Endotyping Eosinophilic Inflammation in COPD with ELAVL1, ZfP36 and HNRNPD mRNA Genes
Abstract
:1. Introduction
2. Materials and Methods
2.1. Patients
2.2. Isolation of Peripheral Blood Mononuclear Cells (PBMCs)
2.3. Quantitative Real-Time PCR
2.4. Cytokine Analysis
2.5. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Global Initiative for Chronic Obstructive Lung Disease. Global Strategy for the Diagnosis, Management, and Prevention of Chronic Obstructive Pulmonary Disease. Available online: https://goldcopd.org/2024-gold-report/ (accessed on 26 December 2023).
- Tashkin, D.P.; Wechsler, M.E. Role of eosinophils in airway inflammation of chronic obstructive pulmonary disease. Int. J. Chron. Obstruct. Pulmon. Dis. 2018, 13, 335–349. [Google Scholar] [CrossRef]
- Zhao, J.; Zhao, Y. Interleukin-33 and Its Receptor in Pulmonary Inflammatory Diseases. Crit. Rev. Immunol. 2015, 35, 451–461. [Google Scholar] [CrossRef] [PubMed]
- Xiao, X.; Fan, Y.; Li, J.; Zhang, X.; Lou, X.; Dou, Y.; Shi, X.; Lan, P.; Xiao, Y.; Minze, L.; et al. Guidance of Super-Enhancers in Regulation of IL-9 Induction and Airway Inflammation. J. Exp. Med. 2018, 215, 559–574. [Google Scholar] [CrossRef] [PubMed]
- Brooks, S.A.; Blackshear, P.J. Tristetraprolin (TTP): Interactions with mRNA and Proteins, and Current Thoughts on Mechanisms of Action. Biochim. Biophys. Acta 2013, 1829, 666–679. [Google Scholar] [CrossRef]
- Atasoy, U.; Techasintana, P.; Glascock, J.; Ridenhour, S.; Magee, J.; Gubin, M. RNA-Binding Protein Hur Regulates CD4+ T Cell Differentiation and Is Required for Normal IL-2 Homeostasis and Allergic Airway Inflammation. J. Allergy Clin. Immunol. 2016, 137, AB175. [Google Scholar] [CrossRef]
- Raineri, I.; Wegmueller, D.; Gross, B.; Certa, U.; Moroni, C. Roles of AUF1 Isoforms, HuR and BRF1 in ARE-Dependent mRNA Turnover Studied by RNA Interference. Nucleic Acids Res. 2004, 32, 1279–1288. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCt Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Esnault, S.; Shen, Z.J.; Malter, J.S. Protein Translation and Signaling in Human Eosinophils. Front. Med. 2017, 4, 150. [Google Scholar] [CrossRef]
- Srikantan, S.; Gorospe, M. HuR Function in Disease. Front. Biosci. Landmark Ed. 2012, 17, 189. [Google Scholar] [CrossRef]
- Grammatikakis, I.; Abdelmohsen, K.; Gorospe, M. Posttranslational Control of HuR Function. Wiley Interdiscip. Rev. RNA 2017, 8, E1372. [Google Scholar] [CrossRef]
- Izquierdo, J.M. Hu Antigen R (HuR) Functions as an Alternative Pre-mRNA Splicing Regulator of Fas Apoptosis-Promoting Receptor on Exon Definition. J. Biol. Chem. 2008, 283, 19077–19084. [Google Scholar] [CrossRef] [PubMed]
- Aloufi, N.; Haidar, Z.; Ding, J.; Nair, P.; Benedetti, A.; Eidelman, D.H.; Gallouzi, I.E.; Di Marco, S.; Hussain, S.N.; Baglole, C.J. Role of Human Antigen R (HuR) in the Regulation of Pulmonary ACE2 Expression. Cells 2021, 11, 22. [Google Scholar] [CrossRef] [PubMed]
- Sun, J.; Gu, X.; Wu, N.; Zhang, P.; Liu, Y.; Jiang, S. Human Antigen R Enhances the Epithelial-Mesenchymal Transition via Regulation of ZEB-1 in the Human Airway Epithelium. Respir. Res. 2018, 19, 109. [Google Scholar] [CrossRef]
- Fattahi, F.; Ellis, J.S.; Sylvester, M.; Bahleda, K.; Hietanen, S.; Correa, L.; Lugogo, N.L.; Atasoy, U. HuR-Targeted Inhibition Impairs Th2 Proinflammatory Responses in Asthmatic CD4+ T Cells. J. Immunol. 2022, 208, 38–48. [Google Scholar] [CrossRef]
