Next Article in Journal
Colonization with Carbapenem-Resistant Enterobacteriaceae Contributes to Unfavorable Outcomes in End-Stage Liver Disease Patients
Previous Article in Journal
Octenidine’s Efficacy: A Matter of Interpretation or the Influence of Experimental Setups?
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Antibiotics
Volume 11
Issue 11
10.3390/antibiotics11111666
antibiotics-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Virulence Determinants and Methicillin Resistance in Biofilm-Forming Staphylococcus aureus from Various Food Sources in Bangladesh

by
Fatimah Muhammad Ballah
1,2,
Md. Saiful Islam
1,
Md. Liton Rana
1,
Md. Ashek Ullah
1,
Farhana Binte Ferdous
1,
Fahim Haque Neloy
1,
Samina Ievy
1,
Md. Abdus Sobur
1,
AMM Taufiquer Rahman
3,
Mst. Minara Khatun
1,
Marzia Rahman
1 and
Md. Tanvir Rahman
1,*
1
Department of Microbiology and Hygiene, Faculty of Veterinary Science, Bangladesh Agricultural University, Mymensingh 2202, Bangladesh
2
Department of Veterinary Public Health and Preventive Medicine, Usmanu Danfodiyo University, Sokoto 840004, Nigeria
3
Naogaon District Hospital, Naogaon 6500, Bangladesh
*
Author to whom correspondence should be addressed.
Antibiotics 2022, 11(11), 1666; https://doi.org/10.3390/antibiotics11111666
Submission received: 1 November 2022 / Revised: 16 November 2022 / Accepted: 18 November 2022 / Published: 20 November 2022
(This article belongs to the Special Issue Staphylococci Antimicrobial Tolerance, Persistent Infection and Antimicrobial Strategies)
Browse Figure
Versions Notes

Abstract

:
The eradication of staphylococcal infections has become more difficult due to the development of antibiotic resistance and virulence in biofilm-forming Staphylococcus aureus. The presence of the life-threatening zoonotic pathogen, methicillin-resistant S. aureus (MRSA), in foods indicates a public health issue. This study, therefore, aimed to determine virulence factors and methicillin resistance in biofilm-forming S. aureus isolates from different foods and food handlers. A total of 100 PCR-positive S. aureus isolates (97 biofilm formers and three non-biofilm formers) were screened using the disk diffusion method and PCR assay. By PCR, genes encoding virulence factors, e.g., enterotoxin (sea, 30%, 95% CI: 21.90–39.59%), toxic shock syndrome toxin (tst, 20%, 95% CI: 13.34–28.88%), and Panton–Valentine leukocidin toxin (PVL, 15%, 95% CI: 9.31–23.28%), were detected in the S. aureus isolates. By the disk diffusion method, 100% (95% CI: 96.30–100.00%) of S. aureus isolates were phenotypically MRSA in nature, showing 100% resistance to oxacillin and cefoxitin. Moreover, the methicillin-resistant gene mecA was found in 61 (61%, 95% CI: 51.20–69.98%) MRSA isolates. Furthermore, all the S. aureus isolates were phenotypically resistant to ampicillin and penicillin, 30% to erythromycin, and 11% to gentamycin. Among them, 51% (95% CI: 41.35–60.58%) of S. aureus isolates were phenotypically multidrug-resistant in nature, and the multiple antibiotic resistance index varied from 0.33 to 0.55. Genes encoding resistance to beta-lactams (blaZ, 100%, 95% CI: 96.30–100.00%) and tetracyclines (tetA and tetC, 3%, 95% CI: 0.82–8.45%) were found positive in the S. aureus isolates. Genes encoding virulence determinants and MRSA were significantly (p < 0.05) higher in strong biofilm-forming S. aureus than in moderate and non-biofilm-forming isolates. To our knowledge, this is the first study in Bangladesh to incorporate preliminary data on the occurrence of virulence determinants and methicillin resistance, including resistance to clinically important antibiotics, in biofilm-forming S. aureus isolates from different foods and food handlers in Bangladesh, emphasizing a potential threat to human health.

