cell culture (ureC ⁺) were examined by the PCR assay. The LOD of the PCR assay was 4.40 × 10⁰ CFU/reaction, which was 10-fold less sensitive than the LAMP method (4.40 × 10⁻¹ CFU/reaction; Table 4, figures not shown).

These results demonstrated that the lowest LODs, obtained using the PCR assay, targeting the opaR, tlh, ureC, and vpadF genes in the cell culture of V. parahaemolyticus strains, were 1.00 × 10¹- to 1.00 × 10⁷-fold lower than those obtained using the PCR assay.

2.3.2. For the Detection of Genomic DNA of V. parahaemolyticus

Genomic DNA dilutions of each of the 50 V. parahaemolyticus strains (6.58 × 10⁻⁶ to 4.95 × 10² ng/µL) were also examined by the PCR assay, and the resulting data are presented in Table 2, Table 3 and Table 4. For the target gene opaR, the observed LODs for the detection of the genomic DNA of the 50 V. parahaemolyticus strains (opaR⁺) ranged from 1.96 × 10⁻² to 3.79 × 10² ng/reaction using the PCR assay, which was 1.00 × 10¹- to 1.00 × 10⁶-fold lower than those obtained using the LAMP method (Table 2, Figure 3).

Similarly, for the target gene vpadF, the LODs for the detection of the genomic DNA of the 39 V. parahaemolyticus strains (vpadF⁺) were 2.68 × 10⁻¹ to 4.16 × 10² ng/reaction using the PCR assay, which was 1.00 × 10¹- to 1.00 × 10⁴-fold lower than those obtained using the LAMP method (Table 3, Figure 3).

For the target gene tlh, the LODs for the detection of the genomic DNA of the 50 V. parahaemolyticus strains (tlh⁺) were 3.05 × 10⁻² to 6.04 × 10² ng/reaction using the PCR assay, which was 1.00 × 10¹- to 1.00 × 10⁴-fold lower than those obtained using the LAMP method (Table 4, Figure 3).

For the target gene ureC, the observed LOD for the detection of the genomic DNA of V. parahaemolyticus ATCC17802 (ureC⁺) was 1.85 × 10⁻¹ ng/reaction using the PCR assay, which was 100-fold lower than that obtained using the LAMP method (Table 4, figures not shown).

These results demonstrated that the sensitivity of the LAMP method was 1.00 × 10¹- to 1.00 × 10⁶-fold higher than that of the routine PCR assay for the detection of the genomic DNA of V. parahaemolyticus strains.

2.4. Sensitivity of the LAMP Method for the Detection of Spiked Fish, Shrimp and Shellfish Samples

Cell cultures of the V. parahaemolyticus strains ATCC17802 (opaR⁺/vpadF⁺/tlh⁺/ureC⁺) and N7-19 (opaR⁺/vpadF⁺/tlh⁺/ureC^-) were individually spiked into each of six species of commonly consumed aquatic animal samples, including the following four species of fish: Aristichthys nobilis, Carassius auratus, Ctenopharyngodon idella, and Parabramis pekinensis; the following species of shrimp: Litopenaeus vannamei; the following species of shellfish: Mytilus edulis. The sensitivity of the LAMP method was determined for each of the target genes, and the resulting data are presented in

Table 5. Sensitivity of the LAMP method and the PCR assay for the detection of aquatic product samples spiked with V. parahaemolyticus strains.

