Effects of Dietary β-Glucan Feeding Strategy on the Growth, Physiological Response, and Gut Microbiota of Pacific White Shrimp, Litopenaeus vannamei, under Low Salinity
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Diets
2.2. Experimental Design, Growth Trial, and Sampling
2.3. Antioxidant Enzyme Activities
2.4. Gene Expression Analysis
2.5. Gut Microbiota Analysis
2.6. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Antioxidant Capacity
3.3. Immunity Gene Expression
3.4. Gut Microbiota
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Sriket, P.; Benjakul, S.; Visessanguan, W.; Kijroongrojana, K. Comparative studies on the effect of the freeze–thawing process on the physicochemical properties and microstructures of black tiger shrimp (Penaeus monodon) and white shrimp (Penaeus vannamei) muscle. Food Chem. 2007, 104, 113–121. [Google Scholar] [CrossRef] [Scilit]
- Yuan, Y.; Luo, J.; Zhu, T.; Jin, M.; Jiao, L.; Sun, P.; Ward, T.L.; Ji, F.; Xu, G.; Zhou, Q. Alteration of growth performance, meat quality, antioxidant and immune capacity of juvenile Litopenaeus vannamei in response to different dietary dosage forms of zinc: Comparative advantages of zinc amino acid complex. Aquaculture 2020, 522, 735120. [Google Scholar] [CrossRef] [Scilit]
- FAO. The State of World Fisheries and Aquaculture 2020; Food and Agriculture Organization of the United Nations: Rome, Italy, 2020; ISBN 978-92-5-132692-3. [Google Scholar]
- Flores, M.; Díaz, F.; Medina, R.; Re, A.D.; Licea, A. Physiological, metabolic and haematological responses in white shrimp Litopenaeus vannamei (Boone) juveniles fed diets supplemented with astaxanthin acclimated to low-salinity water. Aquac. Res. 2007, 38, 740–747. [Google Scholar] [CrossRef] [Scilit]
- Ciji, A.; Akhtar, M.S. Stress management in aquaculture: A review of dietary interventions. Rev. Aquac. 2021, 13, 2190–2247. [Google Scholar] [CrossRef] [Scilit]
- Wang, F.-I.; Chen, J.-C. Effect of salinity on the immune response of tiger shrimp Penaeus monodon and its susceptibility to Photobacterium damselae subsp. damselae. Fish Shellfish. Immunol. 2006, 20, 671–681. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, C.; Li, E.; Liu, Y.; Wang, X.; Qin, J.G.; Chen, L. Comparative proteome analysis of the hepatopancreas from the Pacific white shrimp Litopenaeus vannamei under long-term low salinity stress. J. Proteom. 2017, 162, 1–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dawood, M.A.O.; Koshio, S.; Ishikawa, M.; Yokoyama, S.; El Basuini, M.F.; Hossain, M.S.; Nhu, T.H.; Moss, A.S.; Dossou, S.; Wei, H. Dietary supplementation of β-glucan improves growth performance, the innate immune response and stress resistance of red sea bream, Pagrus major. Aquac. Nutr. 2017, 23, 148–159. [Google Scholar] [CrossRef] [Scilit]
- NRC National Research Council (NRC). Nutrient requirements of fish and shrimp. Aquac. Int. 2011, 20, 601–602. [Google Scholar]
- Tahmasebi-Kohyani, A.; Keyvanshokooh, S.; Nematollahi, A.; Mahmoudi, N.; Pasha-Zanoosi, H. Effects of dietary nucleotides supplementation on rainbow trout (Oncorhynchus mykiss) performance and acute stress response. Fish Physiol. Biochem. 2012, 38, 431–440. [Google Scholar] [CrossRef] [Scilit]
- Zhang, J.; Liu, Y.; Tian, L.; Yang, H.; Liang, G.; Xu, D. Effects of dietary mannan oligosaccharide on growth performance, gut morphology and stress tolerance of juvenile Pacific white shrimp, Litopenaeus vannamei. Fish Shellfish Immunol. 2012, 33, 1027–1032. [Google Scholar] [CrossRef] [Scilit]
