Next Article in Journal
Entomo-Virological Aedes aegypti Surveillance Applied for Prediction of Dengue Transmission: A Spatio-Temporal Modeling Study
Previous Article in Journal
The Biocontrol Potential of Endophytic Trichoderma Fungi Isolated from Hungarian Grapevines, Part II, Grapevine Stimulation
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Indirect Evidence Based on Mating-Type Ratios for the Role of Sexual Reproduction in European and Chinese Populations of Plenodomus biglobosus (Blackleg of Oilseed Rape)

1
Rothamsted Research, Harpenden AL5 2JQ, UK
2
Huazong Agricultural University, Wuhan 430070, China
*
Author to whom correspondence should be addressed.
Pathogens 2023, 12(1), 3; https://doi.org/10.3390/pathogens12010003
Submission received: 18 October 2022 / Revised: 7 December 2022 / Accepted: 12 December 2022 / Published: 20 December 2022
(This article belongs to the Section Fungal Pathogens)

Abstract

Blackleg (Phoma) disease, caused by the ascomycete fungi Plenodomus biglobosus and P. lingam, threatens oilseed rape (OSR; Brassica napus) crops internationally. In many parts of the world, both species co-occur, but in China only P. biglobosus has so far been reported. Plenodomus biglobosus reproduces asexually (pycnidiospores), but also sexually (pseudothecia-yielding ascospores), via a heterothallic mating system requiring MAT1-1 and MAT1-2 genotypes. However, the roles of airborne ascospore inoculum in driving blackleg disease outbreaks in China are less well understood compared to elsewhere in the world. This is despite the very different agronomic cropping practices in parts of China, in which paddy rice and OSR are often grown in rotation; OSR stubble is often submerged under water for long periods potentially affecting pseudothecial development. Here, we indirectly investigate the potential role of sexual reproduction by developing new polymerase chain reaction (PCR) -based mating-type diagnostics for P. biglobosus and subsequently screening an international collection of 59 European and 157 Chinese isolates. Overall, in both Europe and China, P. biglobosus mating types did not deviate from a 1:1 ratio, such as is generally thought to occur under frequency-dependent selection in sexually reproducing pathogen populations. Both mating types were balanced in all the individual European countries tested (Austria, France, Poland, UK). Conversely, in China, mating types were only balanced in the eastern region; in the northern and southwestern regions there were skewed ratios, more typical of predominantly asexual reproduction, towards MAT1-1 and MAT1-2, respectively. The implications of these findings and future research directions for improved understanding of P. biglobosus epidemiology on OSR, particularly in China, are considered.

