First Report on the Occurrence and Subtypes of Blastocystis in Pigs in Poland Using Sequence-Tagged-Site PCR and Barcode Region Sequencing
Abstract
1. Introduction
2. Results
2.1. Results of STS PCR
2.2. Results of Barcode Region Analysis
2.3. Prevalence of Blastocystis and Subtypes Distribution within Pig Age Groups
3. Discussion
4. Materials and Methods
4.1. Stool Sampling and Processing
4.2. DNA Extraction and PCR Amplification
- (i)
- PCR with subtype-specific sequence-tagged-site (STS) diagnostic primers described by Yoshikawa et al. [36] (Table 3). DNA amplification was carried out in 25 μL reaction mixtures consisting of 12.5 μL PCR Mix HGC Plus (ready-to-use PCR mixture containing Taq DNA polymerase, PCR buffer, MgCl2, and dNTPs; A&A Biotechnology), 1 μL of each primer (concentration 10 μM), 2 μL of genomic DNA, supplemented with deionized water up to 25 μL. The PCR conditions were the same for all primer sets and consisted of the following steps: 3 min at 94 °C (initial denaturation) followed by 35 cycles of 30 s at 94 °C, 30 s at 59 °C, 1 min at 72 °C, and a final extension step of 5 min at 72 °C. STS PCR results were considered positive if a specific band was visible in the gel.
- (ii)
- Amplification and sequencing of a ~600 bp fragment of the SSU rDNA gene (called barcode region) with the Blastocystis-specific BhRDr and the broad-eukaryote-specific RD5 primers described by Scicluna et al. [37] (Table 3). The reaction mixture was as above. The PCR conditions were as follows: 4 min at 94 °C (initial denaturation) followed by 35 cycles of 15 s at 95 °C, 15 s at 60 °C, 30 s at 72 °C, and a final extension step of 5 min at 72 °C.
4.3. Barcode Sequence Analysis
4.4. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
Ethics Statement
References
- Stensvold, C.R.; Clark, C.G. Current status of Blastocystis: A personal view. Parasitol. Int. 2016, 65, 763–771. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yoshikawa, H.; Koyama, Y.; Tsuchiya, E.; Takami, K. Blastocystis phylogeny among various isolates from humans to insects. Parasitol. Int. 2016, 65, 750–759. [Google Scholar] [CrossRef] [Scilit]
- Jiménez, P.A.; Jaimes, J.E.; Ramírez, J.D. A summary of Blastocystis subtypes in North and South America. Parasit. Vectors. 2019, 12, 376. [Google Scholar]
- Andersen, L.O.; Stensvold, C.R. Blastocystis in Health and Disease: Are We Moving from a Clinical to a Public Health Perspective? J. Clin. Microbiol. 2016, 54, 524–528. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Poirier, P.; Wawrzyniak, I.; Vivarès, C.P.; Delbac, F.; El Alaoui, H. New insights into Blastocystis spp.: A potential link with irritable bowel syndrome. PLoS Pathog. 2012, 8, 1–4. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bahrami, F.; Babaei, E.; Badirzadeh, A.; Riabi, T.R.; Abdoli, A. Blastocystis, urticaria, and skin disorders: Review of the current evidences. Eur. J. Clin. Microbiol. Infect. Dis. 2019. [Google Scholar] [CrossRef] [Scilit]
- Shirvani, G.; Fasihi-Harandi, M.; Raiesi, O.; Bazargan, N.; Zahedi, M.J.; Sharifi, I.; Kalantari-Khandani, B.; Nooshadokht, M.; Shabandoust, H.; Mohammadi, M.A.; et al. Prevalence and Molecular Subtyping of Blastocystis from Patients with Irritable Bowel Syndrome, Inflammatory Bowel Disease and Chronic Urticaria in Iran. Acta Parasitol. 2019, 65, 90–96. [Google Scholar] [CrossRef] [Scilit]
