Genetic and Morphological Identification of Spirometra decipiens in Snakes and Domestic Dog Found in Cuba
Abstract
1. Introduction
2. Materials and Methods
2.1. Samples
2.2. Histopathological Findings
2.3. DNA Extraction
2.4. PCR Assays
2.5. Amplicons Detection
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Yamasaki, H.; Sanpool, O.; Rodpai, R.; Sadaow, L.; Laummaunwai, P.; Un, M.; Thanchomnang, T.; Laymanivong, S.; Aung, W.P.P.; Intapan, P.M.; et al. Spirometra species from Asia: Genetic diversity and taxonomic challenges. Parasitol. Int. 2021, 80, 102181. [Google Scholar] [CrossRef] [PubMed]
- Lescano, A.G.; Zunt, J. Other cestodes: Sparganosis, coenurosis and Taenia crassiceps cysticercosis. Handb. Clin. Neurol. 2013, 114, 335–345. [Google Scholar] [CrossRef] [PubMed]
- Oda, F.H.; Borteiro, C.; da Graça, R.J.; Tavares, L.E.R.; Crampet, A.; Guerra, V.; Lima, F.S.; Bellay, S.; Karling, L.C.; Castro, O.; et al. Parasitism by larval tapeworms genus Spirometra in South American amphibians and reptiles: New records from Brazil and Uruguay, and a review of current knowledge in the region. Acta Trop. 2016, 164, 150–164. [Google Scholar] [CrossRef] [PubMed]
- Hong, Q.; Feng, J.; Liu, H.; Li, X.; Gong, L.; Yang, Z.; Yang, W.; Liang, X.; Zheng, R.; Cui, Z.; et al. Prevalence of Spirometra mansoni in dogs, cats, and frogs and its medical relevance in Guangzhou, China. Int. J. Infect. Dis. 2016, 53, 41–45. [Google Scholar] [CrossRef] [PubMed]
- Scholz, T.; Kuchta, R.; Brabec, J. Broad tapeworms (Diphyllobothriidae), parasites of wildlife and humans: Recent progress and future challenges. Int. J. Parasitol. Parasites Wildl. 2019, 9, 359–369. [Google Scholar] [CrossRef]
- Čisovská Bazsalovicsová, E.; Radačovská, A.; Lavikainen, A.; Kuchta, R.; Králová-Hromadová, I. Genetic interrelationships of Spirometra erinaceieuropaei (Cestoda: Diphyllobothriidea), the causative agent of sparganosis in Europe. Parasite 2022, 29, 8. [Google Scholar] [CrossRef]
- Eberhard, M.L.; Thiele, E.A.; Yembo, G.E.; Yibi, M.S.; Cama, V.A.; Ruiz-Tiben, E. Thirty-seven human cases of sparganosis from Ethiopia and South Sudan caused by Spirometra spp. Am. J. Trop. Med. Hyg. 2015, 93, 350–355. [Google Scholar] [CrossRef]
- Kuchta, R.; Kołodziej-Sobocińska, M.; Brabec, J.; Młocicki, D.; Sałamatin, R.; Scholz, T. Sparganosis (Spirometra) in Europe in the Molecular Era. Clin. Infect. Dis. 2021, 72, 882–890. [Google Scholar] [CrossRef]
- Okino, T.; Yamasaki, H.; Yamamoto, Y.; Fukuma, Y.; Kurebayashi, J.; Sanuki, F.; Moriya, T.; Ushirogawa, H.; Saito, M. A case of human breast sparganosis diagnosed as Spirometra Type I by molecular analysis in Japan. Parasitol. Int. 2021, 84, 102383. [Google Scholar] [CrossRef]
- Fredes, F.; Mercado, R.; Salas, I.P.; Sugiyama, H.; Kobayashi, H.; Yamasaki, H. Morphological observation and molecular phylogeny of Spirometra decipiens complex 1 (Cestoda: Diphyllobothriidae) found in cat from Chile. Parasitol. Int. 2022, 87, 102493. [Google Scholar] [CrossRef]
- Jeon, H.K.; Park, H.; Lee, D.; Choe, S.; Sohn, W.M.; Eom, K.S. Molecular Detection of Spirometra decipiens in the United States. Korean J. Parasitol. 2016, 54, 503–507. [Google Scholar] [CrossRef] [PubMed]
- Stiles, C.W. The occurrence of a proliferating cestode larva (Sparganum proliferum) in man in Florida. Hyg. Lab. Bull. 1908, 40, 7–18. [Google Scholar]
- Arrabal, J.P.; Pérez, M.G.; Arce, L.F.; Kamenetzky, L. First identification and molecular phylogeny of Sparganum proliferum from endangered felid (Panthera onca) and other wild definitive hosts in one of the regions with highest worldwide biodiversity. Int. J. Parasitol. Parasites Wildl. 2020, 13, 142–149. [Google Scholar] [CrossRef] [PubMed]
- Jeon, H.K.; Kim, K.H.; Sohn, W.M.; Eom, K.S. Differential Diagnosis of Human Sparganosis Using Multiplex PCR. Korean J. Parasitol. 2018, 56, 295–300. [Google Scholar] [CrossRef]
- Kourí Esmeja, P.; Basnuevo Artiles, J.G.; Sotolongo Guerra, F.; de Parasitología, M. Helmintología Humana. Tomo 1. Emp. Consol; Artes Gráficas: La Habana, Cuba, 1963. [Google Scholar]
- Ramírez, E.; Capó de Paz, V.; Alonso Fiel, A. Human Sparganosis: First Case Reported in Cuba. Rev. Ibér Parasitol. 1989, 49, 147–149. Available online: https://bibliotecavirtual.ranf.com/es/catalogo_imagenes/grupo.do?path=1001332 (accessed on 23 April 2021).