1. Introduction

Blackleg (also Phoma stem canker, Phoma leaf spot) is an internationally important disease of oilseed rape (OSR; Brassica napus L.) and other Brassica spp., annually causing substantial yield losses in the major growing regions of Australia, Europe and North America [1,2]. Two related fungal pathogen species have been widely identified as the causal agents of the disease in OSR. The first is Plenodomus lingam, (Tode:Fr) Desmaz. (formerly Leptosphaeria maculans (Desmaz.) Ces. and De Not.), previously referred to as ‘Tox+’, ‘A-group’, ‘sirodesmin positive’ and ‘aggressive’. The second species is Plenodomus biglobosus (Shoemaker and H. Brun), Gruyter, Aveskamp and Verkley (formerly Leptosphaeria biglobosa Shoemaker and H. Brun), and previously referred to as ‘Tox0’, ‘B-group’, ‘sirodesmin negative’ and ‘non-aggressive’ [3,4]. Seven genetically distinct P. biglobosus ‘subclades’ have so far been identified (subclades ‘americensis’, ‘australensis’, ‘brassicae’, ‘canadensis’, ‘erysimii’, ‘occiaustralensis’ and ‘thlaspii’) [3,5,6], with the ‘brassicae’ and ‘canadensis’ subclades being the most geographically widespread on an international scale and the only subclades detected so far on the Brassica species in Europe and China [3,7,8,9]. While P. biglobosus and P. lingam are by far the more internationally important Phoma pathogens in OSR [2], a third species named Plenodomus dezfulensis, Mehrabi-Koushki, Safi and Farokhinejad, has also very recently been described in OSR [10] that is more closely related to P. biglobosus, but this new species has so far been isolated very infrequently from only a few very diseased leaves in Iran. Lastly, an additional species, Plenodomus wasabiae, Yokogi ex J.F. White and P.V. Reddy (basionym Phoma wasabiae Yokogi), has also been reported on wasabi (Eutrema japonicum (Miq.) Koidz.), but ITS sequence analyses indicate that this species does in fact share 100% identity with the P. biglobosus subclade ‘occiaustralensis’ [4,11]. In this study, for clarity, the names P. biglobosus (and its constituent seven genetic subclades) and P. lingam will be used [4], along with the recently described species P. dezfulensis [10] that will also occasionally be referred to.
Both P. biglobosus and P. lingam are currently known to co-occur in many parts of the world, including in OSR crops in Australia, Canada and Europe [2]. However, to date, only P. biglobosus has so far been identified in China and there are concerns that accidental introduction and spread of P. lingam in China might in future occur and potentially threaten the ca. 7M Ha of winter OSR grown in central and southern China and the ca. 1M Ha of spring OSR grown in northern China [12]. Plenodomus lingam is often associated with more damaging lower stem (crown cankers) lesions while P. biglobosus is more often linked to the less damaging upper stem lesions [2], although there are data to suggest that both species can be obtained from upper and basal stem lesions [13] and there is evidence that P. biglobosus can sometimes cause considerable yield losses in OSR crops including in both Europe and China [7,8,14,15,16].
Blackleg pathogen inocula are known to reproduce via asexually produced splash-dispersed pycnidiospores and/or sexually derived airborne ascospores, with the relative importance of each appearing to vary by geographical location such as in Europe (mostly ascospores), Australia (mainly ascospores, also pycnidiospores) and western Canada (mostly pycnidiospores) [13,17,18]. The relative importance of each inoculum type remains unclear in some other parts of the world, including China. Studies investigating the patterns of P. lingam and P. biglobosus ascospore release, by applying species-specific quantitative polymerase chain reaction (qPCR) assays to air samples, have so far been conducted mostly in Europe [19,20,21,22]. Similar work is now required to investigate the potential role of airborne ascospore production of each of the species in blackleg epidemics in other countries in which blackleg is problematic. Both P. lingam and P. biglobosus are known to have heterothallic sexual cycles yielding pseudothecia and ascospores, requiring both MAT1-1 and MAT1-2 genotypes in order to occur. In sexually reproducing pathogen populations, 1:1 ratios of such mating types are typical under such frequency-dependent selection [23], and thus mating-type ratios can potentially be useful as an indirect measure to infer the importance of sexual reproduction. A mating-type-specific multiplex PCR diagnostic for P. lingam was developed by Cozijnsen and Howlett (2003) [24], but this assay does not work for isolates of P. biglobosus [6]. The use of this diagnostic has shown balanced mating-type ratios in some P. lingam populations from Australia [25], France [26] and Idaho in the US [27], but not in others including Mexico [28] and New Zealand [29]. In contrast, for P. biglobosus, only one molecular study investigating mating type has so far been conducted. Voight et al. (2005) [30] screened 18 international P. biglobosus isolates and a fragment of the MAT1-2 locus was amplified from 12, while additional PCR testing amplified a fragment of what may have been from the MAT1-1 locus from an additional 2. An examination of mating-type distributions of P. biglobosus isolates on an international scale is now required to indirectly investigate the role of sexual reproduction in different geographic regions, especially in parts of the world where only this species is known to occur, such as China [7,8,16].
The main aim of this study is to improve blackleg disease management through better understanding of P. biglobosus population genetics and epidemiology. Thus, we here describe the development of new mating-type diagnostics capable of discriminating between MAT1-1 and MAT1-2 isolates of P. biglobosus. We then apply these new diagnostics to explore mating-type ratios in P. biglobosus populations from Europe and China to indirectly investigate the role of sexual reproduction in these pathogen populations.

2. Materials and Methods

2.1. Fungal Isolates and DNA Extraction

An international collection of P. biglobosus isolates from across Europe and China was assembled from two sources. The first, from the Oilseed Rape Enhanced Genetic Improvement Network (OREGIN; www.herts.ac.uk/oregin; accessed on 7 December 2022 [31]), comprised 109 P. biglobosus isolates in total, with 50 from China (all from OSR stems; 2 collected in 1999; 48 collected in 2005/2006) and a further 59 from Europe (all from OSR; mostly from stems but occasionally leaf lesions; collected over many years). The identity of all these isolates had previously been confirmed as P. biglobosus using species-specific PCR diagnostics [7]. The second, the Huazong culture collection, comprised 107 P. biglobosus isolates (species identities again confirmed using species-specific PCR) in total, collected from OSR and B. rapa between 2018/2019. Thus, in total, 216 P. biglobosus isolates were used in the present study, with details as described in Table 1. DNA extraction from the OREGIN collection was as described in Liu et al. (2014) [7], after which genomic DNA was quantified by nanodrop and diluted to 10 ng/μL.