Target Gene	Aquatic Product	Spiked Strain	Cell Culture Dilutions (CFU/mL)	LOD (CFU/Reaction)		Rate of LOD (LAMP/PCR)
				LAMP	PCR
opaR	Aristichthys nobilis	N7-19	2.96 × 108–2.96	9.87 × 100	9.87 × 101	1.00 × 101
	Carassius auratus			9.87 × 101	9.87 × 102	1.00 × 101
	Ctenopharyngodon idella			9.87 × 100	9.87 × 102	1.00 × 102
	Parabramis pekinensis			9.87 × 102	9.87 × 104	1.00 × 102
	Mytilus edulis			9.87 × 102	9.87 × 103	1.00 × 101
	Litopenaeus vannamei			9.87 × 10−2	9.87 × 103	1.00 × 105
vpadF	Aristichthys nobilis	N7-19	2.96 × 108–2.96	9.87 × 100	9.87 × 103	1.00 × 103
	Carassius auratus			9.87 × 10−1	9.87 × 102	1.00 × 103
	Ctenopharyngodon idella			9.87 × 102	9.87 × 104	1.00 × 102
	Parabramis pekinensis			9.87 × 102	9.87 × 104	1.00 × 102
	Mytilus edulis			9.87 × 102	9.87 × 104	1.00 × 102
	Litopenaeus vannamei			9.87 × 100	9.87 × 103	1.00 × 103
tlh	Aristichthys nobilis	N7-19	2.96 × 108–2.96	9.87 × 103	9.87 × 105	1.00 × 102
	Carassius auratus			9.87 × 102	9.87 × 104	1.00 × 102
	Ctenopharyngodon idella			9.87 × 103	9.87 × 104	1.00 × 101
	Parabramis pekinensis			9.87 × 103	9.87 × 105	1.00 × 102
	Mytilus edulis			9.87 × 104	9.87 × 105	1.00 × 101
	Litopenaeus vannamei			9.87 × 102	9.87 × 103	1.00 × 101
ureC	Aristichthys nobilis	ATCC17802	2.75 × 109–2.75	9.17 × 103	9.17 × 105	1.00 × 102
	Carassius auratus			9.17 × 102	9.17 × 104	1.00 × 102
	Ctenopharyngodon idella			9.17 × 103	9.17 × 104	1.00 × 101
	Parabramis pekinensis			9.17 × 103	9.17 × 105	1.00 × 102
	Mytilus edulis			9.17 × 101	9.17 × 102	1.00 × 101
	Litopenaeus vannamei			9.17 × 102	9.17 × 104	1.00 × 102

.

When the cell culture of V. parahaemolyticus N7-19 (2.96 × 10⁸ to 2.96 CFU/mL) was spiked into the samples, for the target gene opaR, the resulting LODs were recorded to range from 9.87 × 10⁰ to 9.87 × 10² CFU/reaction for the spiked fish; 9.87 × 10⁻² CFU/reaction for the spiked L. vannamei; 9.87 × 10² CFU/reaction for the spiked M. edulis samples. For the target gene vpadF, the LOD values were 9.87 × 10⁻¹ to 9.87 × 10² CFU/reaction for the spiked fish; 9.87 × 10⁰ CFU/reaction for the spiked shrimp; 9.87 × 10² CFU/reaction for the spiked shellfish. For the target gene tlh, the LOD values of the LAMP method ranged from 9.87 × 10² to 9.87 × 10³ CFU/reaction for the spiked fish; 9.87 × 10² CFU/reaction for the spiked shrimp; 9.87 × 10⁴ CFU/reaction for the spiked shellfish samples (Table 5, Figure 4).

Similarly, when the cell culture of V. parahaemolyticus ATCC17802 (2.75 × 10⁹ to 2.75 CFU/mL) was spiked into the aquatic product samples, for the target gene ureC, the observed LODs by the LAMP method ranged from 9.17 × 10³ to 9.17 × 10² CFU/reaction for the spiked A. nobilis, C. auratus, C. idella, and P. pekinensis; 9.17 × 10² CFU/reaction for the spiked L. vannamei; 9.17 × 10¹ CFU/reaction for the spiked M. edulis samples (Table 5, Figure 4).

2.5. Sensitivity Comparison of the LAMP Method with the Standard PCR Assay for the Detection of Spiked Aquatic Product Samples

The sensitivity of the detection of the spiked aquatic product samples with a cell culture of V. parahaemolyticus ATCC17802 (opaR⁺/vpadF⁺/tlh⁺/ureC⁺) and N7-19 (opaR⁺/vpadF⁺/tlh⁺/ureC⁻) was also determined by the standard PCR assay (Table 5); for example, when V. parahaemolyticus N7-19 was spiked into the samples, for the target gene opaR, the observed LODs using the PCR assay were 9.87 × 10¹ to 9.87 × 10⁴ CFU/reaction for the spiked A. nobilis, C. auratus, C. idella, and P. pekinensis; 9.87 × 10³ CFU/reaction for the spiked L. vannamei; 9.87 × 10³ CFU/reaction for the spiked M. edulis samples. Similarly, for the target gene vpadF, the observed LODs using the PCR assay were 9.87 × 10² to 9.87 × 10⁴ CFU/reaction for the spiked fish; 9.87 × 10³ CFU/reaction for the spiked shrimp; 9.87 × 10⁴ CFU/reaction for the spiked shellfish samples. For the target gene tlh, the observed LODs using the PCR assay were 9.87 × 10⁴ to 9.87 × 10⁵ CFU/reaction for the spiked fish; 9.87 × 10³ CFU/reaction for the spiked shrimp; 9.87 × 10⁵ CFU/reaction for the spiked shellfish samples (Table 5, Figure 4).