- Dash, P.; Avunje, S.; Tandel, R.S.; Sandeep, K.P.; Panigrahi, A. Biocontrol of Luminous Vibriosis in Shrimp Aquaculture: A Review of Current Approaches and Future Perspectives. Rev. Fish. Sci. Aquac. 2017, 25, 245–255. [Google Scholar] [CrossRef] [Scilit]
- Montero-Rocha, A.; McIntosh, D.; Sánchez-Merino, R.; Flores, I. Immunostimulation of white shrimp (Litopenaeus vannamei) following dietary administration of Ergosan. J. Invertebr. Pathol. 2006, 91, 188–194. [Google Scholar] [CrossRef] [Scilit]
- Chiu, S.-T.; Tsai, R.-T.; Hsu, J.-P.; Liu, C.-H.; Cheng, W. Dietary sodium alginate administration to enhance the non-specific immune responses, and disease resistance of the juvenile grouper Epinephelus fuscoguttatus. Aquaculture 2008, 277, 66–72. [Google Scholar] [CrossRef] [Scilit]
- Heidarieh, M.; Afsharnasab, M.; Soltani, M.; Dashtyanna, A.; Rajabifar, S.; Sheikhzade, N.; Tamimi, A. Effects of Ergosan and Vibromax to Prevent Vibriosis and WSSV in Litopeaneus vannamei. J. Fish. Aquat. Sci. 2010, 5, 120–125. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.-C.; Chang, P.-S.; Chen, H.-Y. Differential time-series expression of immune-related genes of Pacific white shrimp Litopenaeus vannamei in response to dietary inclusion of β-1,3-glucan. Fish Shellfish Immunol. 2008, 24, 113–121. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Xu, C.; Zhou, L.; Dong, Y.; Su, Y.; Wang, X.; Qin, J.G.; Chen, L.; Li, E. Beneficial effects of dietary β-glucan on growth and health status of Pacific white shrimp Litopenaeus vannamei at low salinity. Fish Shellfish Immunol. 2019, 91, 315–324. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Liu, H.; Dai, X.; Li, J.; Ding, F. Effects of dietary inulin and mannan oligosaccharide on immune related genes expression and disease resistance of Pacific white shrimp, Litopenaeus vannamei. Fish Shellfish Immunol. 2018, 76, 78–92. [Google Scholar] [CrossRef] [Scilit]
- Zhou, L.; Li, H.; Qin, J.G.; Wang, X.; Chen, L.; Xu, C.; Li, E. Dietary prebiotic inulin benefits on growth performance, antioxidant capacity, immune response and intestinal microbiota in Pacific white shrimp (Litopenaeus vannamei) at low salinity. Aquaculture 2020, 518, 734847. [Google Scholar] [CrossRef] [Scilit]
- Zhou, Z.; Ding, Z.; Huiyuan, L. Effects of Dietary Short-chain Fructooligosaccharides on Intestinal Microflora, Survival, and Growth Performance of Juvenile White Shrimp, Litopenaeus vannamei. J. World Aquac. Soc. 2007, 38, 296–301. [Google Scholar] [CrossRef] [Scilit]
- Bai, J.; Ren, Y.; Li, Y.; Fan, M.; Qian, H.; Wang, L.; Wu, G.; Zhang, H.; Qi, X.; Xu, M.; et al. Physiological functionalities and mechanisms of β-glucans. Trends Food Sci. Technol. 2019, 88, 57–66. [Google Scholar] [CrossRef] [Scilit]
- Sang, H.; Fotedar, R. Effects of dietary β-1,3-glucan on the growth, survival, physiological and immune response of marron, Cherax tenuimanus (smith, 1912). Fish Shellfish Immunol. 2010, 28, 957–960. [Google Scholar] [CrossRef] [Scilit]
- Sung, H.H.; Kou, G.H.; Song, Y.L. Vibriosis Resistance Induced by Glucan Treatment in Tiger Shrimp (Penaeus monodon). Fish Pathol. 1994, 29, 11–17. [Google Scholar] [CrossRef] [Scilit]
- Pilarski, F.; Oliveira, C.; Souza, F.; Zanuzzo, F. Different β-glucans improve the growth performance and bacterial resistance in Nile tilapia. Fish Shellfish Immunol. 2017, 70, 25–29. [Google Scholar] [CrossRef] [Scilit]