2.2. Design of New Plenodomus biglobosus Mating-Type PCR Diagnostics

Attempts to apply the multiplex mating-type diagnostic assay, Cozijnsen and Howlett (2003), designed for closely related P. lingam to a range of isolates of P. biglobosus were unsuccessful [24]. New MAT1-1-specific PCR primers were designed based on MAT1-1 idiomorph sequence data downloaded from the available P. biglobosus genome (European Nucleotide Archive (ENA): PRJEB24467; [32]); primers PbMAT1F (5′ TGAAGTTGGCCGCTTCCTC 3′) and PbMAT1R (5′ CTGAGGCGGCATTGGGGTC 3′) were targeted to a 640bp fragment of the MAT1-1 idiomorph. New MAT1-2-specific primers for P. biglobosus were targeted to MAT1-2 idiomorph sequence and were designed based on sequence data retrieved from GenBank (AY748930, AY748939); primers PbMAT2F (5′ GAGTCGGAGAAGAAGCCCTG 3′) and PbMAT2R (5′ ATTCCGGCTTCGAACTCCTC 3′) were targeted to a 416bp fragment of the MAT1-2 idiomorph.

2.3. Validation of New Plenodomus biglobosus PCR Mating-Type Diagnostics

Seven Plenodumus spp. isolates were used for initial validation of the new mating-type diagnostics designed in this study. These included two isolates of P. biglobosus ‘brassicae’ (KO8 from Iran; 21WAS8-4 from the UK) and two isolates of P. biglobosus ‘canadensis’ (21WAS1-2 and 21WAS7-1, both from the UK); isolate, species and subclade identities had previously been confirmed based on at least ITS sequences [9,33]. An isolate of the closely related P. dezfulensis (SCUA-Ahm-S41, Iran) [10] was also tested. Furthermore, two P. lingam isolates were tested from the OREGIN collection that had previously been molecularly characterised, using the P. lingam mating-type diagnostic of Cozijnsen and Howlett (2003) [24], as either a MAT1-1 (IBCN80, from Canada) or MAT1-2 (WAC4057, from Australia) genotype.
Each PCR was performed in 12.5 μL volume containing 0.1 μL each of forward and reverse primer (each at 0.16 μM final reaction concentration), 6.25 μL of 2× RedTaq ReadyMix (1× final concentration; Sigma-Aldrich, UK), 5.05 μL of PCR grade water and 1 μL of genomic DNA (10 ng total). Reaction conditions were 35 cycles of 94 °C for 1 min, either 62 °C (for primer pair PbMAT1F/R) or 60 °C (for primer pair PbMAT2F/R) for 1 min and 72 °C for 1 min, with a final extension of 72 °C for 5 min. PCR amplicons (8 μL) were resolved on 2% agarose gels containing GelRed and viewed under UV light. PCR amplicon sizes were subsequently purified using a MinElute PCR purification kit (Qiagen, Germany) and sent to MWG Eurofin (Germany) for bidirectional sequencing.

2.4. PCR Testing of European and Chinese Plenodomus biglobosus Isolates for Mating Type

Two hundred and sixteen P. biglobosus isolates from Europe and China were subsequently screened for mating type using the newly developed diagnostic assays as previously described (Table 1). The hypotheses of 1:1 ratios of mating types (within individual countries/regions and overall) were tested statistically using a X2 test (GraphPad Prism 9 Software, San Diego, CA, USA).

3. Results

3.1. Validation of New Plenodomus biglobosus Mating-Type Diagnostics

Initial PCR testing showed that putative MAT1-1 amplicons of the expected ~640 bp size were successfully amplified using primers PbMAT1F/R from the P. biglobosus isolates KO8 (subclade ‘brassicae’) and 21WAS1-2 (subclade ‘canadensis’) (Figure 1A). No amplicons were obtained for either of the P. lingam isolates tested (including the MAT1-1 isolate IBCN80) nor for the P. dezfulensis isolate SCUA-Ahm-S41. Bidirectional sequencing of isolates KO8 and 21WAS1-2 yielded partial sequences of 572bp; BLAST analyses confirmed the closest GenBank hits (75.7–76.5% identity) to be a region of the MAT1-1 gene of P. lingam (Accession AY174048). The MAT1-1 gene sequences obtained in this study for isolates KO8 and 21WAS1-2 shared 97.9% identity with each other, and have been deposited onto GenBank (Accessions OP555983 and OP555984, respectively).
Further PCR testing revealed that putative MAT1-2 products of the expected ~416 bp size were, however, instead successfully amplified with primers PbMAT2F/R from P. biglobosus isolates 21WAS8-4 (subclade ‘brassicae’) and 21WAS7-1 (subclade ‘canadensis’) and also from the P. dezfulensis isolate SCUA-Ahm-S41 (Figure 1B). No amplicons were obtained for either of the P. lingam isolates tested (including the MAT1-2 isolate WAC4057). Bidirectional sequencing of the amplicons yielded partial sequences of 382bp. BLAST analyses showed that sequences obtained from the P. biglobosus isolates 21WAS8-4 and 21WAS7-1 showed 100% identities to GenBank MAT1-2 gene sequences of the P. biglobosus subclades ‘brassicae’ (Accession AY748934) or ‘canadensis’ (Accession AY748940), respectively. The MAT1-2 gene sequences newly obtained in this study for isolates 21WAS8-4 and 21WAS7-1 showed 95.8% identity and have been deposited onto GenBank (Accessions OP555985 and OP555986, respectively). Lastly, the sequence obtained from P. dezfulensis isolate SCUA-Ahm-S41 shared a higher identity with the partial MAT1-2 sequence of the P. biglobosus isolate 21WAS7-1 (97.4%) than isolate 21WAS8-4 (96.3%). The partial MAT1-2 gene sequence of the P. dezfulensis isolate SCUA-Ahm-S41 has been deposited onto GenBank (Accession OP555987).

