Pharmacological Activation of Sirt1 Ameliorates Cisplatin-Induced Acute Kidney Injury by Suppressing Apoptosis, Oxidative Stress, and Inflammation in Mice
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Drug Treatment
2.2. Histology and Immunohistochemistry
2.3. Evaluation of Renal Function and Oxidative Stress
2.4. Western Blot Analysis
2.5. Terminal Deoxynucleotidyl Transferase -Mediated Deoxyuridine Triphosphate Nick End Labeling (TUNEL) Staining
2.6. Gene Expression Analysis
2.7. Statistical Analysis
3. Results
3.1. SRT1720 Ameliorated Cisplatin-Induced AKI
3.2. SRT1720 Suppressed Cisplatin-Induced Cell Apoptosis
3.3. SRT1720 Suppressed p53 Acetylation in Mice Treated With Cisplatin
3.4. SRT1720 Decreased Cisplatin-Induced Oxidative Stress and Preserved Peroxisome Function
3.5. SRT1720 Attenuated Cisplatin-Induced Inflammatory Responses
3.6. SRT1720 Reduced Acetylation of NF-κB p65 In Mice Treated With Cisplatin
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Pabla, N.; Dong, Z. Cisplatin nephrotoxicity: Mechanisms and renoprotective strategies. Kidney Int. 2008, 73, 994–1007. [Google Scholar] [CrossRef] [PubMed]
- Sánchez-González, P.D.; López-Hernández, F.J.; López-Novoa, J.M.; Morales, A.I. An integrative view of the pathophysiological events leading to cisplatin nephrotoxicity. Crit. Rev. Toxicol. 2011, 41, 803–821. [Google Scholar] [CrossRef] [PubMed]
- Perše, M.; Večerić-Haler, Ž. Cisplatin-induced rodent model of kidney injury: Characteristics and challenges. Biomed. Res. Int. 2018, 2018, 1462802. [Google Scholar] [CrossRef] [PubMed]
- Ghosh, H.S. The anti-aging, metabolism potential of SIRT1. Curr. Opin. Investig. Drugs 2008, 9, 1095–1102. [Google Scholar] [PubMed]
- Chang, H.C.; Guarente, L. SIRT1 and other sirtuins in metabolism. Trends Endocrinol. Metab. 2014, 25, 138–145. [Google Scholar] [CrossRef]
- Vaziri, H.; Dessain, S.K.; Ng Eaton, E.; Imai, S.I.; Frye, R.A.; Pandita, T.K.; Guarente, L.; Weinberg, R.A. hSIR2(SIRT1) functions as an NAD-dependent p53 deacetylase. Cell 2001, 107, 149–159. [Google Scholar] [CrossRef]
- Ong, A.L.C.; Ramasamy, T.S. Role of Sirtuin1-p53 regulatory axis in aging, cancer and cellular reprogramming. Aging Res. Rev. 2018, 43, 64–80. [Google Scholar] [CrossRef]
- Yeung, F.; Hoberg, J.E.; Ramsey, C.S.; Keller, M.D.; Jones, D.R.; Frye, R.A.; Mayo, M.W. Modulation of NF-kappaB-dependent transcription and cell survival by the SIRT1 deacetylase. EMBO J. 2004, 23, 2369–2380. [Google Scholar] [CrossRef]
- Xie, J.; Zhang, X.; Zhang, L. Negative regulation of inflammation by SIRT1. Pharmacol. Res. 2013, 67, 60–67. [Google Scholar] [CrossRef]
- Hasegawa, K.; Wakino, S.; Yoshioka, K.; Tatematsu, S.; Hara, Y.; Minakuchi, H.; Sueyasu, K.; Washida, N.; Tokuyama, H.; Tzukerman, M.; et al. Kidney-specific overexpression of Sirt1 protects against acute kidney injury by retaining peroxisome function. J. Biol. Chem. 2010, 285, 13045–13056. [Google Scholar] [CrossRef]
- Milne, J.C.; Lambert, P.D.; Schenk, S.; Carney, D.P.; Smith, J.J.; Gagne, D.J.; Jin, L.; Boss, O.; Perni, R.B.; Vu, C.B.; et al. Small molecule activators of SIRT1 as therapeutics for the treatment of type 2 diabetes. Nature 2007, 450, 712–716. [Google Scholar] [CrossRef] [PubMed]
