Next Article in Journal
The Antimicrobial Properties of Nanotitania Extract and Its Role in Inhibiting the Growth of Klebsiella pneumonia and Haemophilus influenza
Next Article in Special Issue
Preliminary Study on Citrus Oils Antibacterial Activity Measured by Flow Cytometry: A Step-by-Step Development
Previous Article in Journal
Antibiotic Use and Fatal Outcomes among Critically Ill Patients with COVID-19 in Tacna, Peru
Previous Article in Special Issue
Comparative Studies on Different Extraction Methods of Centella asiatica and Extracts Bioactive Compounds Effects on Antimicrobial Activities
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antibiotics
Volume 10
Issue 8
10.3390/antibiotics10080960
antibiotics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Biologically Active Extracts from Different Medicinal Plants Tested as Potential Additives against Bee Pathogens

by
Claudia Pașca
1,*,
Ioana Adriana Matei
2,
Zorița Diaconeasa
3,
Ancuța Rotaru
4,
Silvio Erler
5 and
Daniel Severus Dezmirean
1
1
Department of Apiculture and Sericulture, Faculty of Animal Sciences and Biotechnologies, University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca, Calea Mănăștur 3-5, 400372 Cluj-Napoca, Romania
2
Department of Microbiology, Faculty of Veterinary Medicine, University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca, Calea Mănăștur 3-5, 400372 Cluj-Napoca, Romania
3
Department of Chemistry, Biochemistry and Molecular Biology, Faculty of Food Science and Technology, University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca, Calea Mănăștur 3-5, 400372 Cluj-Napoca, Romania
4
Department of Fundamental Science, Faculty of Animal Science and Biotechnology, University of Animal Sciences and Veterinary Medicine 3-5, 400372 Cluj-Napoca, Romania
5
Julius Kühn Institute (JKI)-Federal Research Centre for Cultivated Plants, Institute for Bee Protection, Messeweg 11-12, 38104 Braunschweig, Germany
*
Author to whom correspondence should be addressed.
Antibiotics 2021, 10(8), 960; https://doi.org/10.3390/antibiotics10080960
Submission received: 14 June 2021 / Revised: 1 August 2021 / Accepted: 6 August 2021 / Published: 10 August 2021
(This article belongs to the Special Issue Antimicrobial Activity of Natural Products and Plants)
Browse Figures
Versions Notes

Abstract

:
Honey bees (Apis mellifera) perform pollination service for many agricultural crops and contribute to the global economy in agriculture and bee products. However, honey bee health is an ongoing concern, as illustrated by persistent local population decline, caused by some severe bee diseases (e.g., nosemosis, AFB, EFB, chalkbrood). Three natural recipes are in development based on the bioactive compounds of different plants extract (Agastache foeniculum, Artemisia absinthium, Evernia prunastri, Humulus lupulus, Laurus nobilis, Origanum vulgare and Vaccinium myrtillus), characterised by HPLC-PDA. The antimicrobial activity of these recipes was tested in vitro against Paenibacillus larvae, Paenibacillus alvei, Brevibacillus laterosporus, Enterococcus faecalis, Ascosphaera apis and in vivo against Nosema ceranae. A mix of 20% blueberry, 40% absinthium, 10% oakmoss, 10% oregano, 10% Brewers Gold hops, 5% bay laurel and 5% anise hyssop extract showed the strongest antibacterial and antifungal activity. Combing several highly active plant extracts might be an alternative treatment against bee-disease-associated parasites and pathogens, in particular to replace synthetic antibiotics.

Graphical Abstract

1. Introduction

Honey bee diseases are still a serious problem causing local decline in honey bee populations worldwide. Numerous pathogens and parasites are threatening the health and optimal maintenance of honey bee populations, including bacteria (Paenibacillus larvae and Melissococcus plutonius), fungi (Ascosphaera apis), microsporidia (Nosema apis and Nosema ceranae), trypanosomes (Crithidia mellificae and Lotmaria passim) and mites (Varroa spp. and Tropilaelaps sp.) [1,2,3,4,5,6,7,8]. The microbial balance of honey bees, in particular their gut bacterial symbionts—the possible pathogen counterpart, is influenced by a variety of agricultural, colony developmental and environmental factors [9]; such as contaminated water, food or flowers, cleaning activities and trophallaxis, as well as bee faeces deposited in/on the hive or material with infective spores from infected worker honey bees.
Paenibacillus larvae is a gram-positive endospore-forming bacterium, the causative agent of American foulbrood (AFB) disease, which infects the brood stages of honey bees (Apis mellifera L.). Infected honey bee brood turns black with a spotted appearance and foul smell [1,2,3,4]. Spores of P. larvae are resistant to hot, cold, humid and drought conditions, and they may remain infectious for more than 35 years [10,11,12,13]. European foulbrood (EFB) is also a bacterial brood disease caused by the gram-positive bacterium Melissococcus plutonius, and associated secondary invaders, such as Brevibacillus laterosporus, Enterococcus faecalis, Paenibacillus alvei and Achromobacter eurydice have been discussed [2,3]. Chalkbrood is a fungal bee disease caused by Ascosphaera apis, which infects young honey bee brood. The disease is initiated at the larval stage when bee larvae are infected with spores carried in pollen or spread by the nurse bees. Larvae mummified by chalkbrood often look like tiny sticks of chalk. Mummies are white, black or grayfish and mottled [8,14].
Nosema ceranae is a unicellular fungal parasite that infects the midgut epithelial cells of honey bees [15,16]. The parasite was introduced to European honey bees from its Asian congener (Apis cerana) within the last few decades [17,18], and the disease is associated with colony depopulation and collapse in warmer areas of Europe [19]. N. ceranae spores germinate in response to proper pH and ionic conditions in the midgut and inject the infective sporoplasm into the host’s cells through extruded polar filament [20,21]. Another parasitic bee disease is varroosis caused by the ectoparasitic mite Varroa destructor. There are two distinct phases in the life cycle of V. destructor females: A phoretic phase on adult bees and a reproductive phase within the sealed drone and worker brood cells. The mites suck substantial amounts of hemolymph and fat body from both the adult bees and the preimaginal host stages within the sealed brood cells [5,7].
The honey bee (A. mellifera) is the most important commercially managed pollinator, with its services to agriculture estimated to exceed $200 billion per year [22,23,24], making bee diseases an important source of economic loss. Beekeepers have some control options for these pathogens, antibiotics such as oxytetracycline, sulfathiazole [25,26,27] and fumagillin [28,29], or biological and synthetic acaricides. The repeated use of synthetic antibiotics to treat bee parasites and pathogens for a long period may have caused multidrug resistance in causative organisms [11], which will require increasing doses of antibiotics, leading to the accumulation of large amounts of antibiotics in beehive products. However, current European legislation does not permit the use of antibiotics for treatment of honey bees [30], because bee products are not allowed to contain drug residues. This prohibition has greatly limited the possibility of disease treatments, but at the same time, stimulated the development of alternative methods against bee pathogens. The replacement of synthetic chemical drugs with natural antimicrobial substances is one promising direction [31]. Beekeepers generally have no desire to contribute to antibiotic resistance, to pollute the environment or to feed synthetic chemicals to their bees [32].
In this context of increasing multidrug resistance and the demand for organic products, the search for alternative drugs based on the pharmacological and phytochemical properties of medicinal additives became a priority in honey bee colony health research. Previous studies have assessed the antimicrobial effect of several natural products based on medicinal plants, for example, laurel leaf extracts against P. larvae [12,33] and against bee viruses such as BQCV [34]. Other natural extracts have been reported to inhibit the growth of A. apis [25,35]. Moreover, an infusion of Origanum vulgare exhibits maximum activity against B. laterosporus, essential oil of O. vulgare against Staphylococcus saprophyticus [36] and essential oil of Cryptocarya alba against N. ceranae [37]. In several studies, essential oils of mint, melissa, coriander and thyme [38]; other phytochemicals, including caffeine, clove oil, gallic acid, kaempferol and p-coumaric acid; and even propolis showed effective antimicrobial activity, expanded honey bee longevity and, to some extent, reduced nosemosis levels [37,39,40,41,42]. Other natural products tested as additives in honey bee feeding, such as BioPatty, which contains a mixture of Lactobacillus plantarum Lp39, Lactobacillus rhamnosus GR-1 and Lactobacillus kunkeei BR-1, could reduce pathogen loads, up-regulate the expression of key immune genes and improve survival during P. larvae infection [43,44,45]. Hydroalcoholic laurel extract [12], Cinnamomum zeylanicum, Syzygium aromaticum, propolis and Thymus vulgaris are active against M. plutonius [46]. Medicinal plants (Eugenia caryophyllus, Piper betel, Illicium verum, Cinnamomum cassia and Acorus calamus) at various concentrations (0.25–10%) were assayed against A. apis [14], as well as propolis extracts [47] and another plant extract [25]. The most popular alternative treatments against nosemosis in Europe are: Protofil, a mixture of macerated plants; Nozevit, a natural extract of oak bark; Hive alive(contains seaweed extracts); Artemisia absinthium extract; propolis extract; laurel; oregano; rosemary; cinnamon; and eucalypt essential oils, which have showed adequate antimicrobial activity against this pathogen [26,33,34,35,36,37,42,48,49,50,51].
When we began this study, we started with the idea that on the market there is Protofil, a product obtained from macerated plant extracts; a number of 10 plants were used, with alcohol at 80%. In our study we selected the most efficiently medicinal plants and we separated the extract. We took for the extracts only the part of plants with biologically active compounds. We made three recipes based on these extracts but at different concentrations. We chose the concentration of plant extracts for the recipes after the biologically compounds identified in our experiment and also based on the fact that many plant extracts include secondary compounds, which are toxic to insects, and for this reason we have different concentrations.
The development of new recipes and testing their effectivity against bee parasites and pathogens is an alternative way to overcome resistance to classical treatments against mites, bacterial infections, viruses and fungal bee disease. Essential oils from medicinal plants have proven effectivity against bee diseases; however, only a few products are available on the market. Here, we estimate the biologically active compounds of several medicinal plant extracts and tested new recipes, which might be used as additives in honey bee feeding in order to control bee pathogens.