- Gentekaki, E.; Curtis, B.A.; Stairs, C.W.; Klimeš, V.; Eliáš, M.; Salas-Leiva, D.E.; Herman, E.K.; Eme, L.; Arias, M.C.; Henrissat, B.; et al. Extreme Genome Diversity in the Hyper-Prevalent Parasitic Eukaryote Blastocystis. PLoS Biol. 2017, 15, e2003769. [Google Scholar] [CrossRef] [Scilit]
- Stensvold, C.R.; Clark, C.G. Pre-empting Pandora’s Box: Blastocystis Subtypes Revisited. Trends Parasitol. 2020, 36, 229–232. [Google Scholar] [CrossRef] [Scilit]
- Wawrzyniak, I.; Poirier, P.; Texier, C.; Delbac, F.; Viscogliosi, E.; Dionigia, M.; Alaoui, H.E. Blastocystis, an unrecognized parasite: An overview of pathogenesis and diagnosis. Adv. Infect. Dis. 2013, 1, 167–178. [Google Scholar] [CrossRef] [Scilit]
- Alfellani, M.A.; Taner-Mulla, D.; Jacob, A.S.; Imeede, C.A.; Yoshikawa, H.; Stensvold, C.R.; Clark, C.G. Genetic Diversity of Blastocystis in Livestock and Zoo Animals. Protist 2013, 164, 497–509. [Google Scholar] [CrossRef] [Scilit]
- Clark, C.G.; van der Giezen, M.; Alfellani, M.A.; Stensvold, C.R. Recent Developments in Blastocystis Research; Elsevier: Amsterdam, The Netherlands, 2013; Volume 82, ISBN 9780124077065. [Google Scholar]
- Salim, H.R.; Kumar, G.S.; Vellayan, S.; Mak, J.W.; Khairul Anuar, A.; Init, I.; Vennila, G.D.; Saminathan, R.; Ramakrishnan, K. Blastocystis in animal handlers. Parasitol. Res. 1999, 85, 1032–1033. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dagci, H.; Kurt, Ö.; Demirel, M.; Mandiracioglu, A.; Aydemir, S.; Saz, U.; Bart, A.; Van Gool, T. Epidemiological and diagnostic features of blastocystis infection in symptomatic patients in izmir province, Turkey. Iran. J. Parasitol. 2014, 9, 519. [Google Scholar] [PubMed]
- Yan, Y.; Su, S.; Ye, J.; Lai, X.; Lai, R.; Liao, H.; Chen, G.; Zhang, R.; Hou, Z.; Luo, X. Blastocystis sp. subtype 5: A possibly zoonotic genotype. Parasitol. Res. 2007, 101, 1527–1532. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stensvold, C.R.; Alfellani, M.A.; Nørskov-Lauritsen, S.; Prip, K.; Victory, E.L.; Maddox, C.; Nielsen, H.V.; Clark, C.G. Subtype distribution of Blastocystis isolates from synanthropic and zoo animals and identification of a new subtype. Int. J. Parasitol. 2009, 39, 473–479. [Google Scholar] [CrossRef] [Scilit]
- Parkar, U.; Traub, R.J.; Vitali, S.; Elliot, A.; Levecke, B.; Robertson, I.; Geurden, T.; Steele, J.; Drake, B.; Thompson, R.C.A. Molecular characterization of Blastocystis isolates from zoo animals and their animal-keepers. Vet. Parasitol. 2010, 169, 8–17. [Google Scholar] [CrossRef] [Scilit]
- Nagel, R.; Cuttell, L.; Stensvold, C.R.; Mills, P.C.; Bielefeldt-Ohmann, H.; Traub, R.J. Blastocystis subtypes in symptomatic and asymptomatic family members and pets and response to therapy. Intern. Med. J. 2012, 42, 1187–1195. [Google Scholar] [CrossRef] [Scilit]
- Lee, L.I.; Chye, T.T.; Karmacharya, B.M.; Govind, S.K. Blastocystis sp.: Waterborne zoonotic organism, a possibility? Parasites Vectors 2012, 5, 1. [Google Scholar] [CrossRef] [Scilit]
- Snell-Castro, R.; Godon, J.J.; Delgenès, J.P.; Dabert, P. Characterisation of the microbial diversity in a pig manure storage pit using small subunit rDNA sequence analysis. Fems Microbiol. Ecol. 2005, 52, 229–242. [Google Scholar] [CrossRef] [Scilit]