- Mitchell, S.J.; Martin-Montalvo, A.; Mercken, E.M.; Palacios, H.H.; Ward, T.M.; Abulwerdi, G.; Minor, R.K.; Vlasuk, G.P.; Ellis, J.L.; Sinclair, D.A.; et al. The SIRT1 activator SRT1720 extends lifespan and improves health of mice fed a standard diet. Cell Rep. 2014, 6, 836–843. [Google Scholar] [CrossRef] [PubMed]
- Feige, J.N.; Lagouge, M.; Canto, C.; Strehle, A.; Houten, S.M.; Milne, J.C.; Lambert, P.D.; Mataki, C.; Elliott, P.J.; Auwerx, J. Specific SIRT1 activation mimics low energy levels and protects against diet-induced metabolic disorders by enhancing fat oxidation. Cell Metab. 2008, 8, 347–358. [Google Scholar] [CrossRef] [PubMed]
- Ichikawa, T.; Hayashi, R.; Suzuki, K.; Imanishi, S.; Kambara, K.; Okazawa, S.; Inomata, M.; Yamada, T.; Yamazaki, Y.; Koshimizu, Y.; et al. Sirtuin 1 activator SRT1720 suppresses inflammation in an ovalbumin-induced mouse model of asthma. Respirology 2013, 18, 332–339. [Google Scholar] [CrossRef] [PubMed]
- Yao, H.; Sundar, I.K.; Ahmad, T.; Lerner, C.; Gerloff, J.; Friedman, A.E.; Phipps, R.P.; Sime, P.J.; McBurney, M.W.; Guarente, L. SIRT1 protects against cigarette smoke-induced lung oxidative stress via a FOXO3-dependent mechanism. Am. J. Physiol.-Lung Cell. Mol. Physiol. 2014, 306, L816–L828. [Google Scholar] [CrossRef] [PubMed]
- Khader, A.; Yang, W.L.; Godwin, A.; Prince, J.M.; Nicastro, J.M.; Coppa, G.F.; Wang, P. Sirtuin 1 stimulation attenuates ischemic liver injury and enhances mitochondrial recovery and autophagy. Crit. Care Med. 2016, 44, e651–e663. [Google Scholar] [CrossRef] [PubMed]
- Khader, A.; Yang, W.L.; Hanse, L.W.; Rajayer, S.R.; Prince, J.M.; Nicastro, J.M.; Coppa, G.F.; Wang, P. SRT1720, a sirtuin 1 activator, attenuates organ injury and inflammation in sepsis. J. Surg. Res. 2017, 219, 288–295. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.Y.; Park, J.H.; Kim, K.; Jo, J.; Leem, J.; Park, K.K. Pharmacological inhibition of caspase-1 ameliorates cisplatin-induced nephrotoxicity through suppression of apoptosis, oxidative stress, and inflammation in mice. Mediators Inflamm. 2018, 2018, 6571676. [Google Scholar] [CrossRef] [PubMed]
- Negishi, K.; Noiri, E.; Sugaya, T.; Li, S.; Megyesi, J.; Nagothu, K.; Portilla, D. A role of liver fatty acid-binding protein in cisplatin-induced acute renal failure. Kidney Int. 2007, 72, 348–358. [Google Scholar] [CrossRef] [PubMed]
- Zhai, Z.; Tang, M.; Yang, Y.; Lu, M.; Zhu, W.G.; Li, T. Identifying human SIRT1 substrates by integrating heterogeneous information from various sources. Sci. Rep. 2017, 7, 4614. [Google Scholar] [CrossRef] [PubMed]
- Do Amaral, C.L.; Francescato, H.D.; Coimbra, T.M.; Coista, R.S.; Darin, J.D.; Antunes, L.M.; Bianchi Mde, L. Resveratrol attenuates cisplatin-induced nephrotoxicity in rats. Arch. Toxicol. 2008, 82, 363–370. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.H.; Jung, Y.J.; Lee, J.E.; Lee, A.S.; Kang, K.P.; Lee, S.; Park, S.K.; Han, M.K.; Lee, S.Y.; Ramkumar, K.M.; et al. SIRT1 activation by resveratrol ameliorates cisplatin-induced renal injury through deacetylation of p53. Am. J. Physiol.-Ren. Physiol. 2011, 301, F427–F435. [Google Scholar] [CrossRef] [PubMed]
- Kaeberlein, M.; Mcdonagh, T.; Heltweg, B.; Hixon, J.; Westman, E.A.; Caldwell, S.D.; Napper, A.; Curtis, R.; DiStefano, P.S.; Fields, S.; et al. Substrate-specific activation of sirtuins by resveratrol. J. Biol. Chem. 2005, 280, 17038–17045. [Google Scholar] [CrossRef] [PubMed]
- Borra, M.T.; Smith, B.C.; Denu, J.M. Mechanism of human SIRT1 activation by resveratrol. J. Biol. Chem. 2005, 280, 17187–17195. [Google Scholar] [CrossRef] [PubMed]
- Ahmad, S.; Hussain, A.; Hussain, A.; Abdullah, I.; Ali, M.S.; Froeyen, M.; Mirza, M.U. Quantification of beberine in Berberis vulgaris L. root extract and its curative and prophylactic role in cisplatin-induced in vivo toxicity and in vitro cytotoxicity. Antioxidants 2019, 8, 185. [Google Scholar] [CrossRef]
- Salem, N.; Helmi, N.; Assaf, N. Renoprotective effect of platelet-rich plasma on cisplatin-induced nephrotoxicity in rats. Oxid. Med. Cell. Longev. 2018, 2018, 9658230. [Google Scholar] [CrossRef] [PubMed]
- Meng, H.; Fu, G.; Shen, J.; Shen, K.; Xu, Z.; Wang, Y.; Jin, B.; Pan, H. Ameliorative effect of daidzein on cisplatin-induced nephrotoxicity in mice via modulation of inflammation, oxidative stress, and cell death. Oxid. Med. Cell. Longev. 2017, 2017, 3140680. [Google Scholar] [CrossRef]
- Luo, J.; Li, M.; Tang, Y.; Laszkowska, M.; Roeder, R.G.; Gu, W. Acetylation of p53 augments its site-specific DNA binding both in vitro and in vivo. Proc. Natl. Acad. Sci. USA 2004, 101, 2259–2264. [Google Scholar] [CrossRef]
- Jiang, M.; Yi, X.; Hsu, S.; Wang, C.Y.; Dong, Z. Role of p53 in cisplatin-induced tubular cell apoptosis: Dependence on p53 transcriptional activity. Am. J. Physiol.-Ren. Physiol. 2004, 287, F1140–F1147. [Google Scholar] [CrossRef]
- Wei, Q.; Dong, G.; Yang, T.; Megyesi, J.; Price, P.M.; Dong, Z. Activation and involvement of p53 in cisplatin-induced nephrotoxicity. Am. J. Physiol.-Ren. Physiol. 2007, 293, F1282–F1291. [Google Scholar] [CrossRef]
- Dong, G.; Luo, J.; Kumar, V.; Dong, Z. Inhibitors of histone deacetylases suppress cisplatin-induced p53 activation and apoptosis in renal tubular cells. Am. J. Physiol.-Ren. Physiol. 2010, 298, F293–F300. [Google Scholar] [CrossRef]
- Molitoris, B.A.; Dagher, P.C.; Sandoval, R.M.; Campos, S.B.; Ashush, H.; Fridman, E.; Brafman, A.; Faerman, A.; Atkinson, S.J.; Thompson, J.D.; et al. siRNA targeted to p53 attenuates ischemic and cisplatin-induced acute kidney injury. J. Am. Soc. Nephrol. 2009, 20, 1754–1764. [Google Scholar] [CrossRef]
- Schrader, M.; Fahimi, H.D. Peroxisomes and oxidative stress. Biochim. Biophys. Acta 2006, 1763, 1755–1766. [Google Scholar] [CrossRef]
- Rjeibi, I.; Feriani, A.; Ben Saad, A.; Sdayria, J.; Saidi, I.; Ncib, S.; Souid, S.; Allagui, M.S.; Hfaiedh, N. Lycium europaeum extract: A new potential antioxidant source against cisplatin-induced liver and kidney injuries in mice. Oxid. Med. Cell. Longev. 2018, 2018, 1630751. [Google Scholar] [CrossRef]
- Wang, Z.; Li, Y.F.; Han, X.Y.; Sun, Y.S.; Zhang, L.X.; Liu, W.; Liu, X.X.; Li, W.; Liu, Y.Y. Kidney protection effect of ginsenoside Re and its underlying mechanisms on cisplatin-induced kidney injury. Cell. Physiol. Biochem. 2018, 48, 2219–2229. [Google Scholar] [CrossRef]
- Hasegawa, K.; Wakino, S.; Yoshioka, K.; Tatematsu, S.; Hara, Y.; Minakuchi, H.; Washida, N.; Tokuyama, H.; Hayashi, K.; Itoh, H. Sirt1 protects against oxidative stress-induced renal tubular cell apoptosis by the bidirectional regulation of catalase expression. Biochem. Biophys. Res. Commun. 2008, 372, 51–56. [Google Scholar] [CrossRef]