1. Introduction

Staphylococcus aureus, an opportunistic and notorious zoonotic pathogen, is responsible for food poisoning and a wide range of infections in humans, ranging from skin infections, diarrhea, nausea, vomiting, and abdominal cramps to serious consequences, such as endocarditis, pneumonia, osteomyelitis, toxic shock syndrome, and septicemia [1,2]. The consumption of S. aureus-contaminated foods is a major factor in the development of staphylococcal food poisoning in humans.
The pathogenicity of S. aureus is triggered by a number of characteristics, such as invasive components, toxin-associated virulence factors, biofilm formation, and antibiotic resistance. These characteristics also assist these organisms in becoming more resistant to hostile environments, developing infections, and escaping the immune system of the host [3,4,5].
The ability of S. aureus to form biofilm can shield them from antibiotics, enzymes released from the host immune system, and environmental stressors [6]. The formation of biofilms, which consist of an aggregation of microbial cells encased in exopolymeric substances, is a frequent strategy that bacteria use in order to survive in a variety of hostile environmental conditions [7]. Bacteria permanently alter their growth rate and gene transcription through the process of biofilm development, in which they cling to and grow on a surface and secrete extracellular polymers that aid adhesion and matrix creation [8]. The biofilm-forming ability of bacterial communities assists them in being resilient against environmental stressors, antimicrobials, or sanitizers that a single bacterium cannot [4].
Staphylococcal virulence factors such as (a) enterotoxins (sea, seb, and others) are responsible for food poisoning and help organisms become resistant to heat treatment [5], (b) toxic shock syndrome toxin (tst)—an exotoxin that causes rapid onset of fever, shock syndrome, hypotension, and inflammation of the vascular system [9], and (c) the Panton–Valentine leukocidin (PVL)—a cytotoxin that causes necrosis on the skin, lysis of human neutrophils—while also increasing S. aureus adherence to the extracellular matrix [10].
The use of antibiotics for treating bacterial infections has been increasing gradually since their discovery in the early nineteenth century [11]. However, selective pressure resulting from the misuse and overuse of antibiotics has triggered the development of antimicrobial resistance (AMR) or multidrug resistance (MDR) in many bacterial pathogens [12]. AMR is a major threat to human health and economic expansion [13]. Based on a predictive statistical model, there were an estimated 4.95 million bacterial AMR-associated deaths in 2019, with 1.27 million deaths from bacterial AMR [14]. The adverse impacts of AMR are more severe in low- and middle-income countries, including Bangladesh [15]. In addition, health components are being jeopardized by the consequences of AMR [16].
Antibiotic resistance in S. aureus has increased dramatically over the years. Consequently, a high degree of resistance developed in S. aureus, particularly in methicillin-resistant S. aureus (MRSA) strains, is a critical threat to human health [17]. A US study previously reported that MRSA causes more human mortalities than AIDS [18]. In addition, the superbug MRSA develops resistance to most of the available antibiotics which are used to treat staphylococcal infections [19]. S. aureus becomes resistant to methicillin, e.g., MRSA, by acquiring the mecA, mecB, or mecC genes. In MRSA, these resistant genes are harbored in a mobile genetic element mec operon, namely the staphylococcal cassette chromosome mec (SCCmec) [20]. MRSA showed MDR properties by developing resistance to beta-lactams, aminoglycosides, macrolides, fluoroquinolones, chloramphenicol, and tetracyclines, which are frequently used to treat staphylococcal infections [21].
Both the hand surfaces of food handlers and the surfaces that come into contact with foods are important factors in the spread of S. aureus in foods and settings that contain foods. As a result, S. aureus has been found in a variety of foods on multiple occasions [22]. Furthermore, MRSA is being increasingly detected in different food products, such as ready-to-eat food, hand swabs from food handlers, chicken products, etc. [17,23]. Indeed, no data are available from Bangladesh on the prevalence of virulence factors and methicillin resistance in biofilm-forming S. aureus from food origins. Considering the current importance, we conducted the present study focusing on the detection of staphylococcal virulence factors and MRSA with other clinically important antibiotic resistance genes and to determine their association with staphylococcal biofilm formation.