- Qiao, Y.; Zhou, L.; Qu, Y.; Lu, K.; Han, F.; Li, E. Effects of Different Dietary β-Glucan Levels on Antioxidant Capacity and Immunity, Gut Microbiota and Transcriptome Responses of White Shrimp (Litopenaeus vannamei) under Low Salinity. Antioxidants 2022, 11, 2282. [Google Scholar] [CrossRef] [Scilit]
- Udayangani, R.M.C.; Dananjaya, S.H.S.; Fronte, B.; Kim, C.-H.; Lee, J.; De Zoysa, M. Feeding of nano scale oats β-glucan enhances the host resistance against Edwardsiella tarda and protective immune modulation in zebrafish larvae. Fish Shellfish Immunol. 2017, 60, 72–77. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Eissa, E.-S.H.; Ahmed, R.A.; Abd Elghany, N.A.; Elfeky, A.; Saadony, S.; Ahmed, N.H.; Sakr, S.E.-S.; Dayrit, G.B.; Tolenada, C.P.S.; Atienza, A.A.C.; et al. Potential Symbiotic Effects of β-1,3 Glucan, and Fructooligosaccharides on the Growth Performance, Immune Response, Redox Status, and Resistance of Pacific White Shrimp, Litopenaeus vannamei to Fusarium solani Infection. Fishes 2023, 8, 105. [Google Scholar] [CrossRef] [Scilit]
- Herrera, M.; Mancera, J.M.; Costas, B. The Use of Dietary Additives in Fish Stress Mitigation: Comparative Endocrine and Physiological Responses. Front. Endocrinol. 2019, 10, 447. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Q.; Sheng, X.; Shi, A.; Hu, H.; Yang, Y.; Liu, L.; Fei, L.; Liu, H. β-Glucans: Relationships between Modification, Conformation and Functional Activities. Molecules 2017, 22, 257. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shan, H.; Wang, T.; Dong, Y.; Ma, S. Effects of dietary Ampithoe sp. supplementation on the growth, energy status, antioxidant capacity, and ammonia-N tolerance of the shrimp Litopenaeus vannamei: Continuous versus interval feeding. Aquaculture 2019, 509, 32–39. [Google Scholar] [CrossRef] [Scilit]
- Bai, N.; Zhang, W.; Mai, K.; Wang, X.; Xu, W.; Ma, H. Effects of discontinuous administration of β-glucan and glycyrrhizin on the growth and immunity of white shrimp Litopenaeus vannamei. Aquaculture 2010, 306, 218–224. [Google Scholar] [CrossRef] [Scilit]
- Bricknell, I.; Dalmo, R.A. The use of immunostimulants in fish larval aquaculture. Fish Shellfish Immunol. 2005, 19, 457–472. [Google Scholar] [CrossRef] [Scilit]
- López, N.; Cuzon, G.; Gaxiola, G.; Taboada, G.; Valenzuela, M.; Pascual, C.; Sánchez, A.; Rosas, C. Physiological, nutritional, and immunological role of dietary β 1-3 glucan and ascorbic acid 2-monophosphate in Litopenaeus vannamei juveniles. Aquaculture 2003, 224, 223–243. [Google Scholar] [CrossRef] [Scilit]
- Sajeevan, T.P.; Philip, R.; Bright Singh, I.S. Dose/frequency: A critical factor in the administration of glucan as immunostimulant to Indian white shrimp Fenneropenaeus indicus. Aquaculture 2009, 287, 248–252. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Q.; Yang, H.; Teame, T.; Ran, C.; Yang, Y.; Yao, Y.; Ding, Q.; Liu, S.; Li, S.; Zhang, Z.; et al. Immune disorders induced by improper use of dietary immunostimulants in aquatic animals: Research progress and prospective solutions by targeting gut microbiota. Rev. Aquac. 2023, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Xu, W.-N.; Chen, D.-H.; Chen, Q.-Q.; Liu, W.-B. Growth performance, innate immune responses and disease resistance of fingerling blunt snout bream, Megalobrama amblycephala adapted to different berberine-dietary feeding modes. Fish Shellfish Immunol. 