3.2. PCR Screening of European and Chinese P. biglobosus Isolates for Mating Type

All 216 of the European and Chinese P. biglobosus isolates tested could be assigned to either the MAT1-1 or MAT1-2 genotype (Table 1). Screening with primers PbMAT1R/F yielded the expected ~640 bp amplicon for MAT1-1 isolates, whereas the use of primers PbMAT2F/R gave the predicted ~416 bp product for MAT1-2 isolates. An additional six Canadian P. biglobosus isolates were also tested and were identified as either a MAT1-1 or MAT1-2 genotype, demonstrating the robustness of the developed diagnostics to P. biglobosus isolates from other geographic regions.
For the 59 European isolates tested, no statistically significant departure from a 1:1 ratio of MAT1-1:MAT1-2 types was found, such being the case for each of the individual French, Polish and UK populations screened. Five Austrian isolates were also tested, with both MAT types again present, but this sample could not be analysed statistically due to small sample numbers. For the remaining 157 Chinese isolates tested, when all data were combined, no evidence was obtained for a departure from a 1:1 ratio of MAT1-1:MAT1-2 types. However, it should be noted that upon inspection of underlying data supporting this headline result, two of the three Chinese regions had ratios that were significantly different from a 1:1 mating-type ratio (p < 0.01). Thus, although the eastern region had a balanced mating-type ratio, the northern and southwestern regions were heavily skewed towards MAT1-1 and MAT1-2 type isolates, respectively.

4. Discussion

In this study, new PCR-based diagnostics were successfully developed to discriminate between MAT1-1 and MAT1-2 genotypes of P. biglobosus. The diagnostics were validated by screening against P. biglobosus subclades ‘brassicae’ and ‘canadensis’, the two most geographically widespread subclades on an international scale, and the only ones reported to date on Brassica species in Europe and China. The wider applicability of the new MAT1-2 diagnostic was further demonstrated by its successful application to P. dezfulensis, a recently described species that is very closely related to the P. biglobosus subclades [10]. It is noted that the new P. biglobosus mating-type diagnostics described here do not work for the more distantly related P. lingam, but the latter species’ mating-type diagnostics were previously developed by Cozijnsen and Howlett (2003) [24].
The new P. biglobosus mating-type diagnostics were subsequently applied to European and Chinese isolates of this species. For the China dataset, no evidence for deviation from a 1:1 mating-type ratio was found in combined data from the three geographic regions tested (east, north, southwest). Similar results supporting a 1:1 ratio were also obtained in the European dataset, based on combined mating-type data from four countries (Austria, France, Poland, UK). Thus, these combined data provide indirect evidence for the role of sexual reproduction in P. biglobosus in Europe, as previously supported by air spore trapping studies [19,20,21,22], and also in China, although there such air trapping studies do not to the authors’ knowledge appear to have been conducted. This is also consistent with the genetic diversity previously detected in European and Chinese P. biglobosus populations [7,8], a feature consistent with regular sexual reproduction [23].
Despite this overall result, however, closer inspection of the Chinese mating-type dataset revealed that, of the three individual regions examined, only the eastern region exhibited a 1:1 distribution. In contrast, skewed distributions that deviated significantly from a 1:1 ratio were observed in both the northern region (91% MAT1-1) and southwest region (64% MAT1-2). In contrast, for the European mating-type dataset, no evidence for a departure from a 1:1 distribution was obtained in any of the individual countries tested. Skewed mating-type distributions, such as those observed in the northern and southwestern regions of China in this study, are more typical of asexual (clonally) reproducing populations. Previous work by West et al. (2000) [34] investigated sexual reproduction using blackleg-diseased OSR stubble (that was incubated for three months under natural conditions), collected from three different sites in China. Sexual reproduction, with pseudothecia-yielding ascospores, was confirmed from stubble collected from Guizhou (southwestern region) and Anhui (eastern region), but not from Hubei (southwestern region). One hypothesis is that the stubble of West et al. (2000) [34] collected from Hubei contained only a single mating type, thus precluding completion of the sexual cycle.
Further study is now required to explore the extent to which sexually produced ascospores drive blackleg outbreaks in China, especially since the relative importance of ascospore inoculum appears to vary between other major OSR-growing regions (Australia, Canada and Europe) of the world [1,17,18]. Although combined mating-type data from throughout China obtained in this study overall provide indirect evidence for the role of sexual cycles there, data from individual regions suggest that asexual reproduction may predominate in some locations. Although it is acknowledged that the P. biglobosus isolates used in this study were not sampled in a systematic way, nor were the resulting dataset’s clones corrected, many of the European and Chinese OREGIN collection isolates tested here had previously been analysed via AFLP and found to be genetically distinct [7]. More comprehensive investigations, using the P. biglobosus mating-type-specific diagnostics developed here, are now required to investigate mating-type distributions at different spatial scales (i.e., continent, region, field, leaf, lesion), and such work should incorporate these factors into their design.
Future work should additionally focus on the quantification of P. biglobosus airborne inocula at different locations in China through air spore trapping in conjunction with species-specific qPCR. As previously discussed, such studies have been conducted in Europe but not, to the authors’ knowledge, yet in China. It is possible that sexual reproduction may occur less frequently in some Chinese P. biglobosus populations compared to other populations in the world, due to the major importance of OSR and flooded paddy rice (Oryza sativa) crop rotations there. This is because in such agricultural systems, blackleg-diseased crop debris is often submerged under water for extended periods of time, and there is evidence that the flooding of infected debris for even relatively short time periods (10 days) may inhibit ascospore production and release [35]. Understanding the extent to which sexual reproduction might be occurring in the field for Chinese P. biglobosus populations could provide novel insights, for instance into inoculum dispersal and the evolutionary potential of the population there [23], that could be used to inform blackleg disease management strategies.