Similarly, when V. parahaemolyticus 17802 was spiked into the samples, for the target gene ureC, the observed LODs using the PCR assay were 9.17 × 10⁴ to 9.17 × 10⁵ CFU/reaction for the spiked fish; 9.17 × 10⁴ CFU/reaction for the spiked shrimp; 9.17 × 10² CFU/reaction for the spiked shellfish samples (Table 5, Figure 4).

These results demonstrated that the sensitivity of the PCR assay was 1.00 × 10¹- to 1.00 × 10⁵-fold lower than that of the LAMP method for the detection of the opaR, tlh, ureC, and vpadF genes in the spiked aquatic product samples.

2.6. Reproducibility of the LAMP Method

For the target genes opaR, tlh, ureC, and vpadF of V. parahaemolyticus, all the positive results could be repeated in all the tests performed for the detection of cell culture and genomic DNA samples, as well as of the spiked aquatic product samples, indicating high reproductivity (100%) of the LAMP method developed in this study.

2.7. Detection of Drinking Water and Aquatic Product Samples by the LAMP Method

Water samples from various sources were collected in Shanghai, China, in August 2021, including mineral water (n = 3), tap water (n = 3), river water (n = 3), lake water (n = 3), and estuarine water (n = 3). The samples were promptly screened by the LAMP method for the virulence-associated genes opaR, vpadF, tlh, and ureC of V. parahaemolyticus. As shown in

Table 6. Detection of the virulence-related genes of V. parahaemolyticus in drinking water and aquatic product samples by the LAMP method.

Sample	No. of Sample	Virulence-Related Gene	No. of Sample
Water sample
Mineral water	3	opaR-/vpadF-/tlh-/ureC-	3
Tap water	3	opaR-/vpadF-/tlh-/ureC-	3
River water	3	opaR-/vpadF-/tlh-/ureC-	3
Lake water	3	opaR-/vpadF-/tlh-/ureC-	3
Estuarine water	3	opaR-/vpadF-/tlh-/ureC-	3
Meat sample
Aristichthys nobilis	3	opaR-/vpadF-/tlh-/ureC-	3
Carassius auratus	3	opaR-/vpadF-/tlh-/ureC-	3
Ctenopharyngodon idella	3	opaR-/vpadF-/tlh-/ureC-	3
Parabramis pekinensis	3	opaR-/vpadF-/tlh-/ureC-	3
Mytilus edulis	3	opaR-/vpadF-/tlh-/ureC-	3
Litopenaeus vannamei	3	opaR-/vpadF-/tlh-/ureC-	3
Intestine sample
Aristichthys nobilis	3	opaR-/vpadF-/tlh-/ureC-	3
Carassius auratus	3	opaR-/vpadF-/tlh-/ureC-	3
Ctenopharyngodon idella	3	opaR-/vpadF-/tlh-/ureC-	3
Parabramis pekinensis	3	opaR+/vpadF-/tlh+/ure C-	3
Mytilus edulis	3	opaR-/vpadF-/tlh-/ureC-	3
Litopenaeus vannamei	3	opaR-/vpadF-/tlh-/ureC-	3

, all the water samples tested negative for the target genes.

In addition, six species of commonly consumed aquatic product samples were collected from the fish market in Shanghai, China, in September 2021, and were examined by the LAMP method. The results showed that all the meat samples and most the intestine samples were negative for the opaR, vpadF, tlh, and ureC genes of V. parahaemolyticus. However, the opaR and tlh genes were detected in the intestine sample of P. pekinensis (Table 6, Figure 5), which were confirmed by routine microbial isolation and identification methods [35] (data not shown). These results suggested the risk of potentially virulent V. parahaemolyticus strains in the fish product.