2. Results

2.1. Prevalence of Virulence Factors in Biofilm-Forming S. aureus

Out of 100 S. aureus isolates, 35 (95% CI: 26.36–44.75%) harbored at least one virulence gene, where the sea, tst, and PVL were detected in 30% (95% CI: 21.90–39.59%), 20% (95% CI: 13.34–28.88%), and 15% (95% CI: 9.31–23.28%) isolates, respectively. In addition, these three genes were significantly (p < 0.05) higher in strong biofilm-forming S. aureus isolates (sea: 100%; tst: 70%; PVL: 55%) than in moderate (sea: 12.98%; tst: 7.79%; PVL: 5.19%) and non-biofilm-forming (0% for all virulence genes) S. aureus isolates. None of the S. aureus isolates were found to be positive for the virulence seb gene. Moreover, the virulence genes sea, tst, and PVL were detected only in biofilm-forming S. aureus isolates, and non-biofilm-forming isolates did not harbor any virulence genes. Table 1 depicts the overall prevalence of different virulence genes detected in S. aureus isolates.
Sample-wise, S. aureus isolates detected from ready-to-eat foods showed the highest occurrence of different virulence genes compared with other samples (Supplementary Table S1).
Bivariate analysis revealed strong and positive significant correlations between virulence genes sea and tst (Pearson correlation coefficient, ρ = 0.600), sea and PVL (ρ = 0.458), and tst and PVL (ρ = 0.420). Table 2 shows the overall correlation outcomes between the virulence genes of S. aureus isolates.

2.2. Antibiogram Profiles of Biofilm-Forming S. aureus

By disk diffusion assay, all the isolated S. aureus exhibited resistance to oxacillin and cefoxitin (100/100, 95% CI: 96.30–100%), which indicates that all the 100 isolates were phenotypically MRSA in nature. In addition, resistance to ampicillin and penicillin was found in every single isolate. Resistance to erythromycin and gentamicin was estimated at 30% and 11%, respectively. Sensitivity to chloramphenicol, ciprofloxacin, co-trimoxazole, tetracycline, and azithromycin was estimated at 98%, 98%, 87%, 86%, and 85%, respectively. Figure 1 shows the overall antibiotic susceptibility profiles of 100 S. aureus isolates. Sample-wise phenotypic antibiotic resistance patterns are documented in Supplementary Table S1 and Figure 1. Moreover, there was no statistically significant correlation between any of the two antibiotics’ resistance in S. aureus isolates (Supplementary Table S2).

2.3. Association of Antibiotic Resistance Patterns with Biofilm-Forming S. aureus

The resistance patterns of all the antibiotics except oxacillin, ampicillin, penicillin, and cefoxitin (which showed 100% resistance in all levels of biofilm-forming isolates) were higher in biofilm-forming S. aureus isolates than in non-biofilm-forming isolates. Moreover, the occurrence of erythromycin resistance patterns was significantly (p < 0.05) higher in strong biofilm-formers (55%), compared with intermediate (24.68%) and non-biofilm-forming (0%) isolates. Strong biofilm-forming S. aureus isolates showed higher resistance to other antibiotics (except chloramphenicol and ciprofloxacin) compared with moderate and non-biofilm-producing S. aureus isolates, but there were no significant variations (p > 0.05) (Table 3).

2.4. Phenotypic MDR and MAR Nature in Biofilm-Forming S. aureus

Of 100 S. aureus isolates, 51 (95% CI: 41.35–60.58%) were phenotypically MDR in nature. A total of 12 resistance patterns were audited, among them, 11 were MDR patterns. The MDR pattern number 5 (E, OX, AMP, P, CX) was observed in the highest number of MDR S. aureus isolates (24/51, 47.06%, 95% CI: 34.05–60.48%). The resistance pattern number 12 (OX, AMP, P, CX) was not phenotypically MDR in nature, though it was found in 49 (95% CI: 39.42–58.65%) S. aureus isolates. Seven isolates exhibited resistance against four classes of antibiotics (patterns 1, 2, 3, and 4), comprising six antibiotics. Moreover, all 100 S. aureus isolates showed more than 0.2 MAR indices (MAR index: 0.33–0.55). The MDR and MAR index profiles of S. aureus isolates are arranged in Table 4.