2. Results

2.1. Total Phenolic, Flavonoid Content and Phenolic Compounds

A sensitive, accurate and specific method coupling HPLC with photodiode array detection (PDA) and spectrometry was developed for the analysis of phenolic and flavonoid compounds in extracts of Agastache foeniculum, Artemisia absinthium, Evernia prunastri, Humulus lupulus, Laurus nobilis, Origanum vulgare, Vaccinium myrtillus and sunflower honey. Phenolic and flavonoid compounds were identified on the basis of their retention time, absorbance spectra and a chromatogram with authentic standards. Figure 1 and Figure 2 show the HPLC chromatogram for the extract of Laurus nobilis and Origanum vulgare. The total phenolic and flavonoid content were identified using the Folin–Ciocalteu method and aluminium chloride colorimetric method.
Mobile phases have been formed by water at pH 2.5 adjusted with ortho-phosphoric acid (solvent A) and acetonitrile (solvent B). Elution was carried out using a flow rate of 1 mL/min at 24 °C. The chromatogram was made at 254 nm and the compounds were identified at characteristic wavelengths for each compound.
Different quantities of total phenolic content (1.831–44.672 mg GAE/g DW) and flavonoids (2.215–30.520 mg QE/g DW) were obtained for each specific plant extract (Table 1). The highest concentration of phenolic content was identified for O. vulgare, and for the flavonoid content for A. absinthium.
Among the 25 identified phenolic compounds (Table 2), some of them are already known for their importance on bee health, such as: chlorogenic acid [52] and resveratrol [53,54]. Isoquercitrin and p-OH-benzoic acid were identified in different amounts as a major compound in all plant extracts. Dominating quantities of chlorogenic acid (312.18 µg/g DW) were measured in V. myrtillus extract, rutin (523.25 µg/g DW) and epicatechin (501.29 µg/g DW) in H. lupulus extract, rosmarinic acid (633.85 µg/g DW) and vitexin 2-O-ramnoside (470.45 µg/g DW) in O. vulgare extract, rutin (869.21 µg/g DW) and isoquercitrin (577.15 µg/g DW) in L. nobilis extract, and quercetin (389.73 µg/g DW) in A. absinthium extract.
The highest concentration (µg/g DW) of total phenolic acids and total flavonoids was identified in the L. nobilis extract (Figure 1) and the O. vulgare extract (Figure 2).
Mobile phases have been formed by water at pH 2.5 adjusted with ortho-phosphoric acid (solvent A) and acetonitrile (solvent B). Elution was carried out using a flow rate of 1 mL/min at 24 °C. The chromatogram was made at 254 nm, and the compounds were identified at characteristic wavelengths for each compound.

2.2. Antioxidant and Antimicrobial Activity

The antioxidant activity of the medicinal plant extracts and sunflower honey were performed by DPPH-radical scavenging activity [41,55] and the cupric reducing antioxidant capacity (CUPRAC) method [56]. All plant extracts were characterised for their antioxidant capacity (Table 3) as well as their in vitro antimicrobial activity against bee-disease associated-bacteria and fungi (Table 4). The highest percentage of the inhibition of the DPPH radical (97.50%) was detected for the extract of A. absinthium, which also exhibited the strongest antibacterial activity on P. larvae and E. faecalis (Table 4). For the total antioxidant power, CUPRAC value, the order is slightly changed. The O. vulgare extract showed the highest concentration (165.59 µmol TE/g DW), followed by the L. nobilis extract (39.16 µmol TE/g DW).
The antimicrobial activity of the medicinal plant extracts was evaluated on selective medium plates by the agar well diffusion method [41].
The highest antibacterial activity against P. larvae was observed for extracts of A. foeniculum and A. absinthium and against P. alvei and B. laterosporus for H. lupulus extract (Table 4). A. absinthium and L. nobilis extracts showed strongest antifungal activity against A. apis.

2.3. Medicinal Additive Recipes

The efficacy of chemical constituents of plants depends on the mode of preparation and conservation of its extracts. Many plant extracts include secondary compounds that are toxic to insects. Honey bees usually avoid contact with nectar that contains such secondary compounds, but here, diet selection was not allowed [57]. Based on the results of their biological activity (antioxidant activity, phenolic acids and flavonoids), compound composition of the plant extracts and results of previous studies [55], three medicinal recipes were developed using different concentrations of the mentioned plant extracts (Table S1).
All recipes (R1, R2, R3) were tested in terms of their antioxidant and antimicrobial potential before running the in vivo experimental study using N. ceranae-infected bees. The highest concentration of the antioxidant activity (CUPRAC value) was estimated for recipe 2 (119.4 µM TE/100 g), followed by recipe 3 (112.5 µM TE/100 g) and recipe 1 (94.4 µM TE/100 g). Differences between different natural recipes may be explained by the different concentrations of their ingredients (Table 2, Table S1), in particular phenolic, polyphenolic and flavonoid total contents: R2 (895.128 µg/g DW) > R3 (879.410 µg/g DW) > R1 (838.783 µg/g DW).
Regarding the antimicrobial activity, recipe 2 showed the strongest activity, followed by recipe 3 and recipe 1. Recipe 2 presented means of inhibition areas comparable with the positive control in most cases. Among the tested bacterial strains, the most sensitive were P. alvei and B. laterosporus (Table 4).

2.4. Effectivity against N. ceranae

Bees that died during the experiment or survived until the end of the experiment were collected for each cage on day 7, day 14 and day 21 post-infection. The spore levels of surviving bees at the end were as follows; recipe 2: 2257 spores/bee (C4, C7), recipe 3: 2587 spores/bee (C2, C3), sunflower honey: 2895 spores/bee (C1), Protofil: 2979 spores/bee (C5) and recipe 1: 4830 spores/bee (C8), while the untreated bees showed a spore level of 124,400 spores/bee (C6) (Table S3). All treated bees that died during the experiment showed much lower spore loads than the non-treated control (day 14 and 21), with decreasing spore numbers from day 7 to day 21. Bees that survived until day 21 were shown to have the lowest spore loads compared to the non-treated control and bees that died earlier (Table S3).
The same results were observed for the presence of Nosema spp. and N. ceranae-specific PCR. All positive samples for Nosema spp. (16S rRNA gene fragment) were also positive for the N. ceranae 16S rRNA gene fragment, confirming an infection with N. ceranae. Bees collected prior to the experimental infection were PCR negative (n = 0/10), and all infected and untreated bees (positive control) were positive (n = 10/10). Overall, 36.84% (n = 42/114) of the bees yielded a negative PCR-result after infection and treatment. The highest rate of negative bees was obtained after treatment with recipe 2 plant extract, 56.25% (n = 18/32) (Figure S1), followed by Protofil (n = 6/13, 46.15%), recipe 3 (n = 13/34, 38.24%), recipe 1 (n = 2/11, 18.18%) and sunflower honey (n = 2/12, 16.67%) (Figures S1 and S2). Finally, recipe 2, 3 and Protofil were more active against N. ceranae than recipe 1 and sunflower honey.

3. Discussion

The present study attempts to be part of the replacement of synthetic antibiotics, which are used in treating bee diseases (nosemosis, AFB, EFB, chalkbrood), with proposing medicinal additive recipes composed of plants extracts or with biologically active compounds of different plant extracts. The effectiveness of the three recipes obtained in the present study was analysed using an in vitro and in vivo approach. However, more colony replicate cage studies, larvae assays and finally, colony assays are needed to finally confirm their activity under field-realistic conditions. In particular, the results for N. ceranae-infected bees have to be seen as preliminary due to reduced replicate and sample sizes.
All the recipes showed strong antimicrobial activity, and each plant extract was characterised for its individual polyphenolic composition. The mechanism by which plant extracts of blueberries, absinthium, oakmoss, oregano, Brewers Gold hops, bay laurel and anise hyssop employed their antimicrobial activity might be attributed to their bioactive components (phenolic acids and flavonoids) as their active biomolecules. The obtained results have shown an inhibition of bacterial (AFB and EFB) and fungal (nosemosis and chalkbrood) growth for all tested plant extracts, with best results for A. absinthium, H. lupulus, O. vulgare and V. myrtillus. To our knowledge there are not many studies on the effectivity of alcoholic extracts of blueberries, absinthium, oakmoss, oregano, Brewers Gold hops, bay laurel and anise hyssop on bee pathogens [33,34,36]. Nevertheless, the results of the current study are in line with results of many other plants extracts, which are used against bee parasites and pathogens (nosemosis, AFB, EFB, chalkbrood), such as: Aristotelia chilensis, Gevuina avellana, Ugni molinae and propolis methanolic extracts [40] or Buddleja thyrsoides [58] and Scutia buxifolia [59]; furthermore, some studies use Humulus lupulus and Myrtus communis [60], Origanum vulgare and Rosmarinus officinalis [61] or Laurus nobilis [12,33,34]. However, others showed that bay laurel oil and phenolic extracts of berries had very low or no activity on Gram-positive bacteria [11].
Scientists and beekeepers alike are keen on finding new natural recipes of products that improve bee health. One way to overcome the huge variety of natural products and active ingredients is to combine naturally produced compounds [32]. Therefore, a major objective of this study was to create new recipes based on biologically active compounds from different medicinal plants that can be used as additive products in honey bee feeding for the control of bee diseases. The most efficient recipe on the control of bacterial and fungal pathogens was recipe 2. Differences between the recipes were due to the concentrations in bioactive compounds and ingredients. In Europe [42,49,50], beekeepers use Protofil for the control of nosemosis. Protofil is a maceration of several plants (chamomile, St. John’s wort, marigold, mouse tail, thyme, basil, mint, sea buckthorn, rosehip, plantain, wormwood, acacia flowers, linden) in alcohol at 70 °C. The medicinal additive recipes (R1, R2, R3) were tested together with Protofil and sunflower honey on honey bees artificially infected with N. ceranae. However, no treatment resulted in 100% negative PCR results. Using PCR for evaluating treatment efficiency should be considered with caution as N. ceranae DNA will be amplified regardless of the viability of spores. Furthermore, using cage assays, infected bees do not have the opportunity to get ride of the infective spores (by defaecation) even if they are potentially inactivated by the bioactive medicinal additive.
Beekeepers have some opportunities to control bacterial infections (AFB, EFB) with antibiotics such as oxytetracycline or sulfathiazole, or fumagillin against Nosema sp., but no registered product exists to control chalkbrood. Currently, there is no product that can be used for treating honey bees against several bee diseases in one application. Recipes tested and developed in this study might be applied to control nosemosis, AFB, EFB and chalkbrood. They are made based on the individual extraction of each plant. The selection of plants should be based on their antioxidant and antimicrobial potential, as well as having no effect harming honey bees.