2017, 68, 458–465. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, Y.; Wang, C.; Wang, A.; Yang, W.; Lv, F.; Liu, F.; Liu, B.; Sun, C. Effects of various feeding patterns of Bacillus coagulans on growth performance, antioxidant response and Nrf2-Keap1 signaling pathway in juvenile gibel carp (Carassius auratus gibelio). Fish Shellfish Immunol. 2018, 73, 75–83. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, C.-N.; Li, X.-F.; Jiang, G.-Z.; Zhang, D.-D.; Tian, H.-Y.; Li, J.-Y.; Liu, W.-B. Effects of dietary fructooligosaccharide levels and feeding modes on growth, immune responses, antioxidant capability and disease resistance of blunt snout bream (Megalobrama amblycephala). Fish Shellfish Immunol. 2014, 41, 560–569. [Google Scholar] [CrossRef] [Scilit]
- Sakai, M. Current research status of fish immunostimulants. Aquaculture 1999, 172, 63–92. [Google Scholar] [CrossRef] [Scilit]
- Chang, C.F.; Chen, H.Y.; Su, M.S.; Liao, I.C. Immunomodulation by dietary beta-1, 3-glucan in the brooders of the black tiger shrimp Penaeus monodon. Fish Shellfish Immunol. 2000, 10, 505–514. [Google Scholar] [CrossRef] [Scilit]
- Douxfils, J.; Fierro-Castro, C.; Mandiki, S.N.M.; Emile, W.; Tort, L.; Kestemont, P. Dietary β-glucans differentially modulate immune and stress-related gene expression in lymphoid organs from healthy and Aeromonas hydrophila-infected rainbow trout (Oncorhynchus mykiss). Fish Shellfish Immunol. 2017, 63, 285–296. [Google Scholar] [CrossRef] [Scilit]
- AOAC. The Association of Official Analytical Chemists (AOAC). J. Am. Oil Chem. Soc. 1990, 54, 171–172. [Google Scholar]
- Ebeling, M.E. The Dumas Method for Nitrogen in Feeds. J. AOAC Int. 1968, 51, 766–770. [Google Scholar] [CrossRef] [Scilit]
- Xu, Z.; Wang, Y.; Gul, Y.; Li, Q.; Song, J.; Hu, M. Effects of copper supplement on the immune function and blood-chemistry in adult Chinese horseshoe crab Tachypleus tridentatus. Aquaculture 2020, 515, 734576. [Google Scholar] [CrossRef] [Scilit]
- Yu, Q.; Fu, Z.; Huang, M.; Xu, C.; Wang, X.; Qin, J.G.; Chen, L.; Han, F.; Li, E. Growth, physiological, biochemical, and molecular responses of Pacific white shrimp Litopenaeus vannamei fed different levels of dietary selenium. Aquaculture 2021, 535, 736393. [Google Scholar] [CrossRef] [Scilit]
- Benzie, I.F.; Strain, J.J. The Ferric Reducing Ability of Plasma (FRAP) as a Measure of “Antioxidant Power”: The FRAP Assay. Anal. Biochem. 1996, 239, 70–76. [Google Scholar] [CrossRef] [Scilit]
- Asakawa, T.; Matsushita, S. Thiobarbituric Acid Test for Detecting Lipid Peroxides. Lipids 1979, 14, 401–406. [Google Scholar] [CrossRef] [Scilit]
- Han, F.; Wang, X.; Guo, J.; Qi, C.; Xu, C.; Luo, Y.; Li, E.-C.; Qin, J.; Chen, L. Effects of glycinin and β-conglycinin on growth performance and intestinal health in juvenile Chinese mitten crabs (Eriocheir sinensis). Fish Shellfish Immunol. 2018, 84, 269–279. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Duan, Y.; Wang, Y.; Dong, H.; Ding, X.; Liu, Q.; Li, H.; Zhang, J.; Xiong, D. Changes in the Intestine Microbial, Digestive, and Immune-Related Genes of Litopenaeus vannamei in Response to Dietary Probiotic Clostridium butyricum Supplementation. Front. Microbiol. 2018, 9, 2191. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, J.; Wang, W.-N.; He, W.