Molecular Typing of Leishmania spp. Causing Tegumentary Leishmaniasis in Northeastern Italy, 2014–2020
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Area
2.2. Study Design and Sample Collection
2.3. Case Definition and Characterization
2.4. DNA Extraction, Amplification, and Sequencing
2.5. Whole Genome Sequenced (WGS)-Based Analysis of hsp70 Gene
2.6. Data Analysis
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Gradoni, L.; López-Vélez, R.; Mokni, M. Manual on Case Management and Surveillance of the Leishmaniases in the WHO European Region; World Health Organization: Copenhagen, Danemark, 2017. [Google Scholar]
- Ruiz-Postigo, J.A.; Jain, S.; Madjou, S.; Maia-Elkhoury, A.N.; Valadas, S.; Warusavithana, S.; Osman, M.; Yajim, A.; Lin, A.; Beshah, A.; et al. Global Leishmaniasis Surveillance: 2021, Assessing the Impact of the COVID-19 Pandemic; World Health Organization: Geneva, Switzerland, 2022; pp. 575–590. [Google Scholar]
- Van der Auwera, G.; Dujardin, J.C. Species typing in dermal leishmaniasis. Clin. Microbiol. Rev. 2015, 28, 265–294. [Google Scholar] [CrossRef] [PubMed]
- Maroli, M.; Rossi, L.; Baldelli, R.; Capelli, G.; Ferroglio, E.; Genchi, C.; Gramiccia, M.; Mortarino, M.; Pietrobelli, M.; Gradoni, L. The northward spread of leishmaniasis in Italy: Evidence from retrospective and ongoing studies on the canine reservoir and phlebotomine vectors. Trop. Med. Int. Health 2008, 13, 256–264. [Google Scholar] [CrossRef] [PubMed]
- Gaspari, V.; Gritti, T.; Ortalli, M.; Santi, A.; Galletti, G.; Rossi, A.; Rugna, G.; Mattivi, A.; Matteo, G.; Belloli, G.L.; et al. Tegumentary Leishmaniasis in Northeastern Italy from 2017 to 2020: A Neglected Public Health Issue. Int. J. Environ. Res. Public Health 2022, 19, 16047. [Google Scholar] [CrossRef] [PubMed]
- Mattivi, A.; Massimiliani, E.; Cagarelli, R.; Albieri, A. Leishmaniosi in Emilia-Romagna, Aggiornamento Epidemiologico 1999–2015. Available online: https://salute.regione.emilia-romagna.it/normativa-e-documentazione/rapporti/malattie-infettive/leishmaniosi-er-epidemiologia-1999-2015 (accessed on 17 November 2023).
- Guery, R.; Walker, S.L.; Harms, G.; Neumayr, A.; Van Thiel, P.; Gangneux, J.P.; Clerinx, J.; Söbirk, S.K.; Visser, L.; Lachaud, L.; et al. Clinical diversity and treatment results in Tegumentary Leishmaniasis: A European clinical report in 459 patients. PLoS Negl. Trop. Dis. 2021, 15, e0009863. [Google Scholar] [CrossRef]
- Gaspari, V.; Zaghi, I.; Macrì, G.; Patrizi, A.; Salfi, N.; Locatelli, F.; Carra, E.; Re, M.C.; Varani, S. Autochthonous Cases of Mucosal Leishmaniasis in Northeastern Italy: Clinical Management and Novel Treatment Approaches. Microorganisms 2020, 8, 588. [Google Scholar] [CrossRef]
- Faucher, B.; Pomares, C.; Fourcade, S.; Benyamine, A.; Marty, P.; Pratlong, L.; Faraut, F.; Mary, C.; Piarroux, R.; Dedet, J.P.; et al. Mucosal Leishmania infantum leishmaniasis: Specific pattern in a multicentre survey and historical cases. J. Infect. 2011, 63, 76–82. [Google Scholar] [CrossRef] [PubMed]
- Van der Auwera, G.; Bart, A.; Chicharro, C.; Cortes, S.; Davidsson, L.; Di Muccio, T.; Dujardin, J.C.; Felger, I.; Paglia, M.G.; Grimm, F.; et al. Comparison of Leishmania typing results obtained from 16 European clinical laboratories in 2014. Euro Surveill. 2016, 21, 30418. [Google Scholar] [CrossRef]
- Chicharro, C.; Llanes-Acevedo, I.P.; García, E.; Nieto, J.; Moreno, J.; Cruz, I. Molecular typing of Leishmania infantum isolates from a leishmaniasis outbreak in Madrid, Spain, 2009 to 2012. Euro Surveill. 2013, 18, 20545. [Google Scholar] [CrossRef]