- Brezniceanu, M.L.; Liu, F.; Wei, C.C.; Chénier, I.; Godin, N.; Zhang, S.L.; Filep, J.G.; Ingelfinger, J.R.; Chan, J.S. Attenuation of interstitial fibrosis and tubular apoptosis in db/db transgenic mice overexpressing catalase in renal proximal tubular cells. Diabetes 2008, 57, 451–459. [Google Scholar] [CrossRef]
- Ramesh, G.; Reeves, W.B. TNF-alpha mediates chemokine and cytokine expression and renal injury in cisplatin nephrotoxicity. J. Clin. Investig. 2002, 110, 835–842. [Google Scholar] [CrossRef]
- Ramesh, G.; Zhang, B.; Uematus, S.; Akira, S.; Reeves, W.B. Endotoxin and cisplatin synergistically induce renal dysfunction and cytokine production in mice. Am. J. Physiol.-Ren. Physiol. 2007, 293, F325–F332. [Google Scholar] [CrossRef]
- Zhang, B.; Ramesh, G.; Norbury, C.C.; Reeves, W.B. Cisplatin-induced nephrotoxicity is mediated by tumor necrosis factor-alpha produced by renal parenchymal cells. Kidney Int. 2007, 72, 37–44. [Google Scholar] [CrossRef]
- Cao, Q.; Wang, Y.; Harris, D.C. Pathogenic and protective role of macrophages in kidney disease. Am. J. Physiol.-Ren. Physiol. 2013, 305, F3–F11. [Google Scholar] [CrossRef]
- Jung, Y.J.; Lee, J.E.; Lee, A.S.; Kang, K.P.; Lee, S.; Park, S.K.; Lee, S.Y.; Han, M.K.; Kim, D.H.; Kim, W. SIRT1 overexpression decreases cisplatin-induced acetylation of NF-κB p65 subunit and cytotoxicity in renal proximal tubule cells. Biochem. Biophys. Res. Commun. 2012, 419, 206–210. [Google Scholar] [CrossRef]









| Gene | Primer Sequence (5′→3′) | Product Size (bp) |
|---|---|---|
| PEX14 1 | Forward: GCCACCACATCAACCAACTG Reverse: GTCTCCGATTCAAAAGAAGTCCT | 97 |
| catalase | Forward: CAAGTACAACGCTGAGAAGCCTAAG Reverse: CCCTTCGCAGCCATGTG | 74 |
| GAPDH 2 | Forward: ACTCCACTCACGGCAAATTC Reverse: TCTCCATGGTGGTGAAGACA | 170 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, J.-Y.; Jo, J.; Kim, K.; An, H.-J.; Gwon, M.-G.; Gu, H.; Kim, H.-J.; Yang, A.Y.; Kim, S.-W.; Jeon, E.J.; et al. Pharmacological Activation of Sirt1 Ameliorates Cisplatin-Induced Acute Kidney Injury by Suppressing Apoptosis, Oxidative Stress, and Inflammation in Mice. Antioxidants 2019, 8, 322. https://doi.org/10.3390/antiox8080322
Kim J-Y, Jo J, Kim K, An H-J, Gwon M-G, Gu H, Kim H-J, Yang AY, Kim S-W, Jeon EJ, et al. Pharmacological Activation of Sirt1 Ameliorates Cisplatin-Induced Acute Kidney Injury by Suppressing Apoptosis, Oxidative Stress, and Inflammation in Mice. Antioxidants. 2019; 8(8):322. https://doi.org/10.3390/antiox8080322
Chicago/Turabian StyleKim, Jung-Yeon, Jungmin Jo, Kiryeong Kim, Hyun-Jin An, Mi-Gyeong Gwon, Hyemin Gu, Hyun-Ju Kim, A Young Yang, Sung-Woo Kim, Eon Ju Jeon, and et al. 2019. "Pharmacological Activation of Sirt1 Ameliorates Cisplatin-Induced Acute Kidney Injury by Suppressing Apoptosis, Oxidative Stress, and Inflammation in Mice" Antioxidants 8, no. 8: 322. https://doi.org/10.3390/antiox8080322
APA StyleKim, J.-Y., Jo, J., Kim, K., An, H.-J., Gwon, M.-G., Gu, H., Kim, H.-J., Yang, A. Y., Kim, S.-W., Jeon, E. J., Park, J.-H., Leem, J., & Park, K.-K. (2019). Pharmacological Activation of Sirt1 Ameliorates Cisplatin-Induced Acute Kidney Injury by Suppressing Apoptosis, Oxidative Stress, and Inflammation in Mice. Antioxidants, 8(8), 322. https://doi.org/10.3390/antiox8080322