4. Materials and Methods

4.1. Plant Material and Ethanolic Extracts

The plant material was harvested from the research field of the University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca in 2018. All plant material was dried at room temperature. Bioactive compounds from different parts of the plants (Agastache foeniculum, Artemisia absinthium, Evernia prunastri, Humulus lupulus, Laurus nobilis, Origanum vulgare and Vaccinium myrtillus, Table S2) were extracted using a maceration technique with 80% ethanol (v/v), continuous stirring and protection from light for 96 h to a final concentration of 1% extract [62].

4.2. Total Phenolic, Flavonoid Content and Polyphenolic Composition

The total polyphenolic content was estimated using the Folin–Ciocalteu method (S.I.1.) and was expressed as gallic acid equivalents (GAE) in mg/g dry weight of medicinal plants [55,63,64]. The total flavonoid content (expressed as quercetin equivalent (QE) in mg/g dry weight of medicinal plants) was determined by the aluminium chloride colorimetric method (S.I.2.) as described previously [55,63]. All samples were analysed in triplicate.
Individual polyphenolic characterisation of each plant extract was conducted on a liquid chromatograph Shimadzu 2010 EV (Kyoto, Japan) coupled with an SPD-M20A Photodiode Array Detector, LC-10ADSP binary pumps, a CTO-10AVP column oven and an SIL-10AF autosampler [65]. Compound separation was achieved on a Teknokroma Mediterranean Sea C18 column (15 × 0.46, i.d. 5 µm). Mobile phases have been formed by water at pH 2.5 adjusted with ortho-phosphoric acid (solvent A) and acetonitrile (solvent B) using a binary gradient unit LC-10AD VP. Elution was carried out using a flow rate of 1 mL/min at 24 °C and an injection volume of 10 µL. Spectral data for all peaks were accumulated in the range of 220–400 nm [66]. Concentration of each individual compound was calculated based on an external standard method, using calibration curves for each compound, after comparing retention time and UV spectra with reference standards. All chemicals and solvents used were of analytical grade.

4.3. Antioxidant Activity

DPPH (2,2-diphenyl-1-picrylhydrazyl) free radical scavenging activity of the medicinal plant extracts was evaluated spectrophotometrically by a method described by Dulf et al. (2018) [64] (S.I.3.). The results were expressed as µmol Trolox equivalents per 100-g sample (µM Trolox/100 g dry weight). The percentage of radical scavenging activity was converted to Trolox equivalents using a calibration curve (y = 0.0009x − 0.0051, R2 = 0.9974). The percent inhibition of the radical scavenging activity was calculated by the following formula:
Percentage inhibition (%) = [(Ablank − Asample)/Ablank] × 100, where Ablank is the absorbance of the control reaction (DPPH alone), and Asample is the absorbance of the DPPH solution in the presence of the test compound [48].
The modified cupric reducing antioxidant capacity (CUPRAC) method was applied to evaluate the antioxidant potential [63] (S.I.4.) of the medicinal plant extracts. The samples were analysed at 450 nm, and measurements were expressed as µmol Trolox equivalents per gram of plant material (μmol TE/g dry weight). All samples were analysed in triplicate.

4.4. Antimicrobial Activity

Four bacterial strains (Paenibacillus larvae ERIC I genotype–RO-I.D.S.A.-14502/17, Paenibacillus alvei–RO-I.D.S.A.-114/09, Brevibacillus laterosporus–RO-I.D.S.A.-99-186-22/08, Enterococcus faecalis–RO-I.D.S.A.-14490/13) and one fungal strain (Ascosphaera apis–RO-I.D.S.A-11885/17) from the Institute of Diagnosis and Animal Health (I.D.S.A) of Bucharest, Romania, were used. The antimicrobial activity of medicinal plant extracts and the three recipes was tested on selective medium plates by the agar well diffusion method [42]. Vegetative cells of bacterial strains and A. apis were suspended in 10 mL distilled sterile water (1.5 × 108 CFU (colonies forming units)/mL), confirmed spectrophotometrically at 600 nm). Every petri dish was floated with the bacterial suspension and dried. Nine micro-compartments (discs of filter paper) with plant extracts or mixed products (50 μL each) were distributed on each plate. Agar plates were incubated at 37 °C for 24 h for the bacterial strains and at 25 °C for 48 h for A. apis. The results were expressed in mm zone of inhibition. The concentration of the negative control (ethanol) was similar to the concentration used in the plant extracts, for the positive control (oxytetracycline) the concentration was 30 µg per disc.

4.5. Nosema Infection Assay

All experiments were carried out in April to May 2019. To minimise any potential colony-level effects, a single sealed worker brood frame was obtained from one healthy, Nosema-free (confirmed by PCR) and Varroa-free (confirmed by macroscopic examination) colony of Apis mellifera located in the experimental apiary (Department of Apiculture and Sericulture, University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca). The frame was kept in an incubator at 34 ± 2 °C until workers emerged.
Nosema spores were obtained from a highly infected colony and the bee samples were analysed by the Institute of Diagnosis and Animal Health (I.D.S.A) of Bucharest using a method described by Fries et al. (2013) [67]. Viable Nosema spores, isolated from the infected colony and provided by I.D.S.A. Bucharest, were used for the infection of honey bees in this study.
Freshly emerged bees were starved for 3 h and 40 bees per group were fed with 10 µL of 50% sucrose solution (w/v) containing 105 Nosema spores. After infection, the bees were kept in cages for another 7 days to ensure that the spores reached the midgut [19,68,69,70]. Then, 7 days post-infection, natural products based on plant extracts were used as therapeutic additives in honey bee feeding until the end of the experiment. Extracts were supplied in sugar syrup so as to force bees to ingest them in each feeding. Five cages (C2, C3, C4, C7, C8) equipped with 40 bees were assigned to different treatments with medicinal additives at 5% (C2 and C3 with recipe 3; C4 and C7 with recipe 2; C8 with recipe 1); one cage (C1) was assigned to sunflower honey that was shown to be active against N. ceranae and honey bee bacterial pathogens [71,72]; two cages were assigned to a commercial product (Protofil–C5) and the untreated control (infested bees and untreated–C6). The negative control was represented by a lot of honey bees without nosemosis, from the original colony of the brood frame. Dead bees were removed and counted on days 7, 14 and 21. Ventriculi of dead bees were checked separately for the presence of Nosema spores. Bee samples of bees that survived were collected from each cage on day 21 post-infection.

4.6. Determination of Spore Levels

To determine N. ceranae infection levels for each cage, dead and survived worker bees were collected post-infection: on day 7 (C1: 5 dead bees, C2: 4 dead bees, C3: 5 dead bees, C4: 2 dead bees, C5: 2 dead bees, C6: 5 dead bees, C7: 1 dead bee, C8: 4 dead bees), on day 14 post-infection (C1: 9 dead bees, C2: 4 dead bees, C3: 2 dead bees, C4: 2 dead bees; C5: 2 dead bees, C6: 12 dead bees, C7: 2 dead bees, C8: 3 dead bees), and on day 21 post-infection (C1: 8 dead bees, 6 survived; C2: 5 dead bees, 12 survived; C3: 6 dead bees, 8 survived; C4: 2 dead bees, 17 survived; C5: 3 dead bees, 20 survived; C6: 3 dead bees, 10 survived bees; C7: 2 dead bees, 20 survived; C8: 7 dead bees, 15 survived). Each worker’s abdomen was homogenised with a pestle, diluted in 1 mL sterile water per bee, filtered through a 10 µm pore size filter paper and finally centrifuged for 20 min at 3900× g. The spore pellet was resuspended in 2 mL sterile water, pooled per cage and the number of spores was determined using a Neubauer counting chamber [71].