- Suresh, K.; Smith, H.V.; Tan, T.C. Viable Blastocystis cysts in Scottish and Malaysian sewage samples. Appl. Environ. Microbiol. 2005, 71, 5619–5620. [Google Scholar] [CrossRef] [Scilit]
- Leelayoova, S.; Siripattanapipong, S.; Thathaisong, U.; Naaglor, T.; Taamasri, P.; Piyaraj, P.; Mungthin, M. Drinking water: A possible source of Blastocystis spp. subtype 1 infection in schoolchildren of a rural community in central Thailand. Am. J. Trop. Med. Hyg. 2008, 79, 401–406. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Noradilah, S.A.; Lee, I.L.; Anuar, T.S.; Salleh, F.M.; Manap, S.N.A.A.; Mohtar, N.S.H.M.; Azrul, S.M.; Abdullah, W.O.; Moktar, N. Occurrence of Blastocystis sp. in water catchments at Malay villages and Aboriginal settlement during wet and dry seasons in Peninsular Malaysia. PeerJ 2016, 2016, 1–20. [Google Scholar] [CrossRef] [Scilit]
- Song, J.K.; Hu, R.S.; Fan, X.C.; Wang, S.S.; Zhang, H.J.; Zhao, G.H. Molecular characterization of Blastocystis from pigs in Shaanxi province of China. Acta Trop. 2017, 173, 130–135. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, W.; Owen, H.; Traub, R.J.; Cuttell, L.; Inpankaew, T.; Bielefeldt-Ohmann, H. Molecular epidemiology of Blastocystis in pigs and their in-contact humans in Southeast Queensland, Australia, and Cambodia. Vet. Parasitol. 2014, 203, 264–269. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yoshikawa, H.; Tokoro, M.; Nagamoto, T.; Arayama, S.; Asih, P.B.S.; Rozi, I.E.; Syafruddin, D. Molecular survey of Blastocystis sp. from humans and associated animals in an Indonesian community with poor hygiene. Parasitol. Int. 2016, 65, 780–784. [Google Scholar] [CrossRef] [Scilit]
- Pintong, A.; Sunyanusin, S.; Prasertbun, R.; Mahittikorn, A.; Mori, H.; Changbunjong, T.; Komalamisra, C.; Sukthana, Y.; Popruk, S. Blastocystis subtype 5: Predominant subtype on pig farms, Thailand. Parasitol. Int. 2018, 67, 824–828. [Google Scholar] [CrossRef] [Scilit]
- GUS. Pogłowie świń 2019. Available online: https://stat.gov.pl/obszary-tematyczne/rolnictwo-lesnictwo/produkcja-zwierzeca-zwierzeta-gospodarskie/poglowie-swin-wedlug-stanu-w-grudniu-2019-roku,7,12.html (accessed on 30 April 2019).
- Kowalewska, B.; Rudzińska, M.; Zarudzka, D.; Kotłowski, A. Ocena częstości zarażeń pasożytami jelitowymi wśród pacjentów przychodni Instytutu Medycyny Morskiej i Tropikalnej w Gdyni w okresie ostatnich 30 lat An evaluation of the intensity of intestinal parasitic infections among patients of out-patient Division. Diagn. Lab. 2013, 49, 9–15. [Google Scholar]
- Wesolowska, W.; Kicia, M.; Szetela, B.; Kopacz, Z.; Salamatin, R.; Rymer, W.; Szymczak, A.; Knysz, B. Prevalence of Blastocystis hominis among HIV-positive and HIV-negative patients in Poland. Prevalence 2016, 6, 11. [Google Scholar]
- Lepczyńska, M.; Białkowska, J.; Dzika, E.; Piskorz-Ogórek, K.; Korycińska, J. Blastocystis: How do specific diets and human gut microbiota affect its development and pathogenicity? Eur. J. Clin. Microbiol. Infect. Dis. 2017, 36, 1531–1540. [Google Scholar] [CrossRef] [Scilit]