Author Contributions

Conceptualisation, Formal Analysis, Investigation, Data Curation and Writing—Original Draft and Presentation: K.M.K.; Methodology and Validation: K.M.K., G.C., K.Z. and Z.L.; Resources and Supervision: K.M.K., M.W. and J.S.W.; Writing—Review and Editing: J.S.W.; Funding Acquisition: K.M.K. and J.S.W. All authors have read and agreed to the published version of the manuscript.

Funding

Work at Rothamsted Research (UK) was partly supported by the Biotechnology and Biological Sciences Research Council’s Industrial Strategy Challenge Fund, Smart Crop Protection strategic programme (BBS/OS/CP/000001).

Data Availability Statement

The data that support the findings of this study are available from the corresponding author (K.M.K.) upon reasonable request.

Acknowledgments

The authors wish to thank all those who contributed P. biglobosus isolates to the OREGIN culture collection over many years, and Defra for financial support.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. West, J.S.; Kharbanda, P.D.; Barbetti, M.J.; Fitt, B.D.L. Epidemiology and management of Leptosphaeria maculans (phoma stem canker) on oilseed rape in Australia, Canada and Europe. Plant Pathol. 2001, 50, 10–27. [Google Scholar] [CrossRef] [Scilit]
  2. Fitt, B.D.L.; Brun, H.; Barbetti, M.J.; Rimmer, S.R. World-wide importance of phoma stem canker (Leptosphaeria maculans and L. biglobosa) on oilseed rape (Brassica napus). Eur. J. Plant Pathol. 2006, 114, 3–15. [Google Scholar] [CrossRef] [Scilit]
  3. Mendes-Pereira, E.; Balesdent, M.-H.; Brun, H.; Rouxel, T. Molecular phylogeny of the Leptosphaeria maculansL. biglobosa species complex. Mycol. Res. 2003, 107, 1287–1304. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. de Gruyter, J.; Woudenberg, J.H.C.; Aveskamp, M.M.; Verkley, G.J.M.; Groenewald, J.Z.; Crous, P.W. Redisposition of Phoma-like anamorphs in Pleosporales. Stud. Mycol. 2013, 75, 1–36. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Vincenot, L.; Balesdent, M.H.; Li, H.; Barbetti, M.J.; Sivasithamparam, K.; Gout, L.; Rouxel, T. Occurrence of a new subclade of Leptosphaeria biglobosa in Western Australia. Phytopathology 2008, 98, 321–329. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Zou, Z.; Zhang, X.; Parks, P.; du Toit, L.J.; Van de Wouw, A.P.; Dilantha Fernando, W.G. A new subclade of Leptosphaeria biglobosa identified from Brassica rapa. Int. J. Mol. Sci. 2019, 20, 1668. [Google Scholar] [CrossRef] [Scilit]
  7. Liu, Z.; Latunde-Dada, A.O.; Hall, A.M.; Fitt, B.D.L. Phoma stem canker disease on oilseed rape (Brassica napus) in China is caused by Leptosphaeria biglobosa ‘brassicae’. Eur. J. Plant Pathol. 2014, 140, 841–857. [Google Scholar] [CrossRef] [Scilit]
  8. Hao, L.; Song, P.; Huangfu, H.; Li, Z. Genetic diversity and differentiation of Leptosphaeria biglobosa on oilseed rape in China. Phytoparasitica 2015, 43, 253–263. [Google Scholar] [CrossRef] [Scilit]
  9. King, K.M.; West, J.S. Detection of the Phoma pathogens Plenodomus biglobosus subclades ‘brassicae’ and ‘canadensis’ on wasabi, and ‘canadensis’ in Europe. Eur. J. Plant Pathol. 2022, 162, 751–756. [Google Scholar] [CrossRef] [Scilit]
  10. Safi, A.; Mehrabi-Koushki, M.; Farokhinejad, R. Plenodomus dezfulensis sp. nov. causing leaf spot of rapeseed in Iran. Phytotaxa 2021, 523, 141–154. [Google Scholar] [CrossRef] [Scilit]
  11. Punja, Z.K.; Chandanie, W.A.; Chen, X.; Rodríguez, G. Phoma leaf spot of wasabi (Wasabia japonica) caused by Leptosphaeria biglobosa. Plant Pathol. 2017, 66, 480–489. [Google Scholar] [CrossRef] [Scilit]
  12. Fitt, B.D.L.; Hu, B.C.; Li, Z.Q.; Liu, S.Y.; Lange, R.M.; Kharbanda, P.D.; Butterworth, M.H.; White, R.P. Strategies to prevent spread of Leptosphaeria maculans (phoma stem canker) onto oilseed rape crops in China; costs and benefits. Plant Pathol. 2008, 57, 652–664. [Google Scholar] [CrossRef] [Scilit]
  13. West, J.S.; Balesdent, M.-H.; Rouxel, T.; Narcy, J.P.; Huang, Y.J.; Roux, J.; Steed, J.M.; Fitt, B.D.L.; Schmit, J. Colonization of winter oilseed rape tissues by A/Tox+ and B/Tox0 Leptosphaeria maculans (phoma stem canker) in France and England. Plant Pathol. 2002, 51, 311–321. [Google Scholar] [CrossRef] [Scilit]