4.7. DNA Extraction and Species Verification

Ten to twenty surviving bees were collected from each cage on day 21 post-infection and stored in 96% ethanol. Each bee was washed in PBS and dried on sterile filter paper before extraction. The bees were cut into two symmetrically halves using sterile single use blades. Genomic DNA was extracted from each bee (both halves) using a commercial kit (ISOLATE II Genomic DNA Kit, Bioline, UK), following the manufacturer’s instructions. In order to assess cross-contamination between extracts, negative controls consisting of reaction mixes without a bee sample were used in each extraction procedure. DNA quantity and purity were determined on a Nanodrop ND-1000 spectrophotometer (NanoDrop Technologies, Inc., Wilmington, DE, USA), using a representative number of randomly selected samples. DNA was stored at −20 °C until further processing.
Samples were assessed for the presence of Nosema spp. and in particular Nosema ceranae, but not for N. apis, as this Nosema species has not been detected in the last decades in samples of different counties of Romania [73,74]. Initial PCR for Nosema spp. detection was performed using a genus-specific primer set amplifying a 252 bp fragment of the 16S rRNA gene (NOSFOR: TGCCGACGATGTGATATGAG/ NOSREV: CACAGCATCCATTGAAAA CG) [17]. N. ceranae DNA detection was realised using a species specific primer set amplifying a 250 bp fragment of the 16S rRNA gene (N. ceranae F: CGGATAAAAGAGTCCGTTACC, N. ceranae R: TGAGCAGGGTTCTAGGGAT) [75]. Each 25 µL reaction mixture contained 12.5 µL Green PCR Master Mix (Rovalab GmBH), 6.5 µL PCR grade water, 1 µL of each primer (10 µM) and 4 µL isolated DNA. Following optimisation, the amplification profile for Nosema spp. detection started with 3 min of initial denaturation at 95 °C, followed by 40 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 45 s and extension at 72 °C for 1 min, followed by final extension at 72 °C for 5 min. The amplification profile for N. ceranae detection followed the same protocol, except annealing at 45 °C for 45 s. In each PCR assay, positive and negative controls were included in order to assess the specificity of the reaction and potential presence of cross-contamination. Positive controls consisted of DNA extracted from a naturally infected bee, previously confirmed to be N. ceranae by sequencing. The negative control was a reaction mix without DNA. PCRs were run using a T100 Thermal Cycler (Bio-Rad Antibodies Distributor SC Dialabs Street Albac no 1, Sector 1, Bucharest, Romania). PCR products were visualised by agarose gel electrophoresis (1.5%) stained with SYBR Safe DNA gel stain (Invitrogen).

4.8. Statistical Analysis

Significant differences between plant extracts and sunflower honey were analysed with one-way ANOVA post hoc tests, and pairwise multiple comparisons were conducted using Tukey’s test. Zone of inhibition values were shown not to be normally distributed (Shapiro–Wilk test) and did not match criteria for homoscedasticity (Levene test). Results were analysed in STATISTICA 12.0 (StatSoft, Tulsa, OK, USA) using Kruskal–Wallis ANOVA and Bonferroni adjusted Dunn’s post hoc tests. Phenolic and flavonoid compounds and antioxidant activity were analysed using the SPSS programme (version 22.0, Chicago, IL, USA).

5. Conclusions

This study showed that biologically active compounds from different medicinal plants might be useful in the control of several bacteria associated with bee diseases, as well as the fungus A. apis and infections with N. ceranae. Each phenolic compound of each plant extract has its own therapeutic properties for the honey bee colony, and by mixing these compounds, a natural antibiotic extract will be obtained. This natural antibiotic mixture added in artificial honey bee feeding, as food additive, might replace synthetic antibiotics and eliminate the risk of drug residues in bee products. Prophylactic and therapeutic treatments against bee disease will not only reduce disease-associated colony losses but also enhance pollination and ecosystem service of honey bees using healthy colonies.

6. Patents

Patent application no. A00994/2018 with title: Phytotherapeutic tincture ”BIONOSEM”.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/antibiotics10080960/s1, Table S1: Plants studied for their biologically active compounds, Table S2: Recipes of medicinal products (final volume 100 mL), Table S3: Microscopic analysis of N. ceranae-infected honey bees, Figure S1: Agarose gel electrophoresis of N. ceranae-specific PCR products, using spores extracted from “R2” lot samples, Figure S2: Agarose gel electrophoresis of N. ceranae-specific PCR products, using spores extracted from “honey” lot samples.

Author Contributions

Conceptualisation C.P. and D.S.D.; methodology, C.P. and I.A.M.; software, I.A.M. and S.E.; validation, D.S.D., S.E. and C.P.; formal analysis, C.P., I.A.M., Z.D. and S.E.; writing—original draft preparation, C.P. and I.A.M.; writing—review and editing, C.P., S.E. and A.R.; supervision, D.S.D.; project administration, C.P.; funding acquisition, D.S.D. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by a grant of the Ministry of Research, Innovation and Digitization, CNCS/CCCDI–UEFISCDI, project number PN-III-P1-1.1-PD-2019-0498, within PNCDI III. Program 2: Competitiveness of the Romanian economy through research, development and innovation: PN-III-P2-2.1-CI-2018-1472 no. 252 CI from 03/09/2018. Project title: Biologically active product for controlling nosemosis in bees.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available in Supplementary Materials.