3. Discussion

V. parahaemolyticus is the most prevalent gastroenteritis-causing pathogen in Asian countries [36,37]. Appropriate tools for the diagnosis of V. parahaemolyticus contamination in drinking water and aquatic products are the key to fight against outbreaks of the disease [38]. In this study, for the first time, we successfully developed a LAMP method for the detection of toxins and infection process-associated genes opaR, tlh, ureC, and vpadF of V. parahaemolyticus. Our data demonstrated high specificity of the inner, outer, and loop primers designed for each of the target genes in this study. No cross-reaction was observed with the other 7 species of Vibrios and 20 species of non-Vibrios strains, including common pathogenic bacteria, such as V. cholerae, V. alginolyticus, V. fluvialis, V. harveyi, and V. vulnificus, as well as L. monocytogenes, K. pneumoniae, K. oxytoca, A. hydrophila, and S. aureus.

Different sensitivity of the LAMP technique has been reported in the detection of foodborne pathogens; for example, Anupama et al. reported LODs of 1 pg/reaction and 1 CFU/reaction when targeting the tdh and trh genes of V. parahaemolyticus by LAMP [3]. The toxR-LAMP assay was able to detect 47–470 V. parahaemolyticus cells per reaction tube [32]. The LODs of the LAMP assays targeting the rpoD and toxR genes of V. parahaemolyticus were 3.7 and 450 CFU per test, respectively [31]. For the artificially contaminated seafood and seawater, the LODs of the LAMP assay were 120 and 150 fg per reaction for the groEL gene of V. parahaemolyticus [33]. In this study, inclusivity tests were conducted for each of the target genes with 50 V. parahaemolyticus strains. In a 25 µL LAMP system, the lowest observed LODs were 14.6 fg/reaction and 0.0103 CFU/reaction when targeting the opaR gene; 1.85 × 10⁻⁴ ng/reaction and 1.73 CFU/reaction when targeting the vpadF gene; 1.85 × 10⁻⁴ ng/reaction and 1.37 CFU/reaction when targeting the tlh gene; 1.85 pg/reaction and 0.44 CFU/reaction when targeting the ureC gene. The LAMP method developed in this study was more sensitive, with lower LODs, than the previous reports [3,31,32,33], not only for the detection of genomic DNA, but also for bacterial cell samples in water.

The influence of different aquatic product matrixes on the sensitivity of the LAMP method was observed in this study; for example, when the cell culture of V. parahaemolyticus ATCC17802 (2.75 × 10⁹–2.75 CFU/mL) was spiked into the aquatic product samples, the observed LODs ranged from 9.17 × 10³ to 9.17 × 10¹ CFU/reaction when targeting the ureC gene for the spiked fish, shrimp, and shellfish samples, which was 2.08× 10²- to 2.08× 10⁴-fold lower than those obtained for the detection of V. parahaemolyticus cells in water (4.40 × 10⁻¹ CFU/reaction). Moreover, our data revealed that the L. vannamei matrix appeared to interfere with the LAMP method more than those from the fish and shellfish. The L. vannamei matrix contained higher contents of proteins (23.3%) and crude fat (15.09%) [39] than the P. pekinensis (15.6% and 6.6%, respectively) and M. edulis (10.8% and 1.4%, respectively) matrixes [40], which may explain the observation. It will be interesting to investigate possible components in the L. vannamei matrix that contributed to the influence.

A comparison of the sensitivity of the LAMP method with the standard PCR assay revealed that the lowest LODs of the PCR assay ranged from 1.96 × 10⁻² to 3.79 × 10² ng/reaction and 1.37 × 10³ to 7.13 × 10⁶ CFU/reaction when targeting the opaR gene of V. parahaemolyticus; 3.05 × 10⁻² to 6.04 × 10² ng/reaction and 7.90 × 10¹ to 9.20 × 10⁶ CFU/reaction when targeting the tlh gene; 1.85 × 10⁻¹ ng/reaction and 4.40 × 10⁰ CFU/reaction when targeting the ureC gene; 2.68 × 10⁻¹ to 4.16 × 10² ng/reaction and 1.73 × 10² to 8.63 × 10⁵ CFU/reaction when targeting the vpadF gene. These LODs were 1.00 × 10¹- to 1.00 × 10⁶-fold, for the genomic DNA, and 1.00 × 10¹- to 1.00 × 10⁷-fold, for the cell culture, lower than those obtained using the LAMP method. Although the aquatic product matrixes interfered with the sensitivity of the LAMP method, it was still more sensitive than the PCR assay.