2.5. Genotypic Prevalence of MRSA and other Antibiotic Resistance in Biofilm-Forming S. aureus

By PCR, the methicillin resistance gene mecA was found to be positive in 61% (95% CI: 51.20–69.98%) of S. aureus isolates, which was significantly (p < 0.05) higher in strong biofilm-formers (80%) compared with moderate/intermediate (58.44%) and non-biofilm (0%) formers (Table 5). Sample-wise, all types of samples contained the methicillin resistance gene mecA (Supplementary Table S1).
Moreover, all the biofilm-forming S. aureus isolates were found positive for at least one antibiotic resistance gene (Supplementary Table S1). The tetracycline resistance genes tetA and tetC were detected in 3% (95% CI: 0.82–8.45%) of S. aureus isolates, and the beta-lactam gene blaZ was in 100% of S. aureus isolates. However, there was not a significant difference (p > 0.05) between the level of biofilm formation and the occurrence of these resistance genes. No isolates were found to be positive for tetC (Table 5). Sample-wise data on different antibiotic resistance genes are given in Supplementary Table S1.

3. Discussion

Foods, especially ready-to-eat foods, are becoming incredibly popular, with an increased number of restaurants and street vendors around the globe, most notably in Bangladesh. Other food sources such as milk, meat, fish, and eggs always have a high demand among all classes of people. However, foods contaminated with S. aureus have the potential to cause food poisoning, generating serious public health risks. In addition, biofilm formation in S. aureus is responsible for different persistent or chronic staphylococcal infections. In this study, we present the first-time detection of virulence determinants and methicillin resistance in biofilm-forming S. aureus isolated from different foods and human hand swab samples in Bangladesh. Islam et al. [22] conducted almost-similar types of research in Bangladesh. They reported virulence factors and antibiotic resistance only in S. aureus isolates from food sources, but they did not focus on biofilm. In addition, we showed variations in the occurrence of virulence and antibiotic resistance with different degrees of biofilm formation in S. aureus isolates, but they did not.
The pathogenic characteristics of S. aureus isolates provide vital details on the isolates’ ability to develop human and animal infections. In this study, 30% of S. aureus isolates harbored at least one virulence gene, demonstrating their potential pathogenic and toxic characteristics. However, no isolates tested positive for the seb gene. Previously, Islam et al. [24] also reported various virulence genes in S. aureus isolates from food samples in Bangladesh, detecting a higher prevalence (ours vs. theirs) for seb (0% vs. 11.4%) and PVL (15% vs. 71.4%) genes and a lower prevalence for sea (30% vs. 25.7%) and tst (20% vs. 17.1%) genes, compared with our present study. In other countries, multiple previous studies detected virulence genes harboring S. aureus isolates with different observations from food samples such as raw milk, meat, eggs, ready-to-eat foods, fish, food handlers, etc. Mashouf et al. [25] detected virulence genes, sea (25.5%) and seb (4%) in S. aureus isolated from animal-originated foods in Iran; Puah et al. [26] detected sea (5.8%), seb (1.9%), tst (9.6%), and PVL (9.6%) in ready-to-eat foods in Malaysia; Rong et al. [27] reported sea (22.7%), seb (10.1%), tst (2.5%), and PVL (50.4%) in aquatic foods in China; Yang et al. [28] reported sea (33.3%), seb (36.2%), tst (7.3%), and PVL (11.6%) in retail ready-to-eat foods in China; and Adame-Gómez et al. [29] detected sea (53.1%), seb (3.1%), and tst (9.3%) in food, humans, and animals in Mexico. The disparities in the detection rate of virulence factors in S. aureus isolates might be due to variations in geographical distributions, sample sizes and types, detection rate, biofilm-forming abilities, the hygienic condition of the sampling sites, sampling methodologies, and other factors.