  14. Li, Q.; Rong, S.; Hu, B.; Jiang, Y.; Hou, S.; Fei, W.; Chen, F.; Wu, X.; Fan, Z.; Lei, W. Distribution of blackleg disease on oilseed rape in China and its pathogen identification. Chin. J. Oil Crop Sci. 2013, 35, 415–423. Available online: http://www.jouroilcrops.cn/EN/Y2013/V35/I4/415 (accessed on 7 December 2022).
  15. Huang, Y.J.; Karandeni-Dewage, C.S.; Fitt, B.D.L. Importance of Leptosphaeria biglobosa as a cause of phoma stem canker on winter oilseed rape in the UK. Asp. Appl. Biol. 2014, 127, 117–122. [Google Scholar]
  16. Zhang, X.; White, R.P.; Demir, E.; Jedryczka, M.; Lange, R.M.; Islam, M.; Li, Z.Q.; Huang, Y.J.; Hall, A.M.; Zhou, G.; et al. Leptosphaeria spp., phoma stem canker and potential spread of L. maculans on oilseed rape crops in China. Plant Pathol. 2014, 63, 598–612. [Google Scholar] [CrossRef] [Scilit]
  17. Dilmaghani, A.; Gladieux, P.; Gout, L.; Giraud, T.; Brunner, P.C.; Stachowiak, A.; Balesdent, M.-H.; Rouxel, T. Migration patterns and changes in population biology associated with the worldwide spread of the oilseed rape pathogen Leptosphaeria maculans. Mol. Ecol. 2012, 21, 2519–2533. [Google Scholar] [CrossRef] [Scilit]
  18. Zhang, X.; Dilantha Fernando, W.G. Insights into fighting against blackleg disease of Brassica napus in Canada. Crop Pasture Sci. 2018, 69, 40–47. [Google Scholar] [CrossRef] [Scilit]
  19. Huang, Y.J.; Fitt, B.D.L.; Jedryczka, M.; Dakowska, S.; West, J.S.; Gladders, P.; Steed, J.M.; Li, Z.Q. Patterns of ascospore release in relation to phoma stem canker epidemiology in England (Leptosphaeria maculans) and Poland (Leptosphaeria biglobosa). Eur. J. Plant Pathol. 2005, 111, 263–277. [Google Scholar] [CrossRef] [Scilit]
  20. Stonard, J.F.; Marchant, B.P.; Latunde-Dada, A.O.; Liu, Z.; Evans, N.; Gladders, P.; Eckert, M.R.; Fitt, B.D.L. Geostatistical analysis of the distribution of Leptosphaeria species causing phoma stem canker on winter oilseed rape (Brassica napus) in England. Plant Pathol. 2010, 59, 200–210. [Google Scholar] [CrossRef] [Scilit]
  21. Dawidziuk, A.; Kaczmarek, J.; Jedryczka, M. The effect of winter weather conditions on the ability of pseudothecia of Leptosphaeria maculans and L. biglobosa to release ascospores. Eur. J. Plant Pathol. 2012, 134, 329–343. [Google Scholar] [CrossRef] [Scilit]
  22. Kaczmarek, J.; Jedryczka, M.; Cools, H.J.; Fitt, B.D.; Lucas, J.A.; Latunde-Dada, A.O. Quantitative PCR analysis of abundance of airborne propagules of Leptosphaeria species in air samples from different regions of Poland. Aerobiologia 2012, 28, 199–212. [Google Scholar] [CrossRef] [Scilit]
  23. McDonald, B.A.; Linde, C. Pathogen population genetics, evolutionary potential, and durable resistance. Annu. Rev. Phytopathol. 2002, 40, 349–379. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Cozijnsen, A.J.; Howlett, B.J. Characterisation of the mating-type locus of the plant pathogenic ascomycete Leptosphaeria maculans. Curr. Genet. 2003, 43, 351–357. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Barrins, J.M.; Ades, P.K.; Salisbury, P.A.; Howlett, B.J. Genetic diversity of Australian isolates of Leptosphaeria maculans, the fungus that causes blackleg of canola (Brassica napus). Australas. Plant Pathol. 2004, 33, 529–536. [Google Scholar] [CrossRef] [Scilit]
  26. Gout, L.; Eckert, M.; Rouxel, T.; Balesdent, M.H. Genetic variability and distribution of mating type alleles in field populations of Leptosphaeria maculans from France. Appl. Environ. Microbiol. 2006, 72, 185–191. [Google Scholar] [CrossRef] [Scilit]
  27. Pickard, J.E. Investigating the Distribution and Diversity of Leptosphaeria maculans in Northern Idaho. Master’s Thesis, University of Idaho, Moscow, ID, USA, December 2018. [Google Scholar]
  28. Dilmaghani, A.; Gout, L.; Moreno-Rico, O.; Dias, J.S.; Coudard, L.; Castillo-Torres, N.; Balesdent, M.-H.; Rouxel, T. Clonal populations of Leptosphaeria maculans contaminating cabbage in Mexico. Plant Pathol. 2013, 62, 520–532. [Google Scholar] [CrossRef] [Scilit]