The main limitation of the LAMP-based method is the complexity of the primer design to achieve the specificity of the detection. Another possible limitation of this method is that it could generate false-positive results due to the carry-over from previous experiments (due to its high sensitivity), especially when upgraded to an automated platform [41]. However, compared with the routine PCR and RT-PCR assays, the LAMP method developed in this study can be performed with a simple dry or water bath, which is more suitable for laboratories with less equipment [28]. Moreover, unlike the former two assays, the LAMP method does not require the reaction tubes to be opened, so there is no probable cross-contamination, and this method supports the field screening of potentially virulent V. parahaemolyticus with a larger diagnostic capacity.

4. Materials and Methods

4.1. Bacterial Strains and Culture Conditions

Bacterial strains used in this study are listed in Supplementary Table S1. Culture media were purchased as described previously [28]. Vibrio strains were incubated in 3% NaCl, pH 8.5 media, while non-Vibrio strains were incubated in 1% NaCl, pH 7.0 media [28].

4.2. Genomic DNA Preparation

Bacterial genomic DNA was prepared using TIANamp Bacterial Genomic DNA Extraction kit DP302 (Tiangen Biotech (Beijing) Co., Ltd., Beijing, China), or extracted by a thermal lysis method [28] with minor modifications. Briefly, 100 µL of bacteria cell culture was added into 900 µL 1 x phosphate-buffered saline (PBS, pH 7.4–7.6; Shanghai Sangon Biological Engineering Technology and Services Co., Ltd., Shanghai, China), mixed well, and then serially diluted. Cell pellet of each dilution was collected by centrifugation, resuspended with 200 µL sterile ultrapure water. The cell suspension was heated at 95 °C for 10 min, and then transferred onto ice for cooling. After centrifugation at 12,000 rpm for 5 min, the resulting lysis solution was used as DNA template. Extracted DNA samples were analyzed, and DNA concentrations and purity (A260/A280) were determined as described previously [28].

4.3. Designing of LAMP Primers

Sequences of target genes (opaR, tlh, ureC, and vpadF) in V. parahaemolyticus were retrieved from National Center for Biotechnology Information (NCBI, https://www.ncbi.nlm.nih.gov/; accessed on 9 December 2020 to 23 May 2021) with GenBank accession numbers listed in Supplementary Table S1. The FIP and BIP, F3 and B3, and LF and LB primers targeting conserved sequences of each gene were designed using Primer Explorer Version 5 and SnapGene Viewer version 4.1.4 software (GSL Biotech LLC, Chicago, IL, USA) as described previously [28]. All primers (Table 1) were synthesized and DNA sequencing of PCR products was carried out by Sangon (Shanghai, China).

Following this, 1.6 µM of FIP and BIP primers, 0.05 µM of F3 and B3 primers, and 0.20 µM of LF and LB primers were used in a 25 µL LAMP reaction system. The system also contained 6 mM Mg²⁺, 1.0 mM dNTP, 8 units of bacillus stearothermophilus (Bst) DNA polymerase, and MnCl₂ (15.60 mM)–calcein (1.30 mM) [27,28]. The one-step LAMP reaction was performed at 65 °C for 45 min.

4.4. Determination of Specificity and Sensitivity of the LAMP Method

Exclusivity (determined as 100% negative detection of non-target strains) and inclusivity (determined as 100% positive detection of target strains) tests of the LAMP method were determined as described previously [27,28]. The 50 bacterial strains and 51 V. parahaemolyticus strains used in this study for the exclusivity and inclusivity tests are listed in Supplementary Table S1 and Table 2, Table 3, Table 4, respectively. Genomic DNA samples extracted from each of these strains were serially diluted with DNase-/RNase-free deionized water (Tiangen Biotech Co., Ltd., Beijing, China), and used as DNA templates.

For the detection of V. parahaemolyticus cells, overnight cultures of each V. parahaemolyticus strain were inoculated (1%, v/v) into fresh media (Supplementary Table S1) and bacterial cells grown at mid-logarithmic phase were harvested by centrifugation, resuspended, diluted, and enumerated as described previously [27,28].