Acknowledgments

We thank Liviu Alexandru Mărghitaș for the help in this research study, and also we thank Otilia Bobiș and Victorița Bonta for the help with identifying the polyphenolic compounds.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Ebeling, J.; Knispel, H.; Hertlein, G.; Fünfhaus, A.; Genersch, E. Biology of Paenibacillus larvae, a deadly pathogen of honey bee larvae. Appl. Microbiol. Biotechnol. 2016, 100, 7387–7395. [Google Scholar] [CrossRef] [PubMed]
  2. Forsgren, E.; Locke, B.; Sircoulomb, F.; Schäfer, M.O. Bacterial Diseases in Honeybees. Curr. Clin. Microbiol. Rep. 2018, 5, 18–25. [Google Scholar] [CrossRef]
  3. Erler, S.; Lewkowski, O.; Poehlein, A.; Forsgren, E. The Curious Case of Achromobacter eurydice, a Gram-Variable Pleomorphic Bacterium Associated with European Foulbrood Disease in Honeybees. Microb. Ecol. 2018, 75, 1–6. [Google Scholar] [CrossRef] [PubMed]
  4. Human, H.; Pirk, C.W.W.; Crewe, R.M.; Dietemann, V. The honeybee disease American foulbrood—An African perspective. Afr. Entomol. 2011, 19, 551–557. [Google Scholar] [CrossRef] [Green Version]
  5. Rosenkranz, P.; Aumeier, P.; Ziegelmann, B. Biology and control of Varroa destructor. J. Invertebr. Pathol. 2010, 103, S96–S119. [Google Scholar] [CrossRef] [PubMed]
  6. Forsgren, E.; Budge, G.E.; Charrière, J.D.; Hornitzky, M.A.Z. Standard methods for European foulbrood research. J. Apic. Res. 2013, 52, 1–14. [Google Scholar] [CrossRef]
  7. Dietemann, V.; Nazzi, F.; Martin, S.J.; Anderson, D.L.; Locke, B.; Delaplane, K.S.; Wauquiez, Q.; Tannahill, C.; Frey, E.; Ziegelmann, B.; et al. Standard methods for varroa research. J. Apic. Res. 2013, 52, 1–54. [Google Scholar] [CrossRef] [Green Version]
  8. Aronstein, K.A.; Murray, K.D. Chalkbrood disease in honey bees. J. Invertebr. Pathol. 2010, 103, S20–S29. [Google Scholar] [CrossRef]
  9. Paşca, C.; Mărghitaş, L.A.; Șonea, C.; Bobiş, O.; Buzura-Matei, I.A.; Dezmirean, D.S. A Review of Nosema cerane and Nosema apis: Characterization and Impact for Beekeeping. Bul. Univ. Agric. Sci. Vet. Med. Cluj-Napoca Anim. Sci. Biotechnol. 2019, 76, 77–87. [Google Scholar] [CrossRef]
  10. Corby-Harris, V.; Maes, P.; Anderson, K.E. The bacterial communities associated with honey bee (Apis mellifera) foragers. PLoS ONE 2014, 9, e95056. [Google Scholar] [CrossRef] [Green Version]
  11. Ansari, M.J.; Al-Ghamdi, A.; Usmani, S.; Al-Waili, N.; Nuru, A.; Sharma, D.; Ali Khan, K.; Kaurd, M.; Omer, M. In vitro evaluation of the effects of some plant essential oils on Paenibacillus larvae, the causative agent of American foulbrood. Biotechnol. Biotechnol. Equip. 2016, 30, 49–55. [Google Scholar] [CrossRef]
  12. Fernández, N.J.; Damiani, N.; Podaza, E.A.; Martucci, J.F.; Fasce, D.; Quiroz, F.; Meretta, P.E.; Quintana, S.; Eguaras, M.J.; Gende, L.B. Laurus nobilis L. Extracts against Paenibacillus larvae: Antimicrobial activity, antioxidant capacity, hygienic behavior and colony strength. Saudi J. Biol. Sci. 2019, 26, 906–912. [Google Scholar] [CrossRef]
  13. Collins, W.; Lowen, N.; Blake, D.J. Caffeic Acid Esters Are Effective Bactericidal Compounds Against Paenibacillus larvae by Altering Intracellular Oxidant and Antioxidant Levels. Biomolecules 2019, 9, 312. [Google Scholar] [CrossRef] [Green Version]
  14. Chantawannakul, P.; Puchanichanthranon, T.; Wongsiri, S. Inhibitory Effects of Some Medicinal Plant Extracts on the Growth of Ascosphaera apis. Acta Hort. 2005, 4, 183–189. [Google Scholar] [CrossRef]
  15. Fries, I.; Feng, F.; Silva, A.D.; Slemenda, S.B.; Pieniazek, N.J. Nosema ceranae n.sp. (Microspora, Nosematidae), morphological and molecular characterization of a microsporidian parasite of the Asian honey bee Apis cerana (Hymenoptera, Apidae). Eur. J. Protistol. 1996, 32, 356–365. [Google Scholar] [CrossRef]
  16. Fries, I. Nosema ceranae in European honey bees (Apis melllifera). J. Invertebr. Pathol. 2010, 103(S), S73–S79. [Google Scholar] [CrossRef] [PubMed]
  17. Martin-Hernandez, R.; Meana, A.; Prieto, L.; Salvador, A.M.; Garrido-Bailon, E.; Higes, M. Outcome of colonization of Apis mellifera by Nosema ceranae. Appl. Environ. Microbiol. 2007, 73, 6331–6338. [Google Scholar] [CrossRef] [Green Version]
  18. Williams, G.R.; Shafer, A.B.A.; Rogers, R.E.L.; Shutler, D.; Stewart, D.T. First detection of Nosema ceranae, a microsporidian parasite of European honey bees (Apis mellifera), in Canada and central U.S.A. J. Invertebr. Pathol. 2008, 97, 189–192. [Google Scholar] [CrossRef] [PubMed]
  19. Higes, M.; Martin-Hernandez, R.; Botias, C.; Bailon, E.G.; Gonzalez-Porto, A.V.; Barrios, L.; Del Nozal, D.J.; Bernal, J.L.; Jimenez, J.J.; Palencia, P.G.; et al. How natural infection by Nosema ceranae causes honeybee colony collapse. Environ. Microbiol. 2008, 10, 2659–2668. [Google Scholar] [CrossRef]
  20. Guo, R.; Chen, D.; Xiong, C.; Hou, C.; Zheng, Y.; Fu, Z.; Liang, Q.; Diao, Q.; Zhang, L.; Wang, H.; et al. First identification of long non-coding RNAs in fungal parasite Nosema ceranae. Apidologie 2018, 49, 660–670. [Google Scholar] [CrossRef] [Green Version]
  21. McGowan, J.; De la Mora, A.; Goodwin, P.H.; Habash, M.; Hamiduzzaman, M.M.; Kelly, P.G.; Guzman-Novoa, E. Viability and infectivity of fresh and cryopreserved Nosema ceranae spores. J. Microbiol. Methods 2016, 131, 16–22. [Google Scholar] [CrossRef]
  22. Klein, A.M.; Vaissiere, B.E.; Cane, J.H.; Steffan-Dewenter, I.; Cunningham, S.A.; Kremen, C.; Tscharntke, T. Importance of pollinators in changing landscapes for world crops. Proc. Roy. Soc. Lond. B. 2007, 274, 303–313. [Google Scholar] [CrossRef] [Green Version]
  23. Gallai, N.; Salles, J.M.; Settele, J.; Vaissière, B.E. Economic valuation of the vulnerability of world agriculture confronted with pollinator decline. Ecol. Econ. 2009, 68, 810–821. [Google Scholar] [CrossRef]
  24. Potts, S.G.; Biesmeijer, J.C.; Kremen, C.; Neumann, P.; Schweiger, O.; Kunin, W.E. Global pollinator declines: Trends, impacts and drivers. Trends Ecol. Evol. 2010, 25, 345–353. [Google Scholar] [CrossRef]
  25. Chaimanee, V.; Thongtue, U.; Sornmai, N.; Songsri, S.; Pettis, J.S. Antimicrobial activity of plant extracts against the honeybee pathogens, Paenibacillus larvae and Ascosphaera apis and their topical toxicity to Apis mellifera adults. J. Appl. Microbiol. 2017, 123, 1160–1167. [Google Scholar] [CrossRef] [PubMed]
  26. Gochnauer, T.A. Drugs fight foulbrood disease in bees. Minn. Home Fam. Sci. 1951, 9, 15. [Google Scholar]
  27. Genersch, E. American Foulbrood in honeybees and its causative agent, Paenibacillus larvae. J. Invertebr. Pathol. 2010, 103, 10–19. [Google Scholar] [CrossRef]
  28. McCowen, M.C.; Callender, M.E.; Lawlis, J.F. Fumagillin (H-3), a new antibiotic with amebicidal properties. Science 1951, 113, 202–203. [Google Scholar] [CrossRef]
  29. Huang, W.F.; Solter, L.F.; Yau, P.M.; Imai, B.S. Nosema ceranae escapes fumagillin control in honey bees. PLoS Pathog. 2013, 9, e1003185. [Google Scholar] [CrossRef] [Green Version]
  30. Mutinelli, F. European legislation governing the authorisation of veterinary medical products with particular reference to the use of drugs for the control of honey bee diseases. Apiacta 2003, 38, 156–168. [Google Scholar]
  31. Alonso-Salces, R.M.; Cugneta, N.M.; Guapari, E.; Pellegrini, M.C.; Aubone, J.; de Piano, F.G.; Antues, K.; Fuselli, R. Natural strategies for control of Paenibacillus larvae, the causal agent of American foulbrood in honey bees: A review. Apidologie 2017, 48, 387–400. [Google Scholar] [CrossRef]
  32. Tauber, J.P.; Collins, W.R.; Schwarz, R.S.; Chen, Y.; Grubbs, K.; Huang, Q.; Lopez, D.; Peterson, R.; Evans, J. Natural Product Medicines for Honey Bees: Perspective and Protocols. Insects 2019, 10, 356. [Google Scholar] [CrossRef] [Green Version]
  33. Damiani, N.; Fernández, N.J.; Porrini, M.P.; Gende, L.B.; Álvarez, E.; Buffa, F.; Brasesco, C.; Maggi, M.D.; Marcangeli, A.J.; Eguaras, M.J. Laurel leaf extracts for honeybee pest and disease management: Antimicrobial, microsporicidal, and acaricidal activity. Parasitol. Res. 2014, 113, 701–709. [Google Scholar] [CrossRef] [PubMed]
  34. Aurori, A.C.; Bobiş, O.; Dezmirean, D.S.; Mărghitaş, L.A.; Erler, S. Bay laurel (Laurus nobilis) as potential antiviral treatment in naturally BQCV infected honeybees. Virus Res. 2016, 222, 29–33. [Google Scholar] [CrossRef]