Staphylococcal enterotoxins (sea, seb, and others) produced by S. aureus are directly associated with staphylococcal food poisoning [30]. The higher prevalence of the sea gene than the seb gene in S. aureus isolates detected in the present study is not unusual because the isolates with SEA-type toxins cause the most staphylococcal infections and outbreaks, followed by isolates with other staphylococcal enterotoxin-related infections [24]. Detecting genes encoding staphylococcal enterotoxins in the isolated staphylococcal species indicates a serious public health concern since these toxins have resistance activity against high temperatures and can even retain their biological properties in milk during pasteurization [31]. The tst gene is related mainly to human S. aureus isolates [24]. The presence of the tst gene in food and human hand swab samples suggests that this type of gene could be transferred from humans to animals and vice versa via the food chain. Another virulence gene, PVL, is a pertinent S. aureus virulence gene that is attributed mostly to community-acquired infections [32]. The detection of the PVL gene in our study suggests that food can be contaminated by this virulence gene, and these spoiled foods could perhaps constitute a source of community-acquired infections. In addition, virulence genes were found to be significantly higher in strong biofilm-forming S. aureus isolates. This indicates that as the degree of biofilm formation in S. aureus isolates increases, so does their ability to develop infections.
Treatment of staphylococcal infections relies mostly on antibiotic therapy; however, it frequently fails due to their resistance to antibiotics. In addition, the presence of MRSA in foods and on food handlers’ hands raises serious public health implications. In this study, all of the isolates were phenotypically MRSA in nature, indicating a critical threat to consumers by limiting the treatment options. Animal-originated food and food products can be contaminated with MRSA from infected animals, and processed food can be contaminated by infected vendors during food processing. The detection of MRSA in food and human hand swab samples indicates a serious issue for human health because it could be transmitted to humans via the food supply chain, causing staphylococcal infection. In addition, MRSA strains are responsible for severe morbidity and mortality in hospitals and even in healthy individuals [33]. Previously in Bangladesh, Islam et al. [24] reported that 25.7% (9/35) of S. aureus isolates originating from food samples were MRSA in nature, which is relatively lower than our findings. However, Saber et al. [17] recorded a similar prevalence rate, detecting MRSA in 100% of food samples in Egypt. In addition, previous studies found MRSA in different foods and human hand samples with lower and higher occurrence rates, i.e., 57.1% in food handlers in Brazil [34]; 10.1% in retail ready-to-eat foods [35] and 8.4% in retail aquatic products [27] in China; 12.94% in retail chicken meat and eggs in Nepal [36]; 42.3% in street-vended foods in India [37]; and 22.6% in ready-to-eat meat sandwiches in Egypt [38]. It is possible that different strategies for the distribution and usage of antibiotics in humans and animals account for the varying rates of MRSA detection in food samples. Moreover, S. aureus isolates detected in this study were highly resistant to ampicillin (100%), penicillin (100), and erythromycin (30%), but highly sensitive to chloramphenicol.