- Kaczmarek, A.; Gołąb, E.; Żarnowska-Prymek, H.; Rawska, A.; Jańczak, D.; Lewicki, A.; Wesołowska, M.; Rożej-Bielicka, W.; Cielecka, D.; Sałamatin, R. Genetic diversity of Blastocystis hominis sensu lato isolated from humans in Poland = Zróżnicowanie genetyczne Blastocystis hominis sensu lato wyizolowanych od ludzi w Polsce. Przegl. Epidemiol. 2017, 71, 539–546. [Google Scholar]
- Rudzińska, M.; Kowalewska, B.; Wąż, P.; Sikorska, K.; Szostakowska, B. Blastocystis subtypes isolated from travelers and non-travelers from the north of Poland—A single center study. Infect. Genet. Evol. 2019, 75, 103926. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tan, K.S.W. New Insights on Classification, Identification, and Clinical Relevance of Blastocystis spp. Clin. Microbiol. Rev. 2008, 21, 639–665. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dogruman-Al, F.; Simsek, Z.; Boorom, K.; Ekici, E.; Sahin, M.; Tuncer, C.; Kustimur, S.; Altinbas, A. Comparison of methods for detection of Blastocystis infection in routinely submitted stool samples, and also in IBS/IBD Patients in Ankara, Turkey. PLoS ONE 2010, 5, e15484. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yoshikawa, H.; Wu, Z.; Kimata, I.; Iseki, M.; Ali, I.K.M.D.; Hossain, M.B.; Zaman, V.; Haque, R.; Takahashi, Y. Polymerase chain reaction-based genotype classification among human Blastocystis hominis populations isolated from different countries. Parasitol. Res. 2004, 92, 22–29. [Google Scholar] [CrossRef] [Scilit]
- Scicluna, S.M.; Tawari, B.; Clark, C.G. DNA barcoding of Blastocystis. Protist 2006, 157, 77–85. [Google Scholar] [CrossRef] [Scilit]
- Thathaisong, U.; Worapong, J.; Tan-ariya, P.; Viputtigul, K.; Mungthin, M.; Sudatis, A.; Noonai, A.; Leelayoova, S. Blastocystis Isolates from a Pig and a Horse Are Closely Related to Blastocystis hominis Blastocystis Isolates from a Pig and a Horse Are Closely Related to Blastocystis hominis. J. Clin. Microbiol. 2003, 41, 967–975. [Google Scholar] [CrossRef] [Scilit]
- Navarro, C.; Domínguez-Márquez, M.V.; Garijo-Toledo, M.M.; Vega-García, S.; Fernández-Barredo, S.; Pérez-Gracia, M.T.; García, A.; Borrás, R.; Gómez-Muñoz, M.T. High prevalence of Blastocystis sp. in pigs reared under intensive growing systems: Frequency of ribotypes and associated risk factors. Vet. Parasitol. 2008, 153, 347–358. [Google Scholar] [CrossRef] [Scilit]
- Süli, T.; Kozoderović, G.; Potkonjak, A.; Simin, S.; Simin, V.; Lalošević, V. Comparison of conventional and molecular diagnostic techniques for detection of Blastocystis sp. In pig faeces. Iran. J. Parasitol. 2018, 13, 594–601. [Google Scholar]
- Pakandl, M. Occurrence of Blastocystis sp. in pigs. Folia Parasitol. (Praha). 1991, 38, 297–301. [Google Scholar]
- Paik, S.; Jung, B.Y.; Lee, H.; Hwang, M.H.; Han, J.E.; Rhee, M.H.; Kim, T.H.; Kwon, O.D.; Kwak, D. Molecular Detection and Subtyping of Blastocystis in Korean Pigs. Korean J. Parasitol. 2019, 57, 525–529. [Google Scholar] [CrossRef] [Scilit]
- Udonsom, R.; Prasertbun, R.; Mahittikorn, A.; Mori, H.; Changbunjong, T.; Komalamisra, C.; Pintong, A.; Sukthana, Y.; Popruk, S. Blastocystis infection and subtype distribution in humans, cattle, goats, and pigs in central and western Thailand. Infect. Genet. Evol. 2018, 65, 107–111. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, J.; Gong, B.; Yang, F.; Zhang, W.; Zheng, Y.; Liu, A. Subtype distribution and genetic characterizations of Blastocystis in pigs, cattle, sheep and goats in northeastern China’s Heilongjiang Province. Infect. Genet. Evol. 2018, 57, 171–176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wylezich, C.; Belka, A.; Hanke, D.; Beer, M.; Blome, S.; Höper, D. Metagenomics for broad and improved parasite detection: A proof-of concept study using swine faecal samples. Int. J. Parasitol. 2019, 49, 769–777. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Scanlan, P.D.; Stensvold, C.R.; Cotter, P.D. Development and application of a Blastocystis subtype-specific PCR assay reveals that mixed-subtype infections are common in a healthy human population. Appl. Environ. Microbiol. 2015, 81, 4071–4076. [Google Scholar] [CrossRef] [Scilit]
- Stensvold, C.R. Comparison of sequencing (Barcode Region) and sequence-tagged-site PCR for Blastocystis subtyping. J. Clin. Microbiol. 2013, 51, 190–194. [Google Scholar] [CrossRef] [Scilit]
- Yoshikawa, H.; Abe, N.; Wu, Z. PCR-based identification of zoonotic isolates of Blastocystis from mammals and birds. Microbiology 2004, 150, 1147–1151. [Google Scholar] [CrossRef] [Scilit]
- Stensvold, C.R.; Alfellani, M.; Clark, C.G. Levels of genetic diversity vary dramatically between Blastocystis subtypes. Infect. Genet. Evol. J. Mol. Epidemiol. Evol. Genet. Infect. Dis. 2012, 12, 263–273. [Google Scholar] [CrossRef] [Scilit]
- Yoshikawa, H.; Dogruman-AI, F.; Turk, S.; Kustimur, S.; Balaban, N.; Sultan, N. Evaluation of DNA extraction kits for molecular diagnosis of human Blastocystis subtypes from fecal samples. Parasitol. Res. 2011, 109, 1045–1050. [Google Scholar] [CrossRef] [Scilit]
- Roberts, T.; Stark, D.; Harkness, J.; Ellis, J. Subtype distribution of Blastocystis isolates from a variety of animals from New South Wales, Australia. Vet. Parasitol. 2013, 196, 85–89. [Google Scholar] [CrossRef] [Scilit]
- Santín, M.; Gómez-Muñoz, M.T.; Solano-Aguilar, G.; Fayer, R. Development of a new PCR protocol to detect and subtype Blastocystis spp. from humans and animals. Parasitol. Res. 2011, 109, 205–212. [Google Scholar] [CrossRef] [Scilit]
- Fayer, R.; Elsasser, T.; Gould, R.; Solano, G.; Urban, J.; Santin, M. Blastocystis tropism in the pig intestine. Parasitol. Res. 2014, 113, 1465–1472. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Noël, C.; Peyronnet, C.; Gerbod, D.; Edgcomb, V.P.; Delgado-Viscogliosi, P.; Sogin, M.L.; Capron, M.; Viscogliosi, E.; Zenner, L. Phylogenetic analysis of Blastocystis isolates from different hosts based on the comparison of small-subunit rRNA gene sequences. Mol Biochem Parasitol. 2003, 126, 119–123. [Google Scholar] [CrossRef] [Scilit]
- Badparva, E.; Sadraee, J.; Kheirandish, F. Genetic Diversity of Blastocystis Isolated from Cattle in Khorramabad, Iran. Jundishapur J. Microbiol. 2015, 8, 4–7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weining, Z.; Tao, W.; Gong, B.; Yang, H.; Li, Y.; Song, M.; Lu, Y.; Li, W. First report of Blastocystis infections in cattle in China. Vet. Parasitol. 2017, 246, 38–42. [Google Scholar] [CrossRef] [Scilit]