-Y.; Zheng, Y.; Wang, L.; Xin, Y.; Liu, Y.; Wang, A.-L. Expression of HSP60 and HSP70 in white shrimp, Litopenaeus vannamei in response to bacterial challenge. J. Invertebr. Pathol. 2010, 103, 170–178. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jin, M.; Xiong, J.; Zhou, Q.-C.; Yuan, Y.; Wang, X.-X.; Sun, P. Dietary yeast hydrolysate and brewer’s yeast supplementation could enhance growth performance, innate immunity capacity and ammonia nitrogen stress resistance ability of Pacific white shrimp (Litopenaeus vannamei). Fish Shellfish Immunol. 2018, 82, 121–129. [Google Scholar] [CrossRef] [Scilit]
- Sha, Y.; Wang, L.; Liu, M.; Jiang, K.; Xin, F.; Wang, B. Effects of lactic acid bacteria and the corresponding supernatant on the survival, growth performance, immune response and disease resistance of Litopenaeus vannamei. Aquaculture 2016, 452, 28–36. [Google Scholar] [CrossRef] [Scilit]
- Miandare, H.K.; Mirghaed, A.T.; Hosseini, M.; Mazloumi, N.; Zargar, A.; Nazari, S. Dietary Immunogen® modulated digestive enzyme activity and immune gene expression in Litopenaeus vannamei post larvae. Fish Shellfish Immunol. 2017, 70, 621–627. [Google Scholar] [CrossRef] [Scilit]
- Duan, Y.; Zhang, Y.; Dong, H.; Wang, Y.; Zheng, X.; Zhang, J. Effect of dietary Clostridium butyricum on growth, intestine health status and resistance to ammonia stress in Pacific white shrimp Litopenaeus vannamei. Fish Shellfish Immunol. 2017, 65, 25–33. [Google Scholar] [CrossRef] [Scilit]
- Gao, J.; Zuo, H.; Yang, L.; He, J.-H.; Niu, S.; Weng, S.; He, J.; Xu, X. Long-term influence of cyanobacterial bloom on the immune system of Litopenaeus vannamei. Fish Shellfish Immunol. 2017, 61, 79–85. [Google Scholar] [CrossRef] [Scilit]
- Ji, L.; Sun, G.; Li, J.; Wang, Y.; Du, Y.; Li, X.; Liu, Y. Effect of dietary β-glucan on growth, survival and regulation of immune processes in rainbow trout (Oncorhynchus mykiss) infected by Aeromonas salmonicida. Fish Shellfish Immunol. 2017, 64, 56–67. [Google Scholar] [CrossRef] [Scilit]
- Khanjani, M.H.; Ghaedi, G.; Sharifinia, M. Effects of diets containing β-glucan on survival, growth performance, haematological, immunity and biochemical parameters of rainbow trout (Oncorhynchus mykiss) fingerlings. Aquac. Res. 2021, 53, 1842–1850. [Google Scholar] [CrossRef] [Scilit]
- Cao, H.; Yu, R.; Zhang, Y.; Hu, B.; Jian, S.; Wen, C.; Kajbaf, K.; Kumar, V.; Yang, G. Effects of dietary supplementation with β-glucan and Bacillus subtilis on growth, fillet quality, immune capacity, and antioxidant status of Pengze crucian carp (Carassius auratus var. Pengze). Aquaculture 2019, 508, 106–112. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Chang, H.; Han, D.; Lu, S.; Lv, W.; Guo, K.; Wang, C.; Li, S.; Han, S.; Liu, H. Effects of dietary chrysophyte (Poterioochromonas malhamensis) rich in beta-glucan on the growth performance, intestinal health, lipid metabolism, immune gene expression, and disease resistance against Aeromonas salmonicida in juvenile rainbow trout (Oncorhynchus mykiss). Aquaculture 2022, 561, 738589. [Google Scholar]
- de Souza, F.P.; Lima, E.C.S.; de Pandolfi, V.C.F.; Leite, N.G.; Furlan-Murari, P.J.; Leal, C.N.S.; Mainardi, R.M.; Suphoronski, S.A.; Favero, L.M.; Koch, J.F.A.; et al. Effect of β-glucan in water on growth performance, blood status and intestinal microbiota in tilapia under hypoxia. Aquac. Rep. 2020, 17, 100369. [Google Scholar] [CrossRef] [Scilit]