In total, 51% of the isolates detected in this study were MDR in nature, and the MAR index of the isolates varied from 0.33 to 0.55, demonstrating that antibiotics were haphazardly used at the source of the contamination. According to Krumperman [39], isolates with a MAR index of more than 0.2 were thought to have come from a high-risk source of contamination where antibiotics are commonly used. In Bangladesh, antibiotics are readily available in the markets, and there are no proper established policies for their distribution and usage. Therefore, people use antibiotics without any prescriptions and/or consultation with human physicians or veterinarians. The overuse and misuse of antimicrobial agents in both humans and animals might be responsible for the development of MDR S. aureus isolates in different food sources.
The association analysis between the degree of biofilm formation and phenotypic antibiotic resistance revealed that most antibiotics (except ampicillin, penicillin, oxacillin, and cefoxitin) showed resistance only to biofilm-forming S. aureus isolates. Antibiotic resistance increased with the level of biofilm formation, including the determination of significantly higher resistance to erythromycin in strong biofilm-forming S. aureus isolates. Antimicrobial resistance in S. aureus has been reported to increase to 1000 times that of planktonic cells in the presence of biofilm [40]. Various factors explaining the unprecedented resistance of biofilm-forming S. aureus and other bacteria to antibiotics include: (1) lower or decreased metabolic and growth rates of biofilm-formers, which may render them intrinsically less sensitive to antibiotics; (2) the structure of the biofilm-EPS (extracellular polymeric substances) matrix that assists biofilm cells to reduce the access of antibiotics to regions of the biofilm; and (3) the distinct physiological characteristics of biofilm cells that help to express MDR efflux pumps and stress-response regulons for developing antibiotic resistance [41].
In our study, 61% (61/100) of biofilm-forming S. aureus isolates harbored the methicillin resistance gene, mecA. The standard gold method for detecting MRSA isolates is mecA detection via PCR [42]; however, in our study, the mecA gene was absent in 39% of S. aureus isolates that were phenotypically MRSA. The inconsistency of the correlation between phenotypic and genotypic resistance of MRSA might be due to the mutation of genes that result in non-functional proteins and the dearth of gene expression [43]. In addition, the absence of the mecA gene in the MRSA isolates might be due to the detection methods we used, or those MRSA isolates could harbor other methicillin resistance genes, such as mecB, mecC, or mecD [42]. Our findings suggest the possible presence of other intrinsic and extrinsic factors having the ability to compete with the mecA gene for developing MRSA. Furthermore, the resistance gene mecA was significantly higher in strong biofilm-forming S. aureus isolates compared with moderate and non-biofilm producers. The genotypic detection of MRSA in biofilm-forming S. aureus isolates from foods suggests a serious threat to human health because these resistance gene-containing isolates could easily be transferred to humans via the food supply chain. In addition, it would be challenging to manage these organisms clinically because of their biofilm-forming activities.
Penicillin-resistant S. aureus isolates could be interpreted as beta-lactamase resistance. Detecting the blaZ gene using PCR is also necessary to determine the occurrence of beta-lactamase-producing isolates [37]. In this study, blaZ was found positive in all the S. aureus isolates, which is relatively higher than the findings (69.23%) from a previous study [37]. Tetracycline resistance genes tetA and tetC were also detected in biofilm-forming S. aureus isolates. The detection of antibiotic resistance genes in our S. aureus isolates from foods and human hand swab samples suggests that these resistance genes might be transferred to other bacteria via horizontal transmission. We found these resistance genes in both foods and handlers’ hand swab samples, indicating a high-risk S. aureus contamination developed by the poor hygienic condition of the sampling sites.

4. Materials and Methods

4.1. Selection of S. aureus Isolates

Staphylococcus aureus (n = 100, biofilm producers = 97, and non-producers = 3) strains and their data were obtained from our previous study on detecting biofilm-producing S. aureus from different foods (raw milk, egg surface, chicken muscle, fish, and ready-to-eat foods) and humans’ hand swab samples [44]. Originally, S. aureus isolates were identified by culturing on mannitol salt (MS) agar plates, applying different bacteriological analytical methods (Gram’s staining, glucose, and mannitol utilization tests, coagulase test, catalase test, and Voges–Proskauer tests), and finally, employing the polymerase chain reaction (PCR) test targeting the nuc gene [44]. The biofilm-producing ability of S. aureus isolates was evaluated by qualitative (Congo red agar plate test), quantitative (crystal violet microtiter plate test), and genotypic (PCR) assays [44]. All the data related to biofilm-forming S. aureus are documented in Supplementary Table S1.

4.2. Molecular Detection of Virulence Factors

PCR-confirmed S. aureus isolates were subjected to a simplex PCR for the detection of virulence factors, namely staphylococcal enterotoxin A (sea), staphylococcal enterotoxin B (seb), tst, and PVL (Table 6).
The DNA for PCR was extracted from pure cultures of S. aureus using the boiling technique [51,52]. The genomic DNA was amplified using a PCR thermal cycler (ASTEC, Fukuoka, Japan). The PCR mixture was prepared following the previous study [44], and the PCR conditions were set following the previous studies mentioned in Table 6. The PCR products that had been amplified were then run through a gel electrophoresis machine (Nippon Genetics, Tokyo, Japan) using 1.5% agarose (Invitrogen, Waltham, MA, USA). After completing the gel run, the products were stained using ethidium bromide (HiMedia, Maharashtra, India) and checked for their expected amplicon sizes using an ultraviolet trans-illuminator (Biometra, Göttingen, Germany). A 100-bp DNA ladder (Promega, Madison, WI, USA) was used to compare the sizes of the bands.

4.3. Antimicrobial Susceptibility Testing (AST)

The AST of isolated S. aureus was analyzed by the disk diffusion test [53] on Mueller–Hinton agar (HiMedia, India) plates. The concentration of grown S. aureus cultures was maintained by comparing it with 0.5 McFarland solution (HiMedia, Maharashtra, India). Eleven commercially available antibiotics (from seven antibiotic classes) were employed, including amphenicols (chloramphenicol-30 μg), macrolides (azithromycin-30 μg and erythromycin-15 μg), sulfonamides (co-trimoxazole-25 μg), fluoroquinolones (ciprofloxacin-5 μg), aminoglycosides (gentamicin-10 μg), penicillins (oxacillin-10 μg, penicillin-10 μg, and ampicillin-25 μg), tetracyclines (tetracycline-30 μg), and cephalosporins (cefoxitin-30 μg). The results of the AST of S. aureus isolates were interpreted by the CLSI guidelines [54]. Isolates showing resistance to methicillin and cefoxitin were considered phenotypically MRSA in nature. All the antibiotic disks were collected from two different manufacturers (HiMedia, Maharashtra, India, and Oxoid, Hampshire, UK), and all the susceptibility tests were done three times to confirm the exact results. MDR isolates were those that showed resistance to more than two antimicrobial categories [55]. Moreover, the index of multiple antibiotic resistance (MAR) was enumerated by the previously described formula [39]:
MAR   index = The   number   of   antimicrobials   to   which   a   given   S .   a u r e u s   strain   is   resistant   The   sum   of   antibiotics   to   which   an   isolate   was   subjected

4.4. Molecular Detection of MRSA with other Antibiotic Resistance Genes

All the S. aureus isolates were subjected to PCR to detect their genotypic antibiotic resistance profiles. The molecular detection of MRSA was performed by detecting the methicillin resistance gene (mecA) using a PCR assay. Moreover, the genes associated with resistance to beta-lactams (blaZ) and tetracyclines (tetA, tetB, and tetC) were also tested using PCR (Table 6). The same amplification method was used to detect antibiotic resistance genes in S. aureus isolates as was used to detect virulence genes.

4.5. Statistical Analysis

Excel 365 (Microsoft/Office 365, Redmond, WA, USA) was used to incorporate data; GraphPad Prism (Prism 8.4.2, San Diego, CA, USA) and the Statistical Package for Social Science (IBM SPSS 25.0, Chicago, IL, USA) were used to analyze data.

4.5.1. Descriptive Analysis

Descriptive analysis was employed to calculate the prevalence of different variables. To estimate the prevalence, a binomial 95% confidence interval (CI) was enumerated by GraphPad Prism using a previous method [56]. Moreover, using SPSS, the variations in the occurrence of virulence and antibiotic resistance with the occurrence of different degrees of biofilm formation in S. aureus isolates were determined by the chi-square test for relatedness (with the Z-test for proportion) with a ≤ 0.05 significance p-value.

4.5.2. Bivariate Analysis

Using SPSS, the Pearson correlation coefficients were calculated to check whether any of the two antibiotics resistant (phenotypically) to S. aureus were correlated (statistically significant). Only those antibiotics that did not show constant resistance against S. aureus isolates were analyzed for the bivariate analysis. Moreover, a correlation between any two virulence genes was also determined. The significance level for the correlation was selected at p ≤ 0.05.

5. Conclusions

As stated, our study detected virulence determinants and methicillin resistance in biofilm-forming S. aureus isolates sourced from different foods and human hand swab samples for the first time in Bangladesh. This study shows a high prevalence rate of genes encoding virulence factors and methicillin resistance in S. aureus isolates. The S. aureus isolates also showed resistance to several clinically important antibiotics, which demonstrates a potential public health concern by transferring to humans from foods via the food supply chain. In addition, as revealed in the present study, their presence in foods and food handlers indicates that foods such as raw milk, chicken meat, ready-to-eat foods, fish, and eggs could be a possible source of virulent MRSA with significant clinical relevance. Standardized surveillance and monitoring programs, combined with an organized educational awareness campaign on AMR and good hygiene practices, should be implemented throughout the food production and supply chain to reduce the colonization and dissemination of virulent MRSA and biofilm strains and to guarantee the safety of foods.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/antibiotics11111666/s1, Table S1: Distribution of genes associated with biofilm formation, antibiotic resistance patterns, and virulence profiles in S. aureus isolates; Table S2: Pearson correlation coefficients between any of two antibiotics showing resistance to S. aureus isolates detected from different foods and hand swab samples.

Author Contributions

Conceptualization, M.T.R.; methodology, M.T.R.; software, M.S.I.; validation, M.T.R.; formal analysis, M.S.I. and F.M.B.; investigation, F.M.B., M.S.I., M.L.R., M.A.U., F.B.F., F.H.N. and S.I.; resources, M.T.R.; data curation, F.M.B., M.S.I. and M.L.R.; writing—original draft preparation, M.S.I. and F.M.B.; writing—review and editing, M.S.I., M.A.S., A.T.R., M.M.K., M.R. and M.T.R.; writing—critical revision, M.T.R.; visualization, M.S.I.; supervision, M.R. and M.T.R.; project administration, M.T.R.; funding acquisition, M.T.R. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by Tertiary Education Trust Fund, Nigeria (Grant No. TETFund/2020) and Bangladesh Agricultural University Research System (BAURES) project (Project No. 2019/8/BAU).

Institutional Review Board Statement

The Institutional Ethical Committee (AWEEC/BAU/2022 (20)) approved the methodologies and protocols used in this study.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

The authors would also like to express their gratitude to the Department of Microbiology and Hygiene, Faculty of Veterinary Science, Bangladesh Agricultural University, Mymensingh, for their assistance during the research.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Rahman, M.; Sobur, M.; Islam, M.; Ievy, S.; Hossain, M.; El Zowalaty, M.E.; Rahman, A.M.M.; Ashour, H.M. Zoonotic diseases: Etiology, impact, and control. Microorganisms 2020, 8, 1405. [Google Scholar] [CrossRef]
  2. Urmi, M.R.; Ansari, W.K.; Islam, M.S.; Sobur, M.A.; Rahman, M.; Rahman, M.T. Antibiotic resistance patterns of Staphylococcus spp. Isolated from fast foods sold in different restaurants of Mymensingh. Bangladesh. J. Adv. Vet. Anim. Res. 2021, 8, 274–281. [Google Scholar] [CrossRef]
  3. Argudín, M.Á.; Mendoza, M.C.; Rodicio, M.R. Food poisoning and Staphylococcus aureus enterotoxins. Toxins 2010, 2, 1751–1773. [Google Scholar] [CrossRef]
  4. Oliveira, D.; Borges, A.; Simões, M. Staphylococcus aureus toxins and their molecular activity in infectious diseases. Toxins 2018, 10, 252. [Google Scholar] [CrossRef] [Green Version]
  5. Jain, V.K.; Singh, M.; Joshi, V.G.; Chhabra, R.; Singh, K.; Rana, Y.S. Virulence and antimicrobial resistance gene profiles of Staphylococcus aureus associated with clinical mastitis in cattle. PLoS ONE 2022, 17, e0