- Fernández Albán, M.; García Maeso, I.; Figueredo Méndez, J. Resección estereotáctica de una larva viva de Sparganum mansonis en Cuba. Presentación de un caso. Rev. Mex Neuroci. 2009, 10, 49–52. Available online: https://www.medigraphic.com/pdfs/revmexneu/rmn-2009/rmn091h.pdf (accessed on 23 April 2021).
- Caballero, J.; Morales, I.; García, D.; Alarcón, I.; Torres, A.; Sáez, G. Aspiración estereotáctica de una larva de Spirometra spp. Rev. Chil. Infectol 2015, 32, 453–456. [Google Scholar] [CrossRef]
- Marty, A.M.; Neafie, R.C. Diphyllobothriasis and sparganosis. In Pathology of Infectious Diseases; Meyers, W.M., Ed.; Helminthiases; Armed Forces Institute of Pathology: Washington, DC, USA, 2000; Volume 1, pp. 165–183. [Google Scholar]
- Diesing, K.M. Über eine naturgemässe Vertheilung der Cephalocotyleen. Sitzungsber. K. Akad. Wissenschaft. Wien Mat-Naturwissenschaft. Classe 1854, 13, 556–616. [Google Scholar]
- Cobbold, T.S. Description of Ligula mansoni, a new human cestode. J. Linn. Soc. Lond. Zool. 1883, 17, 78–83. [Google Scholar] [CrossRef]
- Jeon, H.K.; Park, H.; Lee, D.; Choe, S.; Kang, Y.; Bia, M.M.; Lee, S.H.; Sohn, W.M.; Hong, S.J.; Chai, J.Y.; et al. Genetic and Morphologic Identification of Spirometra ranarum in Myanmar. Korean J. Parasitol 2018, 56, 275–280. [Google Scholar] [CrossRef]
- Jeon, H.K.; Park, H.; Lee, D.; Choe, S.; Kim, K.H.; Huh, S.; Sohn, W.M.; Chai, J.Y.; Eom, K.S. Human Infections with Spirometra decipiens Plerocercoids Identified by Morphologic and Genetic Analyses in Korea. Korean J. Parasitol. 2015, 53, 299–305. [Google Scholar] [CrossRef] [PubMed]



| Spirometra Species Analyzed in This Study | Species-Specific Primers Gene Cob (5′-3′) | Amplicon Detection Gene Cob (bp) | Species-Specific Primers Gene Cox 1 (5′-3′) | Amplicon Detection Gene Cox 1 (bp) |
|---|---|---|---|---|
| S. decipiens | ID:24145860 Forward Se/Sd-1800F (AGTTATTTTCGGTTGGTGCTGTAG) Reverse Sd-2317R (TCCTCCCCCCACACGACAAAA) | 540 | ID:24145870 Forward Se/Sd-7955F (ACGTGGTTTGTGGTGGCTCATTTT) Reverse Sd-8567R (TTATTAACTTCCTAACCAACTTGATAC) | 644 |
| S. erinaceieuropaei | ID: 6446563 Forward Se/Sd-1800F (AGTTATTTTCGGTTGGTGCTGTAG) Reverse Se2018R (CCACAAACCCAATAACAAACTA) | 239 | ID: 6446566 Forward Se/Sd-7955F (ACGTGGTTTGTGGTGGCTCATTTT) Reverse Se-8356R (ATGATAGGGTATAGGTGACCA) | 401 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Morales, A.; Laird-Pérez, R.M.; Capó, V.; Iglesias, E.; Fonte, L.; Plascencia-Hernández, A.; Calderón, E.J.; Eom, K.S.; de Armas, Y.; Pérez-Gómez, H.R. Genetic and Morphological Identification of Spirometra decipiens in Snakes and Domestic Dog Found in Cuba. Pathogens 2022, 11, 1468. https://doi.org/10.3390/pathogens11121468
Morales A, Laird-Pérez RM, Capó V, Iglesias E, Fonte L, Plascencia-Hernández A, Calderón EJ, Eom KS, de Armas Y, Pérez-Gómez HR. Genetic and Morphological Identification of Spirometra decipiens in Snakes and Domestic Dog Found in Cuba. Pathogens. 2022; 11(12):1468. https://doi.org/10.3390/pathogens11121468
Chicago/Turabian StyleMorales, Alexander, Rebeca M. Laird-Pérez, Virginia Capó, Enrique Iglesias, Luis Fonte, Arturo Plascencia-Hernández, Enrique J. Calderón, Keeseon S. Eom, Yaxsier de Armas, and Héctor R. Pérez-Gómez. 2022. "Genetic and Morphological Identification of Spirometra decipiens in Snakes and Domestic Dog Found in Cuba" Pathogens 11, no. 12: 1468. https://doi.org/10.3390/pathogens11121468
APA StyleMorales, A., Laird-Pérez, R. M., Capó, V., Iglesias, E., Fonte, L., Plascencia-Hernández, A., Calderón, E. J., Eom, K. S., de Armas, Y., & Pérez-Gómez, H. R. (2022). Genetic and Morphological Identification of Spirometra decipiens in Snakes and Domestic Dog Found in Cuba. Pathogens, 11(12), 1468. https://doi.org/10.3390/pathogens11121468