- Van der Auwera, G.; Ravel, C.; Verweij, J.J.; Bart, A.; Schönian, G.; Felger, I. Evaluation of four single-locus markers for Leishmania species discrimination by sequencing. J. Clin. Microbiol. 2014, 52, 1098–1104. [Google Scholar] [CrossRef]
- Schönian, G.; Kuhls, K.; Mauricio, I.L. Molecular approaches for a better understanding of the epidemiology and population genetics of Leishmania. Parasitology 2011, 138, 405–425. [Google Scholar] [CrossRef]
- Folgueira, C.; Cañavate, C.; Chicharro, C.; Requena, J.M. Genomic organization and expression of the HSP70 locus in New and Old World Leishmania species. Parasitology 2007, 134, 369–377. [Google Scholar] [CrossRef] [PubMed]
- Fraga, J.; Montalvo, A.M.; De Doncker, S.; Dujardin, J.C.; Van der Auwera, G. Phylogeny of Leishmania species based on the heat-shock protein 70 gene. Infect. Genet. Evol. 2010, 10, 238–245. [Google Scholar] [CrossRef] [PubMed]
- Gaspari, V.; Ortalli, M.; Foschini, M.P.; Baldovini, C.; Lanzoni, A.; Cagarelli, R.; Gaibani, P.; Rossini, G.; Vocale, C.; Tigani, R.; et al. New evidence of cutaneous leishmaniasis in north-eastern Italy. J. Eur. Acad. Dermatol. Venereol. 2017, 31, 1534–1540. [Google Scholar] [CrossRef] [PubMed]
- El Tai, N.O.; El Fari, M.; Mauricio, I.; Miles, M.A.; Oskam, L.; El Safi, S.H.; Presber, W.H.; Schönian, G. Leishmania donovani: Intraspecific polymorphisms of Sudanese isolates revealed by PCR-based analyses and DNA sequencing. Exp. Parasitol. 2001, 97, 35–44. [Google Scholar] [CrossRef] [PubMed]
- Van der Auwera, G.; Maes, I.; De Doncker, S.; Ravel, C.; Cnops, L.; Van Esbroeck, M.; Van Gompel, A.; Clerinx, J.; Dujardin, J.C. Heat-shock protein 70 gene sequencing for Leishmania species typing in European tropical infectious disease clinics. Euro Surveill. 2013, 18, 20543. [Google Scholar] [CrossRef] [PubMed]
- Franssen, S.U.; Durrant, C.; Stark, O.; Moser, B.; Downing, T.; Imamura, H.; Dujardin, J.C.; Sanders, M.J.; Mauricio, I.; Miles, M.A.; et al. Global genome diversity of the Leishmania donovani complex. Elife 2020, 9, e51243. [Google Scholar] [CrossRef] [PubMed]
- Van der Auwera, G.; Davidsson, L.; Buffet, P.; Ruf, M.T.; Gramiccia, M.; Varani, S.; Chicharro, C.; Bart, A.; Harms, G.; Chiodini, P.L.; et al. Surveillance of leishmaniasis cases from 15 European centres, 2014 to 2019: A retrospective analysis. Euro Surveill. 2022, 27, 2002028. [Google Scholar] [CrossRef]
- Hall, T.A. BioEdit: A User-Friendly Biological Sequence Alignment Editor and Analysis Program for Windows 95/98/NT. In Nucleic Acid Symposium Series; Oxford University Press: Oxford, UK, 1999; pp. 95–98. [Google Scholar]
- de Vries, H.J.C.; Schallig, H.D. Cutaneous Leishmaniasis: A 2022 Updated Narrative Review into Diagnosis and Management Developments. Am. J. Clin. Dermatol. 2022, 23, 823–840. [Google Scholar] [CrossRef]
- Di Muccio, T.; Scalone, A.; Bruno, A.; Marangi, M.; Grande, R.; Armignacco, O.; Gradoni, L.; Gramiccia, M. Epidemiology of Imported Leishmaniasis in Italy: Implications for a European Endemic Country. PLoS ONE 2015, 10, e0129418. [Google Scholar] [CrossRef]
- Hotez, P.J.; Savioli, L.; Fenwick, A. Neglected tropical diseases of the Middle East and North Africa: Review of their prevalence, distribution, and opportunities for control. PLoS Negl. Trop. Dis. 2012, 6, e1475. [Google Scholar] [CrossRef]
- Konate, I.; Sangare, I.; Zoungrana, J.; Meda, Z.C.; Kafando, C.; Sawadogo, Y.; Dabiré, R.; Meda, N.; Diallo, B.; Andonaba, J.B.; et al. Description of a new epidemic focus of cutaneous Leishmaniasis major in western Burkina Faso. Pan. Afr. Med. J. 2020, 35, 65. [Google Scholar] [CrossRef] [PubMed]