  35. Calderone, N.W.; Shimanuki, H.; Allen-Wardell, G. An in vitro evaluation of botanical compounds for the control of the honey bee pathogens Bacillus larvae and Ascosphaera apis, and the secondary invader Bacillus alvei. J. Essent. Oil Res. 1994, 6, 279–287. [Google Scholar] [CrossRef]
  36. Saeed, S.; Tariq, P. Antibacterial activity of oregano (Origanum Vulgare Linn.) against gram positive bacteria. Pak. J. Pharm. Sci. 2009, 22, 421–424. [Google Scholar]
  37. Bravo, J.; Carbonell, V.; Sepúlveda, B.; Delporte, C.; Valdovinos, C.E.; Martín-Hernández, R.; Higes, M. Antifungal activity of the essential oil obtained from Cryptocarya alba against infection in honey bees by Nosema ceranae. J. Invertebr. Pathol. 2017, 149, 141–147. [Google Scholar] [CrossRef]
  38. Wiese, N.; Fischer, J.; Heidler, J.; Lewkowski, O.; Degenhardt, J.; Erler, S. The terpenes of leaves, pollen, and nectar of thyme (Thymus vulgaris) inhibit growth of bee disease associated microbes. Sci. Rep. 2018, 8, 14634. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  39. Bernklau, E.; Bjostad, L.; Hogeboom, A.; Carlisle, A.H.S.A. Dietary Phytochemicals, Honey Bee Longevity and Pathogen Tolerance. Insects 2019, 10, 14. [Google Scholar] [CrossRef] [Green Version]
  40. Ptaszynska, A.A.; Załuski, D. Extracts from Eleutherococcus senticosus (Rupr. et Maxim.) Maxim. Roots: A New Hope Against Honeybee Death Caused by Nosemosis. Molecules 2020, 25, 4452. [Google Scholar] [CrossRef] [PubMed]
  41. Arismendi, N.; Vargas, M.; López, D.M.; Barría, Y.; Zapata, N. Promising antimicrobial activity against the honey bee parasite Nosema ceranae by methanolic extracts from Chilean native plants and propolis. J. Apic. Res. 2018, 57, 522–535. [Google Scholar] [CrossRef]
  42. Dumitru, A.; Chioveanu, G.; Ionita, M.; Dobre, G.; Mitrea, I.L. “In Vitro” Studies On Using Natural Essential Oils In Treatment Of Nosemosis In Honey Bees: Determination Of The Therapeutic Dose, Scientific Works. Series C. Vet. Med. 2017, 63, 165–170. [Google Scholar]
  43. Daisley, B.A.; Pitek, A.P.; Chmiel, J.A.; Al, K.F.; Chernyshova, A.M.; Faragalla, K.M.; Burton, J.P.; Thompson, G.J.; Reid, G. Novel probiotic approach to counter Paenibacillus larvae infection in honey bees. ISME J. 2020, 14, 476–491. [Google Scholar] [CrossRef] [Green Version]
  44. Lamas, A.; Arteaga, V.; Regal, P.; Vázquez, B.; Miranda, J.M.; Cepeda, A.; Franco, C.M. Antimicrobial Activity of Five Apitoxins from Apis mellifera on Two Common Foodborne Pathogens. Antibiotics 2020, 9, 367. [Google Scholar] [CrossRef] [PubMed]
  45. Kačániová, M.; Terentjeva, M.; Žiarovská, J.; Kowalczewski, P.Ł. In Vitro Antagonistic Effect of Gut Bacteriota Isolated from Indigenous Honey Bees and Essential Oils against Paenibacillus Larvae. Int. J. Mol. Sci. 2020, 21, 6736. [Google Scholar] [CrossRef]
  46. Hassona, N.M.K. Using natural products to control foulbrood diseases in honey bee Apis mellifera L. colonies under egyptian conditions. Menoufia J. Plant. Prot. 2017, 2, 153–165. [Google Scholar] [CrossRef]
  47. Wilson, M.B.; Brinkman, D.; Spivak, M.; Gardner, G.; Cohen, J.D. Regional variation in composition and antimicrobial activity of US propolis against Paenibacillus larvae and Ascosphaera apis. J. Invertebr. Pathol. 2015, 124, 44–50. [Google Scholar] [CrossRef]
  48. Dezmirean, D.S.; Marghitas, L.A.; Chirila, F.; Copaciu, F.; Simonca, V.; Bobis, O.; Erler, S. Influence of geographic origin, plant source and polyphenolic substances on antimicrobial properties of propolis against human and honey bee pathogens. J. Apic. Res. 2017, 56, 588–597. [Google Scholar] [CrossRef]
  49. Cristina, R.T.; Kovacevic, Z.; Cincovic, M.; Dumitrescu, E.; Muselin, F.; Imre, K.; Militaru, D.; Mederle, N.; Radulov, I.; Hădărugă, N.; et al. Composition and Efficacy of a Natural Phytotherapeutic Blend against Nosemosis in Honey Bees. Sustainability 2020, 12, 5868. [Google Scholar] [CrossRef]
  50. Chioveanu, G.; Ionescu, D.; Mardare, A. Control of nosemosis–the treatment with Protofil. Apiacta 2004, 39, 31–38. [Google Scholar]
  51. Gajger, I.T.; Petrinec, Z.; Pinter, L.; Kozarić, Z. Experimental Treatment of Nosema Disease with “Nozevit” Phyto-pharmacological Preparation. J. Apic. Res. 2009, 149, 485–490. [Google Scholar]
  52. Balamurugan, R.; Park, J.K.; Lee, J.K. Anti-nosemosis activity of phenolic compounds derived from Artemisia dubia and Aster scaber. J. Apic. Res. 2020, 59, 1–11. [Google Scholar] [CrossRef]
  53. Maistrello, L.; Lodesani, M.; Costa, C.; Leonardi, F.; Marani, G.; Caldon, M.; Mutinelli, F.; Granato, A. Screening of natural compounds for the control of nosema disease in honeybees (Apis mellifera). Apidologie 2008, 39, 436–445. [Google Scholar] [CrossRef] [Green Version]
  54. Berbeć, E.; Migdał, P. Herbal extracts in nosemosis treatment in honeybee (Apis mellifera L.). In The Book of Articles National Scientific Conference “Science and Young Researchers”, 3rd ed.; Promovendi: Łódź, Poland, 2019. [Google Scholar]
  55. Pașca, C.; Mărghitaș, L.; Dezmirean, D.; Bobiș, O.; Bonta, V.; Chirilă, F.; Matei, I.; Fiț, N. Medicinal Plants Based Products Tested on Pathogens Isolated from Mastitis Milk. Molecules 2017, 22, 1473. [Google Scholar] [CrossRef] [Green Version]
  56. Stănilă, M.A.; Cioanca, B.; Diaconeasa, Z.; Stănilă, S.; Sima, N.; Sima, R. Phytochemical Composition and Antioxidant Activity of Various Grain Amaranth Cultivars. Not. Bot. Horti. Agrobot. Cluj Napoca 2019, 47, 1153–1160. [Google Scholar] [CrossRef] [Green Version]
  57. Porrini, M.P.; Fernández, N.J.; Garrido, P.M.; Gende, L.B.; Medici, S.K.; Eguaras, M.J. In vivo evaluation of antiparasitic activity of plant extracts on Nosema ceranae (Microsporidia). Apidologie 2011, 42, 700–707. [Google Scholar] [CrossRef] [Green Version]
  58. Boligon, A.A.; Piana, M.; Brum, T.F.; Freitas, R.B.; Nunes, L.; Pappis, L.; Alves, C.F.S.; Vaucher, R.A.; Santos, R.C.V.; Athayde, M.L. Potential use of Buddleja thyrsoides for control and prevention of American foulbrood disease in honey bees. J. Apic. Sci. 2014, 58, 71–78. [Google Scholar] [CrossRef] [Green Version]
  59. Boligon, A.A.; de Brum, T.F.; Zadra, M.; Piana, M.; dos Santos Alves, C.F.; Fausto, V.P.; dos Santos Barboza, J.V.; de Almeida Vaucher, R.; Santos, R.C.V.; Athayde, M.L. Antimicrobial activity of Scutia buxifolia against the honeybee pathogen Paenibacillus larvae. J. Invertebr. Pathol. 2013, 112, 105–107. [Google Scholar] [CrossRef] [PubMed]
  60. Flesar, J.; Havlik, J.; Kloucek, P.; Rada, V.; Titera, D.; Michal, B.; Stropnicky, M.; Kokoska, L. In vitro growth-inhibitory effect of plant-derived extracts and compounds against Paenibacillus larvae and their acute oral toxicity to adult honey bees. Vet. Microbiol. 2010, 145, 129–133. [Google Scholar] [CrossRef] [PubMed]
  61. Blank, D.E.; Hörnke Alves, G.; Da Silva Nascente, P.; Freitag, R.A.; Cleff, M.B. Bioactive Compounds and Antifungal Activities of Extracts of Lamiaceae Species. J. Agric. Chem. Environ. 2020, 9, 85–96. [Google Scholar] [CrossRef]
  62. Duda, S.C.; Marghitas, L.A.; Dezmirean, D.; Duda, M.; Margaoan, R.; Bobis, O. Changes in major bioactive compounds with antioxidant activity of Agastache foeniculum, Lavandula angustifolia, Melissa officinalis and Nepeta cataria: Effect of harvest time and plant species. Ind. Crops Prod. 2015, 77, 499–507. [Google Scholar] [CrossRef]
  63. Dulf, F.V.; Vodnar, D.C.; Dulf, E.H.; Diaconeasa, Z.; Socaciu, C. Liberation and recovery of phenolic antioxidants and lipids in chokeberry (Aronia melanocarpa) pomace by solid-state bioprocessing using Aspergillus niger and Rhizopus oligosporus strains. LWT Food Sci. Technol. 2018, 87, 241–249. [Google Scholar] [CrossRef]
  64. Dulf, F.V.; Vodnar, D.C.; Socaciu, C. Effects of solid-state fermentation with two filamentous fungi on the total phenolic contents, flavonoids, antioxidant activities and lipid fractions of plum fruit (Prunus domestica L.) by-products. Food Chem. 2016, 209, 27–36. [Google Scholar] [CrossRef]
  65. Clapa, D.; Borsai, O.; Hârta, M.; Bonta, V.; Szabo, K.; Coman, V.; Bobis, O. Micropropagation, Genetic Fidelity and Phenolic Compound Production of Rheum rhabarbarum L. Plants 2020, 9, 656. [Google Scholar] [CrossRef] [PubMed]