- Cornet, V.; Khuyen, T.D.; Mandiki, S.N.M.; Betoulle, S.; Bossier, P.; Reyes-López, F.E.; Tort, L.; Kestemont, P. GAS1: A New β-Glucan Immunostimulant Candidate to Increase Rainbow Trout (Oncorhynchus mykiss) Resistance to Bacterial Infections with Aeromonas salmonicida achromogenes. Front. Immunol. 2021, 12, 693613. [Google Scholar] [CrossRef] [Scilit]
- Chang, C.-F.; Su, M.-S.; Chen, H.-Y.; Liao, I.-C. Dietary β-1,3-glucan effectively improves immunity and survival of Penaeus monodon challenged with white spot syndrome virus. Fish Shellfish Immunol. 2003, 15, 297–310. [Google Scholar] [CrossRef] [Scilit]
- Chang, J.; Zhang, W.; Mai, K.; Ma, H.; Xu, W. Effects of dietary β-glucan and glycyrrhizin on non-specific immunity and disease resistance of the sea cucumber (Apostichopus japonicus Selenka) challenged with Vibrio splendidus. J. Ocean Univ. China 2010, 9, 389–394. [Google Scholar] [CrossRef] [Scilit]
- Ji, P.-F.; Yao, C.-L.; Wang, Z.-Y. Reactive oxygen system plays an important role in shrimp Litopenaeus vannamei defense against Vibrio parahaemolyticus and WSSV infection. Dis. Aquat. Organ. 2011, 96, 9–20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Parrilla-Taylor, D.P.; Zenteno-Savín, T.; Magallón-Barajas, F.J. Antioxidant enzyme activity in pacific whiteleg shrimp (Litopenaeus vannamei) in response to infection with white spot syndrome virus. Aquaculture 2013, 380–383, 41–46. [Google Scholar] [CrossRef] [Scilit]
- Son, V.M.; Chang, C.-C.; Wu, M.-C.; Guu, Y.-K.; Chiu, C.-H.; Cheng, W. Dietary administration of the probiotic, Lactobacillus plantarum, enhanced the growth, innate immune responses, and disease resistance of the grouper Epinephelus coioides. Fish Shellfish Immunol. 2009, 26, 691–698. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thitamadee, S.; Srisala, J.; Taengchaiyaphum, S.; Sritunyalucksana, K. Double-dose β-glucan treatment in WSSV-challenged shrimp reduces viral replication but causes mortality possibly due to excessive ROS production. Fish Shellfish Immunol. 2014, 40, 478–484. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miao, S.; Han, B.; Zhao, C.; Hu, J.; Zhu, J.; Zhang, X.; Sun, L. Effects of dietary Pediococcus acidilactici GY2 single or combined with Saccharomyces cerevisiae or/and β-glucan on the growth, innate immunity response and disease resistance of Macrobrachium rosenbergii. Fish Shellfish Immunol. 2020, 98, 68–76. [Google Scholar] [CrossRef] [Scilit]
- Uchiyama, M.; Mihara, M. Determination of malonaldehyde precursor in tissues by thiobarbituric acid test. Anal. Biochem. 1978, 86, 271–278. [Google Scholar] [CrossRef] [Scilit]
- Babu, D.T.; Antony, S.P.; Joseph, S.P.; Bright, A.R.; Philip, R. Marine yeast Candida aquaetextoris S527 as a potential immunostimulant in black tiger shrimp Penaeus monodon. J. Invertebr. Pathol. 2013, 112, 243–252. [Google Scholar] [CrossRef] [Scilit]
- Apprill, A. Marine Animal Microbiomes: Toward Understanding Host–Microbiome Interactions in a Changing Ocean. Front. Mar. Sci. 2017, 4, 222. [Google Scholar] [CrossRef] [Scilit]
- Dimitroglou, A.; Merrifield, D.L.; Carnevali, O.; Picchietti, S.; Avella, M.; Daniels, C.; Güroy, D.; Davies, S.J. Microbial manipulations to improve fish health and production—A Mediterranean perspective. Fish Amp. Shellfish. Immunol. 2011, 30, 1–16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hoseinifar, S.H.; Mirvaghefi, A.; Merrifield, D.L. The effects of dietary inactive brewer’s yeast Saccharomyces cerevisiae var. ellipsoideus on the growth, physiological responses and gut microbiota of juvenile beluga (Huso huso). Aquaculture 2011, 318, 90–94. [Google Scholar] [CrossRef] [Scilit]