- Katakura, K. Molecular epidemiology of leishmaniasis in Asia (focus on cutaneous infections). Curr. Opin. Infect. Dis. 2009, 22, 126–130. [Google Scholar] [CrossRef] [PubMed]
- Kuhls, K.; Mauricio, I.L.; Pratlong, F.; Presber, W.; Schönian, G. Analysis of ribosomal DNA internal transcribed spacer sequences of the Leishmania donovani complex. Microbes Infect. 2005, 7, 1224–1234. [Google Scholar] [CrossRef] [PubMed]
- El Baidouri, F.; Diancourt, L.; Berry, V.; Chevenet, F.; Pratlong, F.; Marty, P.; Ravel, C. Genetic structure and evolution of the Leishmania genus in Africa and Eurasia: What does MLSA tell us. PLoS Negl. Trop. Dis. 2013, 7, e2255. [Google Scholar] [CrossRef]
- Rugna, G.; Carra, E.; Bergamini, F.; Calzolari, M.; Salvatore, D.; Corpus, F.; Gennari, W.; Baldelli, R.; Fabbi, M.; Natalini, S.; et al. Multilocus microsatellite typing (MLMT) reveals host-related population structure in Leishmania infantum from northeastern Italy. PLoS Negl. Trop. Dis. 2018, 12, e0006595. [Google Scholar] [CrossRef]
- Bruno, F.; Castelli, G.; Li, B.; Reale, S.; Carra, E.; Vitale, F.; Scibetta, S.; Calzolari, M.; Varani, S.; Ortalli, M.; et al. Genomic and epidemiological evidence for the emergence of a putative L. donovani/L. infantum; hybrid with unusual epidemiology in Northern Italy. Available online: https://ssrn.com/abstract=4611485 (accessed on 15 November 2023).
- Domagalska, M.A.; Dujardin, J.C. Next-Generation Molecular Surveillance of TriTryp Diseases. Trends Parasitol. 2020, 36, 356–367. [Google Scholar] [CrossRef]
hsp70 Fragments | Primer Name | Primer Sequence | Position * | Amplicon Size |
---|---|---|---|---|
N-fragment | F25_var (Sense) | 5′_GGACGCCGGCACGATTGCT_3′ | 480–498 | 593 bp |
R617_var (Antisense) | 5′_CGAAGAAGTCCGACACGAGGGA_3′ | 1072–1051 | ||
P-fragment | F-paraf (Sense) | 5′_GGACTTCGACAACCGCCTC_3′ | 699–717 | 295 bp |
R-paraf (antisense) | 5′_CTTGTCCATCTTCGCGTCCT_3′ | 993–974 | ||
Ps-fragment | For-paraf-s (forward) | 5′_CGTCACGTTCTTCACCGAGGAGT_3′ | 717–739 | 262 bp |
Rev-paraf-s (reverse) | 5′_GTCCTGCAGCACGCGCTCCAC_3′ | 978–958 |
hsp70 | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
L. donovani Complex | L. major | L. tropica | NA | Total | |||||||||
Sequence Variant | |||||||||||||
A | B | C | D | E | F | G | H | ||||||
ITS1 | L. infantum | 25 | 1 | 4 | 1 | 6 | 1 | 28 | 1 | 0 | 0 | 0 | 67 |
L. major | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 4(4) | 0 | 0 | 4(4) | |
L. tropica | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2(2) | 0 | 2(2) | |
NA | 4 | 2(1) | 1 | 0 | 1 | 0 | 1 | 0 | 1(1) | 0 | 0 | 10(2) | |
Total | 29 | 3(1) | 5 | 1 | 7 | 1 | 29 | 1 | 5(5) | 2(2) | 0 | 83(8) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gritti, T.; Carra, E.; Van der Auwera, G.; Solana, J.C.; Gaspari, V.; Trincone, S.; Ortalli, M.; Rabitti, A.; Reggiani, A.; Rugna, G.; et al. Molecular Typing of Leishmania spp. Causing Tegumentary Leishmaniasis in Northeastern Italy, 2014–2020. Pathogens 2024, 13, 19. https://doi.org/10.3390/pathogens13010019
Gritti T, Carra E, Van der Auwera G, Solana JC, Gaspari V, Trincone S, Ortalli M, Rabitti A, Reggiani A, Rugna G, et al. Molecular Typing of Leishmania spp. Causing Tegumentary Leishmaniasis in Northeastern Italy, 2014–2020. Pathogens. 2024; 13(1):19. https://doi.org/10.3390/pathogens13010019
Chicago/Turabian StyleGritti, Tommaso, Elena Carra, Gert Van der Auwera, José Carlos Solana, Valeria Gaspari, Silvana Trincone, Margherita Ortalli, Alice Rabitti, Alessandro Reggiani, Gianluca Rugna, and et al. 2024. "Molecular Typing of Leishmania spp. Causing Tegumentary Leishmaniasis in Northeastern Italy, 2014–2020" Pathogens 13, no. 1: 19. https://doi.org/10.3390/pathogens13010019