4.5. Preparation and Analysis of Spiked Samples by LAMP

Spiked aquatic product samples were prepared according to the method described previously [42]. Fresh fish (A. nobilis, C. auratus, C. idellus, and P. pekinensis) (n = 3 per fish species, >500 g/sample), shrimp (L. vannamei, 500 g), and shellfish (M. edulis, 500 g) were purchased from Huangweixing aquatic product market in Nanhui New Town, Pudong New Area, Shanghai, China in September 2021. Twenty-five grams (wet weight) of mussel samples without skin or shell, or intestine samples, were cut with a sterile scalpel and homogenized with 225 mL of 1 × PBS (pH 7.4–7.6, Sangon, China) using BagMixer 400 (Interscience, Paris, France) homogenizer. Only the homogenate samples that were detected as negative for V. parahaemolyticus and the virulence-associated genes were used in the following spiked experiments [28,35].

Serial 10-fold dilutions of V. parahaemolyticus ATCC17802 and N7-19 culture were prepared, and calculated by plate counting method [28]. Further, 100 µL of each dilution was spiked into 900 µL fresh homogenate. Two microliters of 10-fold dilution of the mixture was used for the LAMP method [28].

4.6. PCR Assay

Primers used for the PCR assay in this study are listed in Table 1. The 10 µL PCR reaction solutions were prepared, and 30 cycles of PCR reactions were performed using Mastercycler Rpro PCR thermal cycler (Eppendorf, Hamburg, Germany), according to the methods described previously [28]. Amplicons were analyzed by agarose gel electrophoresis, then visualized and recorded [28].

4.7. Sample Collection and Analysis

Water samples were collected from various sources in August 2021 in Shanghai, China (Table 5). Freshwater fish (A. nobilis, C. auratus, C. idellus, and P. pekinensis) (n = 3 per fish species, >500 g/sample), shrimp (L. vannamei, 500 g), and shellfish (M. edulis, 500 g) samples were collected from the local aquatic product market as described above. All samples were maintained at 4 °C, immediately transported to the laboratory in Shanghai Ocean University (Shanghai, China), and analyzed according to the National Standards of the People’s Republic of China; we used the standard inspection methods for drinking water, the collection and preservation of water samples (GB/T 5750.2-2006), the direct processing of samples (SN/T 2332-2009), and the methods described previously by our research group [27,28].

5. Conclusions

Vibrio parahaemolyticus can cause acute gastroenteritis, wound infection, and septicemia in humans. The bacterium is found growing in aquatic environments worldwide. The detection of V. parahaemolyticus in drinking water and aquatic products is essential for food safety control and human health. In this study, a simple, specific, and user-friendly diagnostic tool was developed for the first time, for the qualitative and quantitative detection of toxins and infection process-associated genes opaR, vpadF, tlh, and ureC in V. parahaemolyticus, using the LAMP technique. Three pairs of specific inner, outer, and loop primers were designed for targeting each of these genes, and the results showed no cross-reaction with the other common Vibrios and non-Vibrios pathogenic bacteria. Positive results in the one-step LAMP reaction (at 65 °C for 45 min) were identified by a change to light green and the emission of bright green fluorescence under visible light and UV light (302 nm), respectively. The lowest limit of detection (LOD) of the LAMP method for the target genes ranged from 1.46 × 10⁻⁵ to 1.85 × 10⁻³ ng/reaction (25 µL) for the genomic DNA, and from 1.03 × 10⁻² to 1.73 × 10⁰ CFU/reaction (25 µL) for the cell culture of V. parahaemolyticus, which were 1.00 × 10¹–1.00 × 10⁶ and 1.00 × 10¹–1.00 × 10⁷ more sensitive than the standard polymerase chain reaction (PCR) assay. Similarly high efficiency was observed for the detection of spiked aquatic product samples. Water from various sources, and commonly consumed fish (A. nobilis, C. auratus, C. idellus, and P. pekinensis), shrimp (L. vannamei), and shellfish (M. edulis) samples, were promptly screened by the LAMP method, and V. parahaemolyticus was detected by the presence of opaR and tlh genes in the intestine of P. pekinensis, indicating a risk of potentially pathogenic V. parahaemolyticus in the fish product. Overall, this study provides a molecular diagnostic tool for early diagnosis, particularly for the large-scale screening of drinking water and aquatic products contaminated by V. parahaemolyticus, a leading sea foodborne pathogen worldwide.