- Jonathan, R.B.; Vuppusetty, C.; Ito, K.; Barnes, P.; Yasuo, K. RNA-Binding Protein HuR Inhibits the Expression of Sirtuin-1 in Patients with COPD. Eur. Respir. J. 2017, 50 (Suppl. 61), OA287. [Google Scholar] [CrossRef]
- Shen, Z.J.; Esnault, S.; Malter, J.S. The Peptidyl-Prolyl Isomerase Pin1 Regulates the Stability of Granulocyte-Macrophage Colony-Stimulating Factor mRNA in Activated Eosinophils. Nat. Immunol. 2005, 6, 1280–1287. [Google Scholar] [CrossRef]
- Tian, P.; Ou, H.; Wu, F.; Ma, Y.; Liu, X.; Chen, Q.; Dang, H.; Zou, H. Interleukin-4-induced Posttranscriptional Gene Regulation of CCL26 by the RNA-Binding Protein HuR in Primary Human Nasal Polyp-derived Epithelial Cells. Int. Forum. Allergy Rhinol. 2019, 9, 311–321. [Google Scholar] [CrossRef]
- Herjan, T.; Xiao, J.; Dziendziel Kolanek, M. RNA-Binding Protein HuR Promotes Airway Inflammation in a House Dust Mite-Induced Allergic Asthma Model. J. Interferon Cytokine Res. 2022, 42, 29–38. [Google Scholar] [CrossRef]
- Prabhala, P.; Ammit, A.J. Tristetraprolin and Its Role in Regulation of Airway Inflammation. Mol. Pharmacol. 2014, 87, 629–638. [Google Scholar] [CrossRef]
- Nader, C.P.; Cidem, A.; Verrills, N.M.; Ammit, A.J. Protein Phosphatase 2A (PP2A): A Key Phosphatase in the Progression of Chronic Obstructive Pulmonary Disease (COPD) to Lung Cancer. Respir. Res. 2019, 20, 222. [Google Scholar] [CrossRef]
- White, E.J.; Brewer, G.; Wilson, G.M. Post-Transcriptional Control of Gene Expression by AUF1: Mechanisms, Physiological Targets, and Regulation. Biochim. Biophys. Acta 2013, 1829, 680–688. [Google Scholar] [CrossRef]
- Gratacos, F.M.; Brewer, G. The Role of AUF1 in Regulated mRNA Decay. Wiley Interdiscip. Rev. RNA 2010, 1, 457–473. [Google Scholar] [CrossRef]
- Sarkar, B.; Xi, Q.; He, C.; Schneider, R.J. Selective Degradation of AU-Rich mRNAs Promoted by the P37 AUF1 Protein Isoform. Mol. Cell. Biol. 2003, 23, 6685–6693. [Google Scholar] [CrossRef]
- Gerstberger, S.; Hafner, M.; Tuschl, T. A Census of Human RNA-Binding Proteins. Nat. Rev. Genet. 2014, 15, 829–845. [Google Scholar] [CrossRef]
- Ricciardi, L.; Giurato, G.; Memoli, D.; Pietrafesa, M.; Dal Col, J.; Salvato, I.; Nigro, A.; Vatrella, A.; Caramori, G.; Casolaro, V.; et al. Posttranscriptional Gene Regulatory Networks in Chronic Airway Inflammatory Diseases: In Silico Mapping of RNA-Binding Protein Expression in Airway Epithelium. Front. Immunol. 2020, 11, 579889. [Google Scholar] [CrossRef]
- Salvato, I.; Ricciardi, L.; Dal Col, J.; Nigro, A.; Giurato, G.; Memoli, D.; Sellitto, A.; Lamparelli, E.P.; Crescenzi, M.A.; Vitale, M.; et al. Expression of Targets of the RNA-Binding Protein AUF-1 in Human Airway Epithelium Indicates Its Role in Cellular Senescence and Inflammation. Front. Immunol. 2023, 14, 1192028. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Yao, W.Z.; Chen, Y.; Ding, Y.L. Role of interleukin-9 in the pathogenesis of chronic obstructive pulmonary disease. Beijing Da Xue Xue Bao Yi Xue Ban 2004, 36, 403–406. [Google Scholar] [PubMed]
- Gounni, A.S.; Nutku, E.; Koussih, L.; Aris, F.; Louahed, J.; Levitt, R.C.; Nicolaides, N.C.; Hamid, Q. IL-9 Expression by Human Eosinophils: Regulation by IL-1beta and TNF-Alpha. J. Allergy Clin. Immunol. 2000, 106, 460–466. [Google Scholar] [CrossRef] [PubMed]
- Oh, C.K.; Raible, D.; Geba, G.P.; Molfino, N.A. Biology of the Interleukin-9 Pathway and Its Therapeutic Potential for the Treatment of Asthma. Inflamm. Allergy Drug Targets 2011, 10, 180–186. [Google Scholar] [CrossRef] [PubMed]
- Cherry, W.B.; Yoon, J.; Bartemes, K.R.; Iijima, K.; Kita, H. A Novel IL-1 Family Cytokine, IL-33, Potently Activates Human Eosinophils. J. Allergy Clin. Immunol. 2008, 121, 1484–1490. [Google Scholar] [CrossRef]
- Tworek, D.; Majewski, S.; Szewczyk, K.; Kiszałkiewicz, J.; Kurmanowska, Z.; Górski, P.; Brzeziańska-Lasota, E.; Kuna, P.; Antczak, A. The Association between Airway Eosinophilic Inflammation IL-33 in Stable Non-Atopic COPD. Respir. Res. 2018, 19, 108. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.W.; Rhee, C.K.; Kim, K.U.; Lee, S.H.; Hwang, H.G.; Kim, Y.I.; Kim, D.K.; Lee, S.D.; Oh, Y.M.; Yoon, H.K. Factors Associated with Plasma IL-33 Levels in Patients with Chronic Obstructive Pulmonary Disease. Int. J. Chron. Obstruct. Pulmon. Dis. 2017, 12, 395–402. [Google Scholar] [CrossRef] [PubMed]
Primers | |
---|---|
ELAVL1: | |
Forwardprimer | GGCGCAGAGATTCAGGTTCT |
Reverseprimer | TGGTCACAAAGCCAAACCCT |
ZfP36: | |
Forwardprimer | ACTGCCATCTACGAGAGCCT |
Reverseprimer | CACTAGGCTGGTGGAGCG |
HNRNPD: | |
Forwardprimer | TATCCAGGCGAGGTGGTCAT |
Reverseprimer | GAAAATACTGCTTCACCACCTGTT |
beta-2 microglobulin: | |
Forwardprimer | TGAGTATGCCTGCCGTGTGA |
Reverseprimer | TGATGCTGCTTACATGTCTCGAT |
Variables | All Patients n = 50 | Non-Eosinophilic (Eosinophils < 4% and/or 300/μL) n = 29 | Eosinophilic (Eosinophils 4% and/or 300/μL) n = 21 | p Value |
---|---|---|---|---|
Sex, Male | 33 (66%) | 16 (55.2%) | 17 (81%) | 0.058 |
Age, Years | 68 ± 8.9 | 68 ± 8.3 | 68 ± 9.9 | 0.989 |
BMI, kg/m2 | 27 (23.8–29.8) | 24.5 (23.4–30.2) | 28.1 (24.8–29.8) | 0.371 |
Smoker (N, %) | 32 (64%) | 18 (66%) | 13 (62%) | 0.629 |
FEV1, Liters | 1.5 ± 0.51 | 1.44 ± 0.53 | 1.58 ± 0.46 | 0.343 |
FEV1, % of predicted | 60.7 ± 18.9 | 61.1 ± 20.7 | 60.1 ± 16.7 | 0.862 |
FEV1/FVC, % | 57.8 ± 11.9 | 57.9 ± 12.7 | 57.6 ± 11.1 | 0.922 |
Comorbidities | ||||
Coronary Artery Disease | 7 (14%) | 6 (20.7%) | 1 (4.8%) | 0.109 |
Hypertension | 25 (50%) | 13 (44.8%) | 12 (57.1%) | 0.39 |
Diabetes | 10 (20%) | 4 (13.8%) | 6 (28.6%) | 0.197 |
Atrial Fibrillation | 5 (10%) | 2 (6.9%) | 3 (14.3%) | 0.39 |
Ischemic Stroke | 5 (10%) | 2 (6.9%) | 3 (14.3%) | 0.39 |
Heart failure | 2 (4%) | 1 (3.4%) | 1 (4.7%) | 0.815 |
Cancer | 11 (22%) | 6 (20.7%) | 5 (23.8%) | 0.793 |
Connective Tissue Disease (CTD) | 4 (8%) | 3 (10.3%) | 1 (4.7) | 0.473 |
Therapy | ||||
LAMA | 6 (12%) | 4 (13.8%) | 2 (9.5%) | 0.647 |
LABA/LAMA | 15 (30%) | 10 (34.5%) | 5 (23.8%) | 0.416 |
LABA/ICS | 4 (8%) | 1 (3.4%) | 3 (14.3%) | 0.163 |
LABA/LAMA/ICS | 21 (42%) | 12 (41.4%) | 9 (42.9%) | 0.917 |
No treatment | 4 (8%) | 2 (6.9%) | 2 (9.5%) | 0.735 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Voulgareli, I.; Semitekolou, M.; Morianos, I.; Blizou, M.; Sfika, M.; Hillas, G.; Bakakos, P.; Loukides, S. Endotyping Eosinophilic Inflammation in COPD with ELAVL1, ZfP36 and HNRNPD mRNA Genes. J. Clin. Med. 2024, 13, 854. https://doi.org/10.3390/jcm13030854
Voulgareli I, Semitekolou M, Morianos I, Blizou M, Sfika M, Hillas G, Bakakos P, Loukides S. Endotyping Eosinophilic Inflammation in COPD with ELAVL1, ZfP36 and HNRNPD mRNA Genes. Journal of Clinical Medicine. 2024; 13(3):854. https://doi.org/10.3390/jcm13030854
Chicago/Turabian StyleVoulgareli, Ilektra, Maria Semitekolou, Ioannis Morianos, Myrto Blizou, Maria Sfika, Georgios Hillas, Petros Bakakos, and Stelios Loukides. 2024. "Endotyping Eosinophilic Inflammation in COPD with ELAVL1, ZfP36 and HNRNPD mRNA Genes" Journal of Clinical Medicine 13, no. 3: 854. https://doi.org/10.3390/jcm13030854