- Song, J.K.; Yin, Y.L.; Yuan, Y.J.; Tang, H.; Ren, G.J.; Zhang, H.J.; Li, Z.X.; Zhang, Y.M.; Zhao, G.H. First genotyping of Blastocystis sp. in dairy, meat, and cashmere goats in northwestern China. Acta Trop. 2017, 176, 277–282. [Google Scholar] [CrossRef] [Scilit]
- Betts, E.L.; Gentekaki, E.; Thomasz, A.; Breakell, V.; Carpenter, A.I.; Tsaousis, A.D. Genetic diversity of Blastocystis in non-primate animals. Parasitology 2017, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Li, W.C.; Wang, K.; Gu, Y. Occurrence of Blastocystis sp. and Pentatrichomonas hominis in sheep and goats in China. Parasit. Vectors 2018, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Valença-Barbosa, C.; Do Bomfim, T.C.B.; Teixeira, B.R.; Gentile, R.; Da Costa Neto, S.F.; Magalhães, B.S.N.; De Almeida Balthazar, D.; Da Silva, F.A.; Biot, R.; D’Avila Levy, C.M.; et al. Molecular epidemiology of Blastocystis isolated from animals in the state of Rio de Janeiro, Brazil. PLoS ONE 2019, 14, e210740. [Google Scholar] [CrossRef] [Scilit]
- Tan, T.C.; Tan, P.; Sharma, R.; Sugnaseelan, S.; Suresh, K. Genetic diversity of caprine Blastocystis from Peninsular Malaysia. Parasitol. Res. 2013, 112, 85–89. [Google Scholar] [CrossRef] [Scilit]
- Greige, S.; El Safadi, D.; Bécu, N.; Gantois, N.; Pereira, B.; Chabé, M.; Benamrouz-Vanneste, S.; Certad, G.; El Hage, R.; Chemaly, M.; et al. Prevalence and subtype distribution of Blastocystis sp. isolates from poultry in Lebanon and evidence of zoonotic potential. Parasites Vectors 2018, 11, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Alfellani, M.A.; Stensvold, C.R.; Vidal-Lapiedra, A.; Onuoha, E.S.U.; Fagbenro-Beyioku, A.F.; Clark, C.G. Variable geographic distribution of Blastocystis subtypes and its potential implications. Acta Trop. 2013, 126, 11–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pakandl, M.; Koudela, B.; Vitovec, J. An experimental infection of conventional and gnotobiotic piglets with human and porcine strains of Blastocystis. Folia Parasitol. (Praha) 1993, 40, 319–320. [Google Scholar] [PubMed]
- Lewicki, A.; Rożej-Bielicka, W.; Sałamatin, R. Blastocystis hominis s. l. ST6—Parasite of chickens—New zoonotic agent in Poland. Ann. Parasitol. 2016, 62, 203. [Google Scholar]
- Kaczmarek, A.; Lewicki, A.; Dziedzic, K.; Sulecki, K.; Rożej-bielicka, W.; Wesołowska, M.; Gołąb, E. A survey of Blastocystis in domestic chickens from Poland and Madagascar. Ann. Parasitol. 2019, 65, s30. [Google Scholar]
- Wesołowska, M.; Paszta, W.; Michrowska, A.; Piekarska, J.; Wesołowska, M.; Gorczykowski, M.; Kaczmarek, A.; Sałamatin, R. Molecular characterization of Blastocystis subtypes isolated from various mammalian groups living in Wrocław ZOO, Poland. Ann. Parasitol. 2019, 65, s47. [Google Scholar]
- Sałamatin, R.; Kaczmarek, A.; Rożej-bielicka, W.; Cielecka, D.; Jańczak, D.; Lewicki, A.; Wesołowska, M.; Młocicki, D.; Gołąb, E. Genotype characterisation of Blastocystis isolates from Polish patients—Preliminary results. Ann. Parasitol. 2016, 62, 93. [Google Scholar]
- Stensvold, C.R.; Suresh, G.K.; Tan, K.S.W.; Thompson, R.C.A.; Traub, R.J.; Viscogliosi, E.; Yoshikawa, H.; Clark, C.G. Terminology for Blastocystis subtypes—A consensus. Trends Parasitol. 2007, 23, 93–96. [Google Scholar] [CrossRef] [Scilit]
- Rolf, F.J.; Sokal, R.R. Statistical Tables, 3rd ed.; Freeman: New York, NY, USA, 1995. [Google Scholar]