  29. Lob, S. Leptosphaeria diseases of oilseed rape and swede: Identification and epidemiology, Doctoral thesis, Lincoln University, Canterbury, New Zealand. 2014. Available online: https://hdl.handle.net/10182/6592 (accessed on 7 December 2022).
  30. Voigt, K.; Cozijnsen, A.J.; Kroymann, J.; Pöggeler, S.; Howlett, B.J. Phylogenetic relationships between members of the crucifer pathogenic Leptosphaeria maculans species complex as shown by mating type (MAT1-2), actin, and β-tubulin sequences. Mol. Phylogenet. Evol. 2005, 37, 541–557. [Google Scholar] [CrossRef] [Scilit]
  31. Oilseed Rape Enhanced Genetic Improvement Network (OREGIN). Available online: https://www.herts.ac.uk/oregin (accessed on 7 December 2022).
  32. Dutreux, F.; Da Silva, C.; d’Agata, L.; Couloux, A.; Gay, E.J.; Istace, B.; Lapalu, N.; Lemainque, A.; Linglin, J.; Noel, B.; et al. De novo assembly and annotation of three Leptosphaeria genomes using Oxford Nanopore MinION sequencing. Sci. Data. 2018, 5, 180235. [Google Scholar] [CrossRef] [Scilit]
  33. Zamanmirabadi, A.; Hemmati, R.; Dolatabadian, A.; Batley, J. Genetic structure and phylogenetic relationships of Leptosphaeria maculans and L. biglobosa in Northern regions of Iran. Arch. Phytopathol. Pflanzenschutz. 2022, 55, 1062–1081. [Google Scholar] [CrossRef] [Scilit]
  34. West, J.S.; Evans, N.; Liu, S.; Hu, B.; Peng, L. Leptosphaeria maculans causing stem canker of oilseed rape in China. New Dis. Rep. 2000, 1, 3. [Google Scholar] [CrossRef] [Scilit]
  35. Petrie, G.A. Long-term survival and sporulation of Leptosphaeria maculans (blackleg) on naturally-infected rapeseed/canola stubble in Saskatchewan. Can. Plant Dis. Surv. 1995, 75, 23–34. [Google Scholar]
Figure 1. Validation of new mating-type polymerase chain reaction (PCR) diagnostics designed to discriminate between (A) MAT1-1 (primers PbMAT1F/R, amplicon 640bp) and (B) MAT1-2 (primers PbMAT2F/R, amplicon 416bp) isolates of Plenodomus biglobosus. Isolates screened in lanes are 1: KO8 (P. biglobosus ‘brassicae’, MAT1-1); 2: 21WAS8-4 (P. biglobosus ‘brassicae’, MAT1-2); 3: 21WAS1-2 (P. biglobosus ‘canadensis’, MAT1-1); 4: 21WAS7-1 (P. biglobosus ‘canadensis’, MAT1-2); 5: SCUA-Ahm-S41 (P. dezfulensis, MAT1-2); 6: Leroy (P. lingam, MAT1-1 type, no amplicon); 7: WAC 4057 (P. lingam, MAT1-2 type, no amplicon); 8: no template water control (NTC).
Figure 1. Validation of new mating-type polymerase chain reaction (PCR) diagnostics designed to discriminate between (A) MAT1-1 (primers PbMAT1F/R, amplicon 640bp) and (B) MAT1-2 (primers PbMAT2F/R, amplicon 416bp) isolates of Plenodomus biglobosus. Isolates screened in lanes are 1: KO8 (P. biglobosus ‘brassicae’, MAT1-1); 2: 21WAS8-4 (P. biglobosus ‘brassicae’, MAT1-2); 3: 21WAS1-2 (P. biglobosus ‘canadensis’, MAT1-1); 4: 21WAS7-1 (P. biglobosus ‘canadensis’, MAT1-2); 5: SCUA-Ahm-S41 (P. dezfulensis, MAT1-2); 6: Leroy (P. lingam, MAT1-1 type, no amplicon); 7: WAC 4057 (P. lingam, MAT1-2 type, no amplicon); 8: no template water control (NTC).
Pathogens 12 00003 g001
Table 1. Mating-type distribution as determined via polymerase chain reaction (PCR) of 216 Chinese and European Plenodomus biglobosus isolates.
Table 1. Mating-type distribution as determined via polymerase chain reaction (PCR) of 216 Chinese and European Plenodomus biglobosus isolates.
Isolates OriginTotal Isolates
Tested a
MAT1-1:MAT1-2 FrequencyX2 Valuep Value
China:
North (Inner Mongolia, Shaanxi) 22 (OSR: 22)20:214.72<0.01
East (Anhui, Jiangsu)46 (OSR: 18; BR: 28)23:2301.00
Southwest (Chongqing, Guizhou, Hubei, Hunan, Sichuan)89 (OSR: 56; BR: 33)32:577.02<0.01
Grand total China:157 (OSR: 96; BR: 61)75:820.310.576
Europe:
Austria5 (OSR: 5)3:2--
France13 (OSR: 13)5:80.690.405
Poland15 (OSR: 15)5:101.670.197
United Kingdom26 (OSR: 26)15:110.620.433
Grand total Europe:59 (OSR: 59)28:310.150.691
China + Europe datasets combined:
Grand total (China + Europe)216 (OSR: 155; BR: 61)103:1130.460.496
a Number of isolates collected from Brassica napus (oilseed rape, OSR) or Brassica rapa (BR) indicated in brackets.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