- Maynard, C.L.; Elson, C.O.; Hatton, R.D.; Weaver, C.T. Reciprocal interactions of the intestinal microbiota and immune system. Nature 2012, 489, 231–241. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Angelis, M.; Montemurno, E.; Vannini, L.; Cosola, C.; Cavallo, N.; Gozzi, G.; Maranzano, V.; Di Cagno, R.; Gobbetti, M.; Gesualdo, L. Effect of Whole-Grain Barley on the Human Fecal Microbiota and Metabolome. Appl. Environ. Microbiol. 2015, 81, 7945–7956. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shin, N.-R.; Whon, T.W.; Bae, J.-W. Proteobacteria: Microbial signature of dysbiosis in gut microbiota. Trends Biotechnol. 2015, 33, 496–503. [Google Scholar] [CrossRef] [Scilit]
- Cornejo-Granados, F.; Lopez-Zavala, A.A.; Gallardo-Becerra, L.; Mendoza-Vargas, A.; Sánchez, F.; Vichido, R.; Brieba, L.G.; Viana, M.T.; Sotelo-Mundo, R.R.; Ochoa-Leyva, A. Microbiome of Pacific Whiteleg shrimp reveals differential bacterial community composition between wild, aquacultured and AHPND/EMS outbreak conditions. Sci. Rep. 2017, 7, 11783. [Google Scholar] [CrossRef] [Scilit]
- Hou, D.; Huang, Z.; Zeng, S.; Liu, J.; Wei, D.; Deng, X.; Weng, S.; Yan, Q.; He, J. Intestinal bacterial signatures of white feces syndrome in shrimp. Appl. Microbiol. Biotechnol. 2018, 102, 3701–3709. [Google Scholar] [CrossRef] [Scilit]
- Zeng, S.; Huang, Z.; Hou, D.; Liu, J.; Weng, S.; He, J. Composition, diversity and function of intestinal microbiota in pacific white shrimp (Litopenaeus vannamei) at different culture stages. PeerJ 2017, 5, e3986. [Google Scholar] [CrossRef] [Scilit]






| Ingredients (%) | Dietary β-(1, 3)-Glucan Concentration | |
|---|---|---|
| Control | 0.1% β-Glucan | |
| Fish meal | 26 | 26 |
| Soybean meal | 28 | 28 |
| Corn starch | 23 | 23 |
| Shrimp meal | 4 | 4 |
| Calcium dihydrogen phosphate | 1.5 | 1.5 |
| Vitamin premix 1 | 2 | 2 |
| Mineral premix 2 | 2 | 2 |
| Choline chloride | 1 | 1 |
| Fish oil | 2.5 | 2.5 |
| Soybean oil | 2.5 | 2.5 |
| Soybean lecithin | 1 | 1 |
| Cholesterol | 0.5 | 0.5 |
| Carboxymethylcellulose | 3 | 3 |
| Butylated hydroxytoluene | 0.1 | 0.1 |
| Microcrystalline cellulose | 2.9 | 2.8 |
| β-(1, 3)-Glucan 3 | 0 | 0.1 |
| Total | 100 | 100 |
| Nutrient levels (%) | ||
| Crude protein | 35.2 | 35.5 |
| Crude lipid | 7.6 | 7.6 |
| Ash | 10.3 | 10.7 |
| Moisture | 9.2 | 9.2 |
| Primer Name | Primer Sequence (5′ to 3′) | GenBank Accession | Tm | Product Size (bp) | Anneal | GC Content | References |
|---|---|---|---|---|---|---|---|
| Lys-F | GTTCCGATCTGATGTCCGATG | AY170126 | 56 °C | 117 | 66 °C | 52 | [50] |
| Lys-R | AAGCCACCCAGGCAGAATAG | 55 | |||||
| HSP70-F | CCTCCAGGACTTCTTCAACG | AY645906 | 55 °C | 145 | 63 °C | 42 | [51] |
| HSP70-R | GGTCACGTCCAACAGCAAC | 53 | |||||
| Cru-F | GAGGGTCAAGCCTACTGCTG | AY488497 | 57 °C | 110 | 68 °C | 60 | [52] |
| Cru-R | ACTTATCGAGGCCAGCACAC | 55 | |||||
| Pen3a-F | CTCGTGGTCTGCCTGGTCTTCTTG | Y14926 | 58 °C | 151 | 69 °C | 58 | [53] |
| Pen3a-R | CAGGGCAACCGTTGTATGGA | 55 | |||||
| ProPO-F | CGGTGACAAAGTTCCTCTTC | AY723296 | 54 °C | 122 | 64 °C | 50 | [54] |
| ProPO-R | GCAGGTCGCCGTAGTAAG | 61 | |||||