- Grzybek, M.; Bajer, A.; Bednarska, M.; Al-Sarraf, M.; Behnke-Borowczyk, J.; Harris, P.D.; Price, S.J.; Brown, G.S.; Osborne, S.-J.; Siński, E.; et al. Long-term spatiotemporal stability and dynamic changes in helminth infracommunities of bank voles (Myodes glareolus) in NE Poland. Parasitology 2015, 142, 1722–1743. [Google Scholar] [CrossRef] [Scilit]


| No of Samples n = 149 | Barcode Sequence Analysis | STS PCR (Positive n = 57) | |
|---|---|---|---|
| Product of Barcode PCR (Positive n = 66) | Identification Based on Nucleotide Sequence (Positive n = 56 **) | ||
| 37 | + | ST5 | ST5 |
| 1 | + | ST1 | ST1 |
| 3 | + | ST5 | ST5/ST1 |
| 1 | + | ST5 | ST5/ST3 |
| 1 | + | ST1 | ST3/ST1 |
| 11 | + | ST5 | - |
| 2 | + | ST-In *** | - |
| 3 | + | fungus | ST5 |
| 3 | + | unreadable | ST5 |
| 8 | - | - | ST5 |
| 1 * | + | fungus | - |
| 3 * | + | unreadable | - |
| 75 | - | - | - |
| Age Group | No. of Examined/Infected Pigs | Blastocystis ST (n) |
|---|---|---|
| Piglets <4 weeks | 32/16 | ST5 (16) |
| Weaners 1–3 months | 18/8 | ST5 (7), ST5/ST3 (1) |
| Porkers 3–9 months | 54/25 | ST5 (21), ST1 (1), ST5/ST1 (2), ST-In * (1) |
| Sows >12 months | 45/21 | ST5 (18), ST5/ST1 (1), ST3/ST1 (1), ST-In * (1) |
| Target Blastocystis ST | Primer Sets | Sequences of Forward (F) and Reverse (R) Primers (5′ to 3′) |
|---|---|---|
| ST1 a | SB83 | F: GAAGGACTCTCTGACGATGA R: GTCCAAATGAAAGGCAGC |
| ST2 a | SB340 | F: TGTTCTTGTGTCTTCTCAGCTC R:TTCTTTCACACTCCCGTCAAT |
| ST3 a | SB 227 | F: TAGGATTTGGTGTTTGGAGA R: TTAGAAGTGAAGGAGATGGAAG |
| ST4 a | SB 337 | F: GTCTTTCCCTGTCTATTCTTGCA R: AATTCGGTCTGCTTCTTCTG |
| ST5 a | SB336 | F: GTGGGTAGAGGAAGGAAAACA R: AGAACAAGTCGATGAAGTGAGAT |
| ST6 a | SB 332 | F: GCATCCAGACTACTATCAACATT R: CCATTTTCAGACAACCACTTA |
| ST7 a | SB 155 | F: ATCAGCCTACAATCTCCTC R: ATCGCCACTTCTCCAAT |
| All | RD5 | ATCTGGTTGATCCTGCCAGT |
| BhRDr | GAGCTTTTTAACTGCAACAACG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rudzińska, M.; Kowalewska, B.; Szostakowska, B.; Grzybek, M.; Sikorska, K.; Świątalska, A. First Report on the Occurrence and Subtypes of Blastocystis in Pigs in Poland Using Sequence-Tagged-Site PCR and Barcode Region Sequencing. Pathogens 2020, 9, 595. https://doi.org/10.3390/pathogens9070595
Rudzińska M, Kowalewska B, Szostakowska B, Grzybek M, Sikorska K, Świątalska A. First Report on the Occurrence and Subtypes of Blastocystis in Pigs in Poland Using Sequence-Tagged-Site PCR and Barcode Region Sequencing. Pathogens. 2020; 9(7):595. https://doi.org/10.3390/pathogens9070595
Chicago/Turabian StyleRudzińska, Monika, Beata Kowalewska, Beata Szostakowska, Maciej Grzybek, Katarzyna Sikorska, and Agnieszka Świątalska. 2020. "First Report on the Occurrence and Subtypes of Blastocystis in Pigs in Poland Using Sequence-Tagged-Site PCR and Barcode Region Sequencing" Pathogens 9, no. 7: 595. https://doi.org/10.3390/pathogens9070595
APA StyleRudzińska, M., Kowalewska, B., Szostakowska, B., Grzybek, M., Sikorska, K., & Świątalska, A. (2020). First Report on the Occurrence and Subtypes of Blastocystis in Pigs in Poland Using Sequence-Tagged-Site PCR and Barcode Region Sequencing. Pathogens, 9(7), 595. https://doi.org/10.3390/pathogens9070595