King, K.M.; Canning, G.; Zhou, K.; Liu, Z.; Wu, M.; West, J.S. Indirect Evidence Based on Mating-Type Ratios for the Role of Sexual Reproduction in European and Chinese Populations of Plenodomus biglobosus (Blackleg of Oilseed Rape). Pathogens 2023, 12, 3. https://doi.org/10.3390/pathogens12010003

AMA Style

King KM, Canning G, Zhou K, Liu Z, Wu M, West JS. Indirect Evidence Based on Mating-Type Ratios for the Role of Sexual Reproduction in European and Chinese Populations of Plenodomus biglobosus (Blackleg of Oilseed Rape). Pathogens. 2023; 12(1):3. https://doi.org/10.3390/pathogens12010003

Chicago/Turabian Style

King, Kevin M., Gail Canning, Kang Zhou, Zekuan Liu, Mingde Wu, and Jonathan S. West. 2023. "Indirect Evidence Based on Mating-Type Ratios for the Role of Sexual Reproduction in European and Chinese Populations of Plenodomus biglobosus (Blackleg of Oilseed Rape)" Pathogens 12, no. 1: 3. https://doi.org/10.3390/pathogens12010003

APA Style

King, K. M., Canning, G., Zhou, K., Liu, Z., Wu, M., & West, J. S. (2023). Indirect Evidence Based on Mating-Type Ratios for the Role of Sexual Reproduction in European and Chinese Populations of Plenodomus biglobosus (Blackleg of Oilseed Rape). Pathogens, 12(1), 3. https://doi.org/10.3390/pathogens12010003

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop