Isolation and Genomic Characteristics of Cat-Borne Campylobacter felis sp. nov. and Sheep-Borne Campylobacter ovis sp. nov
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling, Isolation and Culturing
2.2. Morphological, Physiological and Biochemical Characteristics
2.3. Antimicrobial Susceptibility Testing
2.4. Species-Specific PCR
2.5. Genome Extraction and Sequencing
2.6. Genomic Analysis
2.7. Phylogenetic and Phylogenomic Analysis
2.8. Accession Numbers
3. Results and Discussion
3.1. Isolation and Phenotypic Characterization
3.2. Phylogenetic and Phylogenomic Analysis
3.3. Genome Characteristics
3.4. Antibiotic Resistance and Pathogenicity
3.5. Specific Real-Time PCR
4. Conclusions
4.1. Description of Campylobacter felis sp. nov.
Campylobacter felis (fe’lis. L. gen. n. felis of a Cat)
4.2. Description of Campylobacter ovis sp. nov.
Campylobacter ovis (o’vis. L. gen. n. ovis of a Sheep)
5. Limitations
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Hamidian, M.; Sanaei, M.; Bolfion, M.; Dabiri, H.; Zali, M.R.; Walther-Rasmussen, J. Prevalence of putative virulence markers in Campylobacter jejuni and Campylobacter coli isolated from hospitalized children, raw chicken, and raw beef in Tehran, Iran. Can. J. Microbiol. 2011, 57, 143–148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Man, S.M. The clinical importance of emerging Campylobacter species. Nat. Rev. Gastroenterol. Hepatol. 2011, 8, 669–685. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Karmali, M.A.; Penner, J.L.; Fleming, P.C.; Williams, A.; Hennessy, J.N. The serotype and biotype distribution of clinical isolates of Campylobacter jejuni and Campylobacter coli over a three-year period. J. Infect. Dis. 1983, 147, 243–246. [Google Scholar] [CrossRef] [Scilit]
- Costa, D.; Iraola, G. Pathogenomics of Emerging Campylobacter Species. Clin. Microbiol. Rev. 2019, 32, e00072-18. [Google Scholar] [CrossRef] [Scilit]
- Zhang, M.; Li, Q.; He, L.; Meng, F.; Gu, Y.; Zheng, M.; Gong, Y.; Wang, P.; Ruan, F.; Zhou, L.; et al. Association study between an outbreak of Guillain-Barre syndrome in Jilin, China, and preceding Campylobacter jejuni infection. Foodborne Pathog. Dis. 2010, 7, 913–919. [Google Scholar] [CrossRef] [Scilit]
- Kaakoush, N.O.; Castaño-Rodríguez, N.; Mitchell, H.M.; Man, S.M. Global Epidemiology of Campylobacter Infection. Clin. Microbiol. Rev. 2015, 28, 687–720. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Phung, C.; Scott, P.C.; Dekiwadia, C.; Moore, R.J.; Van, T.T.H. Campylobacter bilis sp. nov., isolated from chickens with spotty liver disease. Int. J. Syst. Evol. Microbiol. 2022, 72, 005314. [Google Scholar] [CrossRef] [Scilit]
- Lynch, C.; Peeters, C.; Walsh, N.; McCarthy, C.; Coffey, A.; Lucey, B.; Vandamme, P. Campylobacter majalis sp. nov. and Campylobacter suis sp. nov., novel Campylobacter species isolated from porcine gastrointestinal mucosa. Int. J. Syst. Evol. Microbiol. 2022, 72, 005510. [Google Scholar] [CrossRef] [Scilit]
- Parisi, A.; Chiara, M.; Caffara, M.; Mion, D.; Miller, W.G.; Caruso, M.; Manzari, C.; Florio, D.; Capozzi, L.; D’Erchia, A.M.; et al. Campylobacter vulpis sp. nov. isolated from wild red foxes. Syst. Appl. Microbiol. 2021, 44, 126204. [Google Scholar] [CrossRef] [Scilit]
- Aydin, F.; Abay, S.; Kayman, T.; Karakaya, E.; Mustak, H.K.; Mustak, I.B.; Bilgen, N.; Goncuoglu, M.; Duzler, A.; Guran, O.; et al. Campylobacter anatolicus sp. nov., a novel member of the genus Campylobacter isolated from feces of Anatolian Ground Squirrel (Spermophilus xanthoprymnus) in Turkey. Syst. Appl. Microbiol. 2021, 44, 126265. [Google Scholar] [CrossRef] [Scilit]
- Silva, M.F.; Pereira, G.; Carneiro, C.; Hemphill, A.; Mateus, L.; Lopes-da-Costa, L.; Silva, E. Campylobacter portucalensis sp. nov., a new species of Campylobacter isolated from the preputial mucosa of bulls. PLoS ONE 2020, 15, e0227500. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bryant, E.; Shen, Z.; Mannion, A.; Patterson, M.; Buczek, J.; Fox, J.G. Campylobacter taeniopygiae sp. nov., Campylobacter aviculae sp. nov., and Campylobacter estrildidarum sp. nov., Novel Species Isolated from Laboratory-Maintained Zebra Finches. Avian Dis. 2020, 64, 457–466. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Boukerb, A.M.; Penny, C.; Serghine, J.; Walczak, C.; Cauchie, H.M.; Miller, W.G.; Losch, S.; Ragimbeau, C.; Mossong, J.; Megraud, F.; et al. Campylobacter armoricus sp. nov., a novel member of the Campylobacter lari group isolated from surface water and stools from humans with enteric infection. Int. J. Syst. Evol. Microbiol. 2019, 69, 3969–3979. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gilbert, M.J.; Zomer, A.L.; Timmerman, A.J.; Spaninks, M.P.; Rubio-Garcia, A.; Rossen, J.W.; Duim, B.; Wagenaar, J.A. Campylobacter blaseri sp. nov., isolated from common seals (Phoca vitulina). Int. J. Syst. Evol. Microbiol. 2018, 68, 1787–1794. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goyal, D.; Watkins, L.K.F.; Montgomery, M.P.; Jones, S.M.B.; Caidi, H.; Friedman, C.R. Antimicrobial susceptibility testing and successful treatment of hospitalised patients with extensively drug-resistant Campylobacter jejuni infections linked to a pet store puppy outbreak. J. Glob. Antimicrob. Resist. 2021, 26, 84–90. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sharma, B.; Thille, K.; Belmar, V.M.; Thomas, R.N.; Sharma, R.N. Molecular detection and genetic characterization of Arcobacter butzleri isolated from red-footed pet tortoises suspected for Campylobacter spp. from Grenada, West Indies. PLoS ONE 2020, 15, e0230390. [Google Scholar] [CrossRef] [Scilit]
- Joseph, L.A.; Francois Watkins, L.K.; Chen, J.; Tagg, K.A.; Bennett, C.; Caidi, H.; Folster, J.P.; Laughlin, M.E.; Koski, L.; Silver, R.; et al. Comparison of Molecular Subtyping and Antimicrobial Resistance Detection Methods Used in a Large Multistate Outbreak of Extensively Drug-Resistant Campylobacter jejuni Infections Linked to Pet Store Puppies. J. Clin. Microbiol. 2020, 58, e00771-20. [Google Scholar] [CrossRef] [Scilit]
- Dipineto, L.; Borrelli, L.; Pace, A.; Romano, V.; D’Orazio, S.; Varriale, L.; Russo, T.P.; Fioretti, A. Campylobacter coli infection in pet birds in southern Italy. Acta Vet. Scand. 2017, 59, 6. [Google Scholar] [CrossRef] [Scilit]
- Bojanić, K.; Midwinter, A.C.; Marshall, J.C.; Rogers, L.E.; Biggs, P.J.; Acke, E. Isolation of Campylobacter spp. from Client-Owned Dogs and Cats, and Retail Raw Meat Pet Food in the Manawatu, New Zealand. Zoonoses Public Health 2017, 64, 438–449. [Google Scholar] [CrossRef] [Scilit]
- Francois Watkins, L.K.; Laughlin, M.E.; Joseph, L.A.; Chen, J.C.; Nichols, M.; Basler, C.; Breazu, R.; Bennett, C.; Koski, L.; Montgomery, M.P.; et al. Ongoing Outbreak of Extensively Drug-Resistant Campylobacter jejuni Infections Associated with US Pet Store Puppies, 2016-2020. JAMA Netw. Open 2021, 4, e2125203. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Zhang, S.; He, M.; Zhang, Y.; Fu, Y.; Liang, H.; Jing, H.; Li, Y.; Ma, H.; Zhang, M. Prevalence and Molecular Characterization of Campylobacter spp. Isolated from Patients with Diarrhea in Shunyi, Beijing. Front. Microbiol. 2018, 9, 52. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Frank, J.A.; Reich, C.I.; Sharma, S.; Weisbaum, J.S.; Wilson, B.A.; Olsen, G.J. Critical evaluation of two primers commonly used for amplification of bacterial 16S rRNA genes. Appl. Environ. Microbiol. 2008, 74, 2461–2470. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Austrian, R. The Gram stain and the etiology of lobar pneumonia, an historical note. Bacteriol. Rev. 1960, 24, 261–265. [Google Scholar] [CrossRef]
- Zhou, G.; Liang, H.; Gu, Y.; Ju, C.; He, L.; Guo, P.; Shao, Z.; Zhang, J.; Zhang, M. Comparative genomics of Helicobacter pullorum from different countries. Gut. Pathog. 2020, 12, 56. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Y.; Gu, Y.; Lv, J.; Liang, H.; Zhang, J.; Zhang, S.; He, M.; Wang, Y.; Ma, H.; French, N.; et al. Laboratory Study on the Gastroenteritis Outbreak Caused by a Multidrug-Resistant Campylobacter coli in China. Foodborne Pathog. Dis. 2020, 17, 187–193. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Seemann, T. Prokka: Rapid prokaryotic genome annotation. Bioinformatics 2014, 30, 2068–2069. [Google Scholar] [CrossRef] [Scilit]
- Lowe, T.M.; Eddy, S.R. tRNAscan-SE: A program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 1997, 25, 955–964. [Google Scholar] [CrossRef]
- Akhter, S.; Aziz, R.K.; Edwards, R.A. PhiSpy: A novel algorithm for finding prophages in bacterial genomes that combines similarity- and composition-based strategies. Nucleic Acids Res. 2012, 40, e126. [Google Scholar] [CrossRef] [Scilit]