  66. Campos, M.G.; Markham, K.R. Structure Information from HPLC and On-line Measured Absorption Spectra: Flavones, Flavonols and Phenolic Acids; Coimbra University Press: Coimbra, Portugal, 2007; p. 14. [Google Scholar]
  67. Fries, I.; Chauzat, M.P.; Chen, Y.P.; Doublet, V.; Genersch, E.; Gisder, S.; Higes, M.; Mcmahon, D.; Martín-Hernández, R.; Natsopoulou, M.; et al. Standard methods for Nosema research. J. Apic. Res. 2013, 52, 1–28. [Google Scholar] [CrossRef] [Green Version]
  68. Higes, M.; García-Palencia, P.; Martín-Hernández, R.; Meana, A. Experimental infection of Apis mellifera honeybees with the Microsporidia Nosema ceranae. J. Invertebr. Pathol. 2007, 94, 211–217. [Google Scholar] [CrossRef] [PubMed]
  69. Higes, M.; Martin-Hernandez, R.; Meana, A. Nosema ceranae, a new microsporidian parasite in honey bees in Europe. J. Invertebr. Pathol. 2006, 92, 93–95. [Google Scholar] [CrossRef]
  70. Higes, M.; Nozal, M.J.; Alvaro, A.; Barrios, L.; Meana, A.; Martin-Hernandez, R.; Bernal, J. The stability and effectiveness of fumagillin in controlling Nosema ceranae (Microsporidia) infection in honey bees (Apis mellifera) under laboratory and field conditions. Apidologie 2011, 42, 364–377. [Google Scholar] [CrossRef] [Green Version]
  71. Gherman, B.I.; Denner, A.; Bobiş, O.; Dezmirean, D.S.; Mărghitaş, L.A.; Schlüns, H.; Moritz, R.F.; Erler, S. Pathogen-associated self-medication behavior in the honeybee Apis mellifera. Behav. Ecol. Sociobiol. 2014, 68, 1777–1784. [Google Scholar] [CrossRef] [Green Version]
  72. Erler, S.; Denner, A.; Bobis, O.; Forsgren, E.; Moritz, R.F.A. Diversity of honey stores and their impact on pathogenic bacteria of the honeybee, Apis mellifera. Evol. Ecol. 2014, 20, 3960–3967. [Google Scholar] [CrossRef]
  73. Aurori, C.M.; Dezmirean, D.S.; Mărghitas, L.A.; Moritz, R.F.A. Nosema apis and N. ceranae in Western Honeybee (Apis mellifera)—Geographical Distribution and Current Methods of Diagnosis. Bul. Univ. Agric. Sci. Vet. Med. Cluj-Napoca Anim. Sci. Biotechnol. 2011, 68, 63–70. [Google Scholar]
  74. Mederle, N.; Lobo, M.L.; Morariu, S.; Morariu, F.; Darabus, G.; Mederle., O.; Matos, O. Microscopic and Molecular Detection of Nosema ceranae in Honeybee Apis mellifera L. from Romania. Rev. Chim. 2018, 69, 3761–3772. [Google Scholar] [CrossRef]
  75. Chen, Y.; Evans, J.D.; Smith, I.B.; Pettis, J.S. Nosema ceranae is a long-present and wide-spread microsporidian infection of the European honey bee (Apis mellifera) in the United States. J. Invertebr. Pathol. 2008, 97, 186–188. [Google Scholar] [CrossRef] [PubMed]
Antibiotics 10 00960 g001 550
Figure 1. Chromatogram of identified polyphenolic compounds detected in extracts of Laurus nobilis (1-p-OH-benzoic acid; 2-syringic acid; 3-epicatechina; 4-rutin; 5-isoquercitrin; 6-quercetin; 7-kaempferol).
Figure 1. Chromatogram of identified polyphenolic compounds detected in extracts of Laurus nobilis (1-p-OH-benzoic acid; 2-syringic acid; 3-epicatechina; 4-rutin; 5-isoquercitrin; 6-quercetin; 7-kaempferol).
Antibiotics 10 00960 g001
Antibiotics 10 00960 g002 550
Figure 2. Chromatogram of identified polyphenolic compounds detected in extracts of Origanum vulgare (1-p-OH-benzoic acid; 2-vitexin 2-O-rhamnoside; 3-sinapic acid; 4-isoquercitrin; 5-rosmarinic acid; 6-resveratrol; 7-apigenin).
Figure 2. Chromatogram of identified polyphenolic compounds detected in extracts of Origanum vulgare (1-p-OH-benzoic acid; 2-vitexin 2-O-rhamnoside; 3-sinapic acid; 4-isoquercitrin; 5-rosmarinic acid; 6-resveratrol; 7-apigenin).
Antibiotics 10 00960 g002
Table
Table 1. Total phenolic and flavonoid content of the different plant extracts and sunflower honey. Results are given as mean values of three independent replicates ± standard deviation.
Table 1. Total phenolic and flavonoid content of the different plant extracts and sunflower honey. Results are given as mean values of three independent replicates ± standard deviation.
SampleTotal Phenolic Content
mg GAE/g DW		Total Flavonoid Content
mg QE/g DW
Agastache foeniculum2.882 ± 0.005 c,d2.215 ± 0.001 d
Artemisia absinthium1.831 ± 0.03 d30.520 ± 0.002 a
Evernia prunastri4.574 ± 0.011 c2.560 ± 0.007 d
Humulus lupulus5.344 ± 0.003 c2.511 ± 0.001 d
Laurus nobilis14.856 ± 0.003 b5.685 ± 0.09 c
Origanum vulgare44.672 ± 0.006 a20.835 ± 0.02 b
Vaccinium myrtillus13.241 ± 0.007 b5.710 ± 0.005 c
Sunflower honey 3.570 ± 0.05 c,d1.890 ± 0.004 d
Note: Different letters within a column denote significant differences (p < 0.05). For the total phenolic content: a Origanum vulgare and Artemisia absinthium different from the others’ samples (p < 0.05) and b Laurus nobilis, Vaccinium myrtillus and Origanum vulgare different from the others’ samples (p < 0.05), c Agastache foeniculum, Evernia prunastri, Humulus lupulus and sunflower honey different from the others’ samples (p < 0.05); d Agastache foeniculum, Artemisia absinthium and Sunflower honey different from the others’ samples (p < 0.05); (Results were analysed using SPSS programme); GAE: gallic acid equivalents, QE: quercetin equivalents, DW: dry weight.
Table
Table 2. Characteristic phenolic acids and flavonoids of Agastache foeniculum, Artemisia absinthium, Evernia prunastri, Humulus lupulus, Laurus nobilis, Origanum vulgare, Vaccinium myrtillus extracts and sunflower honey (expressed as µg/g dry weight).
Table 2. Characteristic phenolic acids and flavonoids of Agastache foeniculum, Artemisia absinthium, Evernia prunastri, Humulus lupulus, Laurus nobilis, Origanum vulgare, Vaccinium myrtillus extracts and sunflower honey (expressed as µg/g dry weight).
Identified CompoundAgastache foeniculumArtemisiaEvernia prunastriHumulus lupulusLaurus nobilisOriganum vulgareVaccinium myrtillusSunflower Honey
Chlorogenic acid49.88 ± 2.37 b*n.d.**1.44 ± 0.07 c*n.d.**n.d.**n.d.**312.18 ± 15.24 a*2.95 ± 0.15 c*
Syringic acidn.d.**n.d.**n.d.**n.d.**120.68 ± 5.80 a*n.d.**76.68 ± 3.88 b*n.d.**
Ferulic acidn.d.**n.d.**n.d.**n.d.**n.d.**n.d.**118.50 ± 5.78 a*0.80 ± 0.04 b*
Isoquercitrin283.22 ± 14.37 c*58.53 ± 2.98 e*n.d.**298.87 ± 15.47 c*577.15 ± 29.53 a*347.90 ± 16.83 b*149.59 ± 7.20 d*n.d.**
Quercetin117.69 ± 6.603 c*389.73 ± 19.48 a*n.d.**n.d.**419.32 ± 21.19 a*n.d.**159.10 ± 8.03 b*5.99 ± 0.29 d*
Miricetinn.d.**n.d.**n.d.**n.d.**n.d.**n.d.**10.21 ± 0.51 a*1.03 ± 0.05 b*
Naringeninn.d.**n.d.**n.d.**n.d.**n.d.**n.d.**0.08 ± 0.00 a*n.d.**
Kaempferoln.d.**n.d.**n.d.**n.d.**7.46 ± 0.38 b*n.d.**0.28 ± 0.01 c*17.80 ± 0.90 a*
Vanilic acidn.d.**n.d.**1.91 ± 0.09 a*n.d.**n.d.**n.d.**n.d.**n.d.**
Vanillin40.96 ± 1.94 a*n.d.**6.41 ± 0.01 b*n.d.**n.d.**n.d.**n.d.**n.d.**
Rosmarinic acidn.d.**n.d.**9.45 ± 0.45 b*n.d.**n.d.**633.85 ± 32.99 a*n.d.**n.d.**
Crisinn.d.**n.d.**70.94 ± 3.6 a*n.d.**n.d.**n.d.**n.d.**n.d.**
o-Cumaric acid n.d.**n.d.**4.48 ± 0.22 a*n.d.**n.d.**n.d.**n.d.**1.46 ± 0.07 b*
Acacetin52.83 ± 2.61 a*n.d.**7.55 ± 0.36 b*n.d.**n.d.**n.d.**n.d.**n.d.**
Gallic acid 38.86 ± 1.85 a*n.d.**n.d.**n.d.**n.d.**n.d.**n.d.**0.63 ± 0.03 b*
Caffeic acid 20.34 ± 1.00 a*n.d.** n.d.** n.d.** n.d.** n.d.** n.d.**2.71 ± 0.13 b*
p-OH Cinnamic acid 9.01 ± 0.45 a*n.d.**n.d.**n.d.**n.d.**n.d.**n.d.**n.d.**
Apigenin 17.38 ± 0.88 b* n.d.**n.d.** n.d.** n.d.** n.d.**93.55 ± 4.72 a* n.d.**0.93 ± 0.04 c*
Rutin n.d.** 115.71 ± 5.7 c*n.d.**523.25 ± 26.89 b*869.21 ± 30.22 a*n.d.**n.d.**1.24 ± 0.06 d*
Epicatechina n.d.**n.d.** n.d.**501.29 ± 24.40 a*142.82 ± 7.16 b* n.d.** n.d.** n.d.** n.d.**
Vitexin 2-o-ramnosiden.d.**n.d.** n.d.** n.d.** n.d.**470.45 ± 23.25 a*n.d.**n.d.**
Sinapic acidn.d.**n.d.** n.d.**n.d.**n.d.**446.86 ± 21.96 a*n.d.**n.d.**
Resveratrol128.59 ± 6.72 cn.d.**n.d.**n.d.**139.2 ± 6.90 c75.19 ± 3.63 a*n.d.**n.d.**
Total phenolic acids512.08 ± 25.18 d28.77 ± 1.39 d33.94 ± 1.64 d95.48 ± 4.70 c2015.96 ± 97.01 a1095.03 ± 52.96 a512.02 ± 24.59 b2.71 ± 0.14 d
Total flavonoids 563.97 ± 29.08 d84.90 ± 4.26 f1323.41 ± 68.86 b 987.09 ± 48.27 c319.26 ± 16.50 e26.99 ± 1.37 f