| Toll-F | CCAGCTTAGAAGACCGGCAA | DQ923424 | 57 °C | 83 | 68 °C | 55 | [55] |
| Toll-R | GTTGTCCGAGCAGAAGTCCA | 55 | |||||
| IMD-F | TGGGTCCGTGTCCAGTGATT | FJ592176 | 61 °C | 79 | 70 °C | 55 | [55] |
| IMD-R | AGAGCCGCCGGTTATGTTGT | 55 | |||||
| EF1α-F | CCTATGTGCGTGGAGACCTTC | GU136229 | 56 °C | 120 | 67 °C | 57 | [56] |
| EF1α-R | GCCAGATTGATCCTTCTTGTTGAC | 46 |
| β-Glucan Feeding Frequencies 1 | Final Weight (g) | Weight Gain (%) | Specific Growth Rate (% day −1) | Condition Factor (%) | Hepatosomatic Index (%) | Survival (%) |
|---|---|---|---|---|---|---|
| Control | 7.65 ± 0.22 | 1502.55 ± 62.51 | 4.61 ± 0.07 | 1.02 ± 0.00 abc | 4.30 ± 0.07 | 95.00 ± 2.04 |
| T1 | 8.02 ± 0.23 | 1521.07 ± 38.09 | 4.63 ± 0.04 | 1.01 ± 0.01 ab | 4.23 ± 0.08 | 96.25 ± 2.39 |
| T2 | 7.56 ± 0.19 | 1477.29 ± 27.15 | 4.59 ± 0.03 | 1.04 ± 0.01 bc | 4.34 ± 0.09 | 95.00 ± 0.00 |
| T3 | 8.31 ± 0.26 | 1543.33 ± 87.20 | 4.65 ± 0.09 | 1.05 ± 0.01 c | 4.15 ± 0.07 | 93.75 ± 2.39 |
| T4 | 8.17 ± 0.10 | 1612.58 ± 91.25 | 4.71 ± 0.08 | 1.04 ± 0.01 bc | 4.09 ± 0.22 | 96.25 ± 2.39 |
| T5 | 8.02 ± 0.30 | 1564.36 ± 100.23 | 4.66 ± 0.10 | 1.00 ± 0.01 a | 4.05 ± 0.12 | 96.25 ± 1.25 |
| KEGG Level | KEGG Pathway | T1 (%) | T3 (%) | p Value |
|---|---|---|---|---|
| 1 | Metabolism | |||
| 2 | Carbohydrate metabolism | 12.382 | 12.570 | 0.042 |
| 3 | Fructose and mannose metabolism | 1.204 | 1.233 | 0.008 |
| 3 | Galactose metabolism | 0.365 | 0.426 | 0.018 |
| 2 | Nucleotide metabolism | 5.244 | 5.311 | 0.019 |
| 3 | Purine metabolism | 3.247 | 3.287 | 0.012 |
| 3 | Cyanoamino acid metabolism | 0.116 | 0.126 | 0.003 |
| 3 | Polyketide sugar unit biosynthesis | 0.098 | 0.099 | 0.001 |
| 3 | Glycerolipid metabolism | 0.335 | 0.377 | 0.006 |
| 3 | Carbon fixation in photosynthetic organisms | 0.464 | 0.473 | 0.017 |
| 1 | Cellular Processes | |||
| 3 | Focal adhesion | 3.77 × 10−6 | 4.3 × 10−6 | 3.30 × 10−2 |
| 1 | Organismal Systems | |||
| 2 | Immune system | 0.037 | 0.044 | 0.036 |
| 3 | NOD-like receptor signaling pathway | 4.23 × 10−5 | 8.55 × 10−6 | 0.08 |
| 3 | RIG-I-like receptor signaling pathway | 0.015 | 0.017 | 0.04 |
| 2 | Environmental adaptation | 0.200 | 0.204 | 0.018 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Qiao, Y.; Han, F.; Lu, K.; Zhou, L.; Rombenso, A.; Li, E. Effects of Dietary β-Glucan Feeding Strategy on the Growth, Physiological Response, and Gut Microbiota of Pacific White Shrimp, Litopenaeus vannamei, under Low Salinity. Animals 2023, 13, 3778. https://doi.org/10.3390/ani13243778
Qiao Y, Han F, Lu K, Zhou L, Rombenso A, Li E. Effects of Dietary β-Glucan Feeding Strategy on the Growth, Physiological Response, and Gut Microbiota of Pacific White Shrimp, Litopenaeus vannamei, under Low Salinity. Animals. 2023; 13(24):3778. https://doi.org/10.3390/ani13243778
Chicago/Turabian StyleQiao, Yanbing, Fenglu Han, Kunyu Lu, Li Zhou, Artur Rombenso, and Erchao Li. 2023. "Effects of Dietary β-Glucan Feeding Strategy on the Growth, Physiological Response, and Gut Microbiota of Pacific White Shrimp, Litopenaeus vannamei, under Low Salinity" Animals 13, no. 24: 3778. https://doi.org/10.3390/ani13243778
APA StyleQiao, Y., Han, F., Lu, K., Zhou, L., Rombenso, A., & Li, E. (2023). Effects of Dietary β-Glucan Feeding Strategy on the Growth, Physiological Response, and Gut Microbiota of Pacific White Shrimp, Litopenaeus vannamei, under Low Salinity. Animals, 13(24), 3778. https://doi.org/10.3390/ani13243778