- Alcock, B.P.; Raphenya, A.R.; Lau, T.T.Y.; Tsang, K.K.; Bouchard, M.; Edalatmand, A.; Huynh, W.; Nguyen, A.V.; Cheng, A.A.; Liu, S.; et al. CARD 2020: Antibiotic resistome surveillance with the comprehensive antibiotic resistance database. Nucleic Acids Res. 2020, 48, D517–D525. [Google Scholar] [CrossRef] [Scilit]
- Liu, B.; Zheng, D.; Jin, Q.; Chen, L.; Yang, J. VFDB 2019: A comparative pathogenomic platform with an interactive web interface. Nucleic Acids Res. 2019, 47, D687–D692. [Google Scholar] [CrossRef] [Scilit]
- Meier-Kolthoff, J.P.; Carbasse, J.S.; Peinado-Olarte, R.L.; Göker, M. TYGS and LPSN: A database tandem for fast and reliable genome-based classification and nomenclature of prokaryotes. Nucleic Acids Res. 2022, 50, D801–D807. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pritchard, L.; Glover, R.H.; Humphris, S.; Elphinstone, J.G.; Toth, I.K. Genomics and taxonomy in diagnostics for food security: Soft-rotting enterobacterial plant pathogens. Analytical. Methods 2016, 8, 12–24. [Google Scholar] [CrossRef] [Scilit]
- Yoon, S.H.; Ha, S.M.; Kwon, S.; Lim, J.; Kim, Y.; Seo, H.; Chun, J. Introducing EzBioCloud: A taxonomically united database of 16S rRNA gene sequences and whole-genome assemblies. Int. J. Syst. Evol. Microbiol. 2017, 67, 1613–1617. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 2013, 30, 772–780. [Google Scholar] [CrossRef] [Scilit]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [Scilit]
- Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar] [CrossRef] [Scilit]
- Fitch, W.M. Toward Defining the Course of Evolution: Minimum Change for a Specific Tree Topology. Syst. Zool. 1971, 20, 406–416. [Google Scholar] [CrossRef] [Scilit]
- Felsenstein, J. Evolutionary trees from DNA sequences: A maximum likelihood approach. J. Mol. Evol. 1981, 17, 368–376. [Google Scholar] [CrossRef] [Scilit]
- Felsenstein, J. Confidence Limits on Phylogenies: An Approach Using the Bootstrap. Evolution 1985, 39, 783–791. [Google Scholar] [CrossRef] [Scilit]
- Fu, L.; Niu, B.; Zhu, Z.; Wu, S.; Li, W. CD-HIT: Accelerated for clustering the next-generation sequencing data. Bioinformatics 2012, 28, 3150–3152. [Google Scholar] [CrossRef] [Scilit]
- Price, M.N.; Dehal, P.S.; Arkin, A.P. FastTree: Computing large minimum evolution trees with profiles instead of a distance matrix. Mol. Biol. Evol. 2009, 26, 1641–1650. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huson, D.H.; Scornavacca, C. Dendroscope 3: An interactive tool for rooted phylogenetic trees and networks. Syst. Biol. 2012, 61, 1061–1067. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rossi-Tamisier, M.; Benamar, S.; Raoult, D.; Fournier, P.E. Cautionary tale of using 16S rRNA gene sequence similarity values in identification of human-associated bacterial species. Int. J. Syst. Evol. Microbiol. 2015, 65 Pt 6, 1929–1934. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Debruyne, L.; Broman, T.; Bergstrom, S.; Olsen, B.; On, S.L.W.; Vandamme, P. Campylobacter subantarcticus sp. nov., isolated from birds in the sub-Antarctic region. Int. J. Syst. Evol. Microbiol. 2010, 60 Pt 4, 815–819. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Richter, M.; Rosselló-Móra, R. Shifting the genomic gold standard for the prokaryotic species definition. Proc. Natl. Acad. Sci. USA 2009, 106, 19126–19131. [Google Scholar] [CrossRef] [Scilit]
- Zhang, M.; Gu, Y.; He, L.; Ran, L.; Xia, S.; Han, X.; Li, H.; Zhou, H.; Cui, Z.; Zhang, J. Molecular typing and antimicrobial susceptibility profiles of Campylobacter jejuni isolates from north China. J. Med. Microbiol. 2010, 59 Pt 10, 1171–1177. [Google Scholar] [CrossRef] [Scilit]
- On, S.L.W.; Miller, W.G.; Houf, K.; Fox, J.G.; Vandamme, P. Minimal standards for describing new species belonging to the families Campylobacteraceae and Helicobacteraceae: Campylobacter, Arcobacter, Helicobacter and Wolinella spp. Int. J. Syst. Evol. Microbiol. 2017, 67, 5296–5311. [Google Scholar] [CrossRef] [Scilit]




| Target | Sequence(5′–3′) a | Target Gene/Region | Reference |
|---|---|---|---|
| Campylobacter spp. | 27F: AGAGTTTGATCCTGGCTCAG | 16S rRNA gene | [8] |
| 1492R: CGGTTACCTTGTTACGACTT | |||
| C. felis sp. nov. | F: GCGCCATCTTGGACGAGTAT | Putative hydrolase YxeP gene | This study |
| R: GGGCAGGGCGTCCATATC | |||
| P: FAM-CGCGAAGGAGGACGCAGGGA-BHQ1 | |||
| C. ovis sp. nov. | F: TGAAGCTGGAGAAAGTGGCC | Hypothetical protein gene | This study |
| R: TCCTATTATGGCGCCAGCTG | |||
| P: FAM-CAACCCTAAGTAGCGGAAGCGGTGG-BHQ1 |
| Isolate | Species | Isolation Date | Isolation Country: City | Host | Source | 16S rRNA Gene Accesion Number | Accession Number |
|---|---|---|---|---|---|---|---|
| XJK22-1 | C. felis | 2019 | China: BeiJing | cat | feces | OP278862 | JANURX000000000 |
| XJK33-1 | C. felis | 2019 | China: BeiJing | cat | feces | OP278861 | JANURU000000000 |
| XJK49-2 | C. felis | 2019 | China: BeiJing | cat | feces | OP278863 | JANURW000000000 |
| XJK56-3 | C. felis | 2019 | China: BeiJing | cat | feces | OP278858 | JANURS000000000 |
| XJK62-3 | C. felis | 2019 | China: BeiJing | cat | feces | OP278859 | JANURT000000000 |
| XJK7-1 | C. felis | 2019 | China: BeiJing | cat | feces | OP278860 | JANURV000000000 |
| S13-1 | C. ovis | 2020 | China: BeiJing | Sheep | feces | OP278865 | JANURP000000000 |
| SYS25-1 | C. ovis | 2019 | China: BeiJing | Sheep | feces | OP278866 | JANURR000000000 |
| SYS28-3 | C. ovis | 2019 | China: BeiJing | Sheep | feces | OP278867 | JANURQ000000000 |
| RM8835 | C. ovis | 2009 | USA: California | Alpaca | feces | OP821422 | MJLL01000000 |
| RM8965 | C. ovis | 2009 | USA: California | Goat | feces | OP821424 | MJLM01000000 |
| RM8966 | C. ovis | 2009 | USA: California | Goat | feces | OP821425 | MJLN01000000 |
| RM9262 | C. ovis | 2009 | USA: California | Alpaca | feces | OP821428 | MJLQ01000000 |
| S0112 | C. ovis | 2013 | UK: Scotland | Sheep | feces | OP821431 | MJLS01000000 |
| RM8970 | C. ovis | 2009 | USA: California | Goat | feces | OP821426 | MJLO01000000 |
| RM9263 | C. ovis | 2009 | USA: California | Alpaca | feces | OP821429 | MJLR01000000 |
| RM9261 | C. ovis | 2009 | USA: California | Alpaca | feces | OP821427 | MJLP01000000 |
| RM12175 | C. ovis | 2010 | USA: California | Alpaca | feces | OP821430 | CP018793 |
| RM8964 | C. ovis | 2009 | USA: California | Goat | feces | OP821423 | CP018791 |
| Species | Isolate | Catalase | Oxidase | URE | NIT | EST | HIP | GGT | TTC | PyrA | ArgA | AspA | PAL | H2S |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| C. felis | XJK22-1 | − | + | − | + | + | + | − | − | − | + | + | + | − |
| C. felis | XJK33-1 | − | + | − | + | + | + | − | − | − | + | + | + | − |
| C. felis | XJK49-2 | − | + | − | + | + | + | − | − | − | + | + | + | − |
| C. felis | XJK56-3 | − | + | − | + | + | + | − | − | − | + | + | + | − |
| C. felis | XJK62-3 | − | + | − | + | + | + | − | − | − | + | + | + | − |
| C. felis | XJK7-1 | − | + | − | + | + | + | − | − | − | + | + | + | − |
| C. ovis | S13-1 | + | + | − | + | − | − | + | − | − | + | − | + | − |
| C. ovis | SYS25-1 | + | + | − | + | − | − | + | − | − | + | − | + | − |
| C. ovis | SYS28-3 | + | + | − | − | − | − | + | − | − | + | − | + | − |
| C. upsaliensis | CCUG 14913 | − | + | − | + | + | − | − | − | − | + | + | + | − |
| C. coli | ATCC 33559 | + | + | − | − | + | − | − | − | − | + | − | + | − |
| C. concisus | ATCC 33237 | − | − | − | − | − | − | − | − | + | − | + | ||
| C. gracilis | ATCC 33236 | − | − | + | − | + | − | − | + | + | − | + | ||
| C. helveticus | CPD4-1 | − | + | − | + | + | + | + | − | − | − | − | − | − |
| C. hyointestinalis | ATCC 35217 | + | + | − | − | − | − | + | − | − | − | − | + | − |
| C. jejuni subsp. doylei | ATCC 49349 | − | − | + | + | + | + | + | − | − | + | − | ||
| C. jejuni subsp. jejuni | ATCC 33560 | + | + | − | − | + | + | − | − | − | − | − | + | − |
| C. lari | ATCC 35221 | + | + | − | + | − | − | + | − | − | + | − | − | − |
| C. rectus | ATCC 33238 | − | − | + | − | − | − | − | + | + | + | − | ||
| C. showae | ATCC 51146 | − | − | + | − | + | − | − | + | + | − | + | ||
| C. jejuni subsp. jejuni | NCTC 11168 | − | + | + | + | − | − | + | − | − | + | − | ||
| C. upsaliensisa | CCUG 14913 | − | + | − | + | + | − | − | − | − | + | + | + | − |
| C. lanienaea | CCUG 44467 | + | + | − | + | +/− | − | − | + | − | +/− | − | + | − |
| Strain | Contigs | Bases | GC Content | CDS | rRNA | CRISPR | tRNA |
|---|---|---|---|---|---|---|---|
| XJK22-1 | 42 | 1,700,455 | 34.99% | 1747 | 2 | - | 43 |
| XJK33-1 | 53 | 1,666,017 | 35.05% | 1707 | 2 | - | 43 |
| XJK49-2 | 37 | 1,640,989 | 35.10% | 1711 | 4 | - | 44 |
| XJK56-3 | 39 | 1,664,700 | 35.03% | 1693 | 2 | - | 42 |
| XJK62-3 | 42 | 1,750,246 | 34.90% | 1841 | 2 | - | 43 |
| XJK7-1 | 51 | 1,668,760 | 35.04% | 1710 | 3 | - | 44 |
| S13-1 | 51 | 1,442,012 | 32.69% | 1454 | 3 | 1 | 37 |
| SYS25-1 | 10 | 1,580,362 | 32.43% | 1567 | 1 | 1 | 38 |
| SYS28-3 | 17 | 1,590,016 | 32.43% | 1576 | 2 | 1 | 39 |
| RM8835 | 49 | 1,694,176 | 32.21% | 1722 | 2 | 2 | 39 |
| RM8965 | 28 | 1,502,748 | 32.45% | 1499 | 2 | 1 | 38 |
| RM8966 | 62 | 1,608,325 | 32.33% | 1601 | 2 | 3 | 39 |
| RM9262 | 86 | 1,707,487 | 32.11% | 1738 | 2 | 2 | 33 |
| S0112 | 18 | 1,533,040 | 32.28% | 1545 | 2 | 2 | 39 |
| RM8970 | 44 | 1,496,869 | 32.43% | 1493 | 2 | 1 | 32 |
| RM9263 | 59 | 1,632,618 | 32.31% | 1680 | 2 | 2 | 39 |
| RM9261 | 66 | 1,634,929 | 32.31% | 1673 | 2 | 2 | 39 |
| RM12175 | 3 | 1,612,610 | 32.40% | 1645 | 6 | 3 | 40 |
| RM8964 | 2 | 1,754,294 | 32.08% | 1771 | 6 | 1 | 41 |
| (A) Campylobacter felis sp. nov. Strains with Their Closely Related Campylobacter Species. | |||||||||
| XJK22-1 | XJK33-1 | XJK49-2 | XJK56-3 | XJK62-3 | XJK7-1 | C. helveticus | C. upsaliensis | C. vulpis | |
| XJK22-1 | 80.50% | 73.80% | 79.30% | 82.20% | 80.70% | 31.90% | 57.70% | 39.60% | |
| XJK33-1 | 97.70% | 74.40% | 94.00% | 78.90% | 93.60% | 31.60% | 58.10% | 39.00% | |
| XJK49-2 | 97.01% | 97.10% | 74.60% | 74.30% | 74.40% | 31.30% | 57.30% | 38.90% | |
| XJK56-3 | 97.60% | 99.26% | 96.98% | 78.80% | 91.30% | 31.50% | 58.30% | 38.90% | |
| XJK62-3 | 97.94% | 97.60% | 96.92% | 97.60% | 79.30% | 32.90% | 57.50% | 38.70% | |
| XJK7-1 | 97.78% | 99.18% | 97.01% | 98.98% | 97.62% | 31.70% | 58.10% | 39.00% | |
| C. helveticus | 86.55% | 86.60% | 86.45% | 86.59% | 87.21% | 86.61% | 29.90% | 28.50% | |
| C. upsaliensis | 94.45% | 94.71% | 94.54% | 94.74% | 94.58% | 94.71% | 85.53% | 40.20% | |
| C. vulpis | 89.92% | 89.74% | 89.70% | 89.74% | 89.64% | 89.77% | 84.51% | 89.90% | |
| (B) Campylobacter ovis sp. nov. strains with their closely related Campylobacter species. | ||||||||||||||||
| S13-1 | SYS25-1 | SYS28-3 | RM8835 | RM8965 | RM8966 | RM9262 | S0112 | RM8970 | RM9263 | RM9261 | RM12175 | RM8964 | C. hyointestinalis subsp. lawsonii | C. infantis | C. lanienae | |
| S13-1 | 75.10% | 75.00% | 75.20% | 74.20% | 74.30% | 75.60% | 78.30% | 74.70% | 75.30% | 75.30% | 75.30% | 74.30% | 19.40% | 21.50% | 25.10% | |
| SYS25-1 | 97.14% | 99.60% | 77.30% | 81.50% | 80.70% | 78.10% | 74.80% | 80.60% | 78.10% | 78.10% | 77.40% | 79.60% | 19.50% | 18.60% | 25.00% | |
| SYS28-3 | 97.09% | 99.91% | 77.10% | 81.30% | 80.50% | 78.00% | 74.60% | 80.50% | 78.10% | 78.00% | 77.30% | 79.50% | 19.70% | 19.30% | 25.10% | |
| RM8835 | 97.15% | 97.34% | 97.36% | 76.90% | 76.70% | 88.20% | 75.40% | 77.50% | 86.00% | 86.00% | 84.00% | 75.10% | 19.70% | 20.90% | 25.20% | |
| RM8965 | 96.98% | 97.84% | 97.86% | 97.41% | 80.80% | 77.60% | 73.70% | 83.30% | 77.60% | 77.60% | 77.30% | 83.00% | 19.40% | 21.60% | 25.10% | |
| RM8966 | 96.97% | 97.80% | 97.79% | 97.31% | 97.83% | 77.90% | 74.10% | 80.80% | 77.70% | 77.60% | 77.30% | 81.20% | 19.70% | 19.90% | 25.20% | |
| RM9262 | 97.14% | 97.43% | 97.44% | 98.61% | 97.44% | 97.34% | 75.60% | 78.20% | 93.70% | 93.70% | 92.60% | 75.80% | 20.30% | 22.10% | 25.20% | |
| S0112 | 97.51% | 97.10% | 97.12% | 97.18% | 96.99% | 97.07% | 97.24% | 75.00% | 75.00% | 75.00% | 75.30% | 74.10% | 19.80% | 21.50% | 25.00% | |
| RM8970 | 97.03% | 97.75% | 97.78% | 97.36% | 98.02% | 97.79% | 97.47% | 97.11% | 78.30% | 78.20% | 78.00% | 83.60% | 19.30% | 20.60% | 25.10% | |
| RM9263 | 97.15% | 97.45% | 97.44% | 98.37% | 97.48% | 97.36% | 99.25% | 97.16% | 97.54% | 100.00% | 95.30% | 75.80% | 20.00% | 22.00% | 25.10% | |
| RM9261 | 97.10% | 97.38% | 97.40% | 98.33% | 97.46% | 97.31% | 99.22% | 97.14% | 97.44% | 99.99% | 95.30% | 75.70% | 20.00% | 22.00% | 25.10% | |
| RM12175 | 97.15% | 97.49% | 97.53% | 98.18% | 97.47% | 97.41% | 99.16% | 97.22% | 97.51% | 99.44% | 99.43% | 77.20% | 20.10% | 23.50% | 25.20% | |
| RM8964 | 97.06% | 97.70% | 97.72% | 97.16% | 98.02% | 97.84% | 97.31% | 97.06% | 98.04% | 97.27% | 97.27% | 97.41% | 19.60% | 23.50% | 25.20% | |
| C. hyointestinalis subsp. lawsonii | 72.25% | 72.22% | 72.34% | 72.39% | 72.21% | 72.36% | 72.44% | 72.25% | 72.13% | 72.29% | 72.31% | 72.34% | 72.17% | 21.30% | 22.80% | |
| C. infantis | 68.44% | 68.23% | 68.40% | 68.26% | 68.33% | 68.24% | 68.32% | 68.38% | 68.39% | 68.26% | 68.24% | 68.34% | 68.35% | 68.09% | 20.90% | |
| C. lanienae | 82.30% | 82.36% | 82.43% | 82.44% | 82.43% | 82.34% | 82.32% | 82.27% | 82.51% | 82.32% | 82.32% | 82.34% | 82.44% | 74.01% | 68.58% | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, H.; Li, Y.; Gu, Y.; Zhou, G.; Chen, X.; Zhang, X.; Shao, Z.; Zhang, J.; Zhang, M. Isolation and Genomic Characteristics of Cat-Borne Campylobacter felis sp. nov. and Sheep-Borne Campylobacter ovis sp. nov. Microorganisms 2023, 11, 971. https://doi.org/10.3390/microorganisms11040971
Wang H, Li Y, Gu Y, Zhou G, Chen X, Zhang X, Shao Z, Zhang J, Zhang M. Isolation and Genomic Characteristics of Cat-Borne Campylobacter felis sp. nov. and Sheep-Borne Campylobacter ovis sp. nov. Microorganisms. 2023; 11(4):971. https://doi.org/10.3390/microorganisms11040971
Chicago/Turabian StyleWang, Hairui, Ying Li, Yixin Gu, Guilan Zhou, Xiaoli Chen, Xin Zhang, Zhujun Shao, Jianzhong Zhang, and Maojun Zhang. 2023. "Isolation and Genomic Characteristics of Cat-Borne Campylobacter felis sp. nov. and Sheep-Borne Campylobacter ovis sp. nov" Microorganisms 11, no. 4: 971. https://doi.org/10.3390/microorganisms11040971
APA StyleWang, H., Li, Y., Gu, Y., Zhou, G., Chen, X., Zhang, X., Shao, Z., Zhang, J., & Zhang, M. (2023). Isolation and Genomic Characteristics of Cat-Borne Campylobacter felis sp. nov. and Sheep-Borne Campylobacter ovis sp. nov. Microorganisms, 11(4), 971. https://doi.org/10.3390/microorganisms11040971