* The values are mean of three samples (n = 3), analysed individually in triplicates. Different letters within a row denote significant differences (p < 0.05); for example, 3,4 dihydroxybenzoic identified in a Humulus lupulus extract, b Artemisia absinthium extract, c Agastache foeniculum and d Evernia prunastri extract is different from the others extracts or sunflower honey (p < 0.05); p-OH-benzoic acid identified in a Humulus lupulus extract, b Laurus nobilis extract, c Origanum vulgare extract, d Artemisia absinthium and Evernia prunastri extract is different from the others extracts or sunflower honey (p < 0.05); Chlorogenic acid identified in a Vaccinium myrtillus extract, b Agastache foeniculum extract, c Evernia prunastri extract and sunflower honey is different from the others extracts (p < 0.05); Syringic acid identified in a Laurus nobilis and b Vaccinium myrtillus extract is different from the others extracts or sunflower honey (p < 0.05); Ferulic acid identified in a Vaccinium myrtillus extract and sunflower honey is different from the others extracts (p < 0.05); Isoquercitrin identified in a Laurus nobilis extract, b Origanum vulgare extract, c Agastache foeniculum and Humulus lupulus extract, d Vaccinium myrtillus extract is different from the others extracts or sunflower honey (p < 0.05); Quercetin identified in a Artemisia absinthium and Laurus nobilis extract, b Vaccinium myrtillus extract, c Agastache foeniculum extract and d sunflower honey is different from the others extracts (p < 0.05); Miricetin identified in a Vaccinium myrtillus extract and b sunflower honey is different from the others extracts (p < 0.05); Naringenin identified in a Vaccinium myrtillus extract is different from the others extracts (p < 0.05); Kaempferol identified in a sunflower honey, b Laurus nobilis extract, c Vaccinium myrtillus extract is different from the others extracts (p < 0.05); Vanilic acid identified in a Evernia prunastri extract is different from the others extracts or sunflower honey (p < 0.05); Vanillin identified in a Agastache foeniculum and b Evernia prunastri extract is different from the others extracts or sunflower honey (p < 0.05); Rosmarinic acid identified in a Origanum vulgare and b Evernia prunastri extract is different from the others extracts or sunflower honey (p < 0.05); Crisin identified in a Evernia prunastri extract is different from the others extracts or sunflower honey (p < 0.05); o-Cumaric acid identified in a Evernia prunastri extract and b sunflower honey is different from the others extracts (p < 0.05); Acacetin identified in a Agastache foeniculum and b Evernia prunastri extract is different from the others extracts or sunflower honey (p < 0.05); Gallic acid and Caffeic acid identified in a Agastache foeniculum extract and b sunflower honey are different from the others extracts (p < 0.05); p-OH Cinnamic acid identified in a Agastache foeniculum extract is different from the others extracts or sunflower honey (p < 0.05); Apigenin identified in a Origanum vulgare extract, b Agastache foeniculum extract and c sunflower honey is different from the others extracts (p < 0.05); Rutin identified in a Laurus nobilis extract, b Humulus lupulus extract, c Artemisia absinthium extract and d sunflower honey is different from the others extracts (p < 0.05); Epicatechina identified in a Humulus lupulus extract and b Laurus nobilis extract is different from the others extracts or sunflower honey (p < 0.05); Vitexin 2-O-ramnoside, Sinapic acid and Resveratrol identified in a Origanum vulgare extract are different from the others extracts or sunflower honey (p < 0.05); (Results were analysed using the SPSS programme) ** n.d. –not detectable.
Table
Table 3. Antioxidant activity of extracts from Agastache foeniculum, Artemisia absinthium, Evernia prunastri, Humulus lupulus, Laurus nobilis, Origanum vulgare, Vaccinium myrtillus and sunflower honey. Results are given as mean values of three independent replicates ± standard deviation.
Table 3. Antioxidant activity of extracts from Agastache foeniculum, Artemisia absinthium, Evernia prunastri, Humulus lupulus, Laurus nobilis, Origanum vulgare, Vaccinium myrtillus and sunflower honey. Results are given as mean values of three independent replicates ± standard deviation.
SampleRadical Scavenging Activity
(% Inhibition)		Total Antioxidant Power,
CUPRAC Value
(µmol TE/g DW)
Agastache foeniculum78.80 ± 1.09 b*17.96 ± 0.36 d*
Artemisia absinthium97.50 ± 1.05 a*20.97 ± 0.51 d*
Evernia prunastri76.93 ± 0.86 b*18.02 ± 0.24 d*
Humulus lupulus46.95 ± 0.31 b*23.85 ± 0.45 c,d*
Laurus nobilis50.63 ± 0.82 d*39.16 ± 0.82 b*
Origanum vulgare76.92 ± 0.52 d*165.59 ± 1.08 a*
Vaccinium myrtillus61.31 ± 0.71 c*30.99 ± 0.21 b,c*
Sunflower honey46.99 ± 1.11 d*22.10 ± 0.40 c,d*
* Different letters within a column denote significant differences (p < 0.05). For the CUPRAC value: a Artemisia absinthium and Origanum vulgare different from the others’ samples (p < 0.05); b Agastache foeniculum, Evernia prunastri, Humulus lupulus, Laurus nobilis and Vaccinium myrtillus different from the others’ samples (p < 0.05); c Vaccinium myrtillus, Humulus lupulus and sunflower honey were different from the others’ samples (p < 0.05); (Results were analysed using the SPSS programme); d Laurus nobilis, Origanum vulgare Sunflower honey, Agastache foeniculum, Artemisia absinthium, Evernia prunastri and Humulus lupulus different from the others’ samples (p < 0.05); TE: Trolox equivalents, DW: dry weight.
Table
Table 4. Antimicrobial activity of plant extracts, recipes of medicinal products, negative (80% ethanol–solvent control) and positive (oxytetracycline) controls. Values are given in mm (zone of inhibition), as mean ± SD of triplicate measurements. Different superscript letters show significant differences, as explained below.
Table 4. Antimicrobial activity of plant extracts, recipes of medicinal products, negative (80% ethanol–solvent control) and positive (oxytetracycline) controls. Values are given in mm (zone of inhibition), as mean ± SD of triplicate measurements. Different superscript letters show significant differences, as explained below.
Plant Extracts and RecipesPaenibacillus
larvae		Paenibacillus
alvei		Brevibacillus
laterosporus		Enterococcus
faecalis		Ascosphaera
apis
Agastache foeniculum24.67 ± 1.15 a18.33 ± 2.8820.67 ± 1.159.33 ± 2.319.33 ± 1.15
Artemisia absinthium24.67 ± 4.6221.33 ± 1.2021.33 ± 1.1517.33 ± 2.3112.67 ± 0.58
Evernia prunastri22.67 ± 2.3121.33 ± 1.2018.00 ± 2.0012.00 ± 2.0010.67 ± 1.15
Humulus lupulus22.67 ± 4.6228.67 ± 2.3122.00 ± 0.0011.33 ± 2.3111.00 ± 0.00
Laurus nobilis22.00 ± 0.0017.33 ± 2.3110.00 ± 0.0013.33 ± 1.1512.00 ± 2.65
Origanum vulgare21.33 ± 2.3126.00 ± 2.0020.67 ± 1.1514.00 ± 0.0010.67 ± 1.15
Vaccinium myrtillus20.00 ± 0.0022.67 ± 1.2013.33 ± 5.7714.67 ± 2.3110.00 ± 0.00
Recipe 1 16.67 ± 4.6226.00 ± 0.0020.67 ± 1.1519.33 ± 1.1510.67 ± 0.58
Recipe 2 21.33 ± 2.3128.67 ± 1.20 b24.00 ± 0.00 c,d14.00 ± 0.0011.33 ± 2.31
Recipe 3 20.00 ± 0.0022.67 ± 2.3122.67 ± 2.3117.33 ± 2.3112.67 ± 1.15
Positive control20.00 ± 0.0029.33 ± 4.2020.00 ± 0.0020.67 ± 1.1519.33 ± 1.15 e
Negative control10.00 ± 2.8311.33 ± 1.2010.33 ± 1.538.50 ± 2.128.00 ± 0.00
a Agastache foeniculum different from negative control (p = 0.037), b Recipe 2 different from negative control (p = 0.049), c Recipe 2 different from Laurus nobilis (p = 0.04), d Recipe 2 different from negative control (p = 0.04), e positive control different from negative control (p = 0.028). (Results were analysed using Kruskal–Wallis ANOVA and Bonferroni adjusted Dunn’s post hoc tests).
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Pașca, C.; Matei, I.A.; Diaconeasa, Z.; Rotaru, A.; Erler, S.; Dezmirean, D.S. Biologically Active Extracts from Different Medicinal Plants Tested as Potential Additives against Bee Pathogens. Antibiotics 2021, 10, 960. https://doi.org/10.3390/antibiotics10080960

AMA Style

Pașca C, Matei IA, Diaconeasa Z, Rotaru A, Erler S, Dezmirean DS. Biologically Active Extracts from Different Medicinal Plants Tested as Potential Additives against Bee Pathogens. Antibiotics. 2021; 10(8):960. https://doi.org/10.3390/antibiotics10080960

Chicago/Turabian Style

Pașca, Claudia, Ioana Adriana Matei, Zorița Diaconeasa, Ancuța Rotaru, Silvio Erler, and Daniel Severus Dezmirean. 2021. "Biologically Active Extracts from Different Medicinal Plants Tested as Potential Additives against Bee Pathogens" Antibiotics 10, no. 8: 960. https://doi.org/10.3390/antibiotics10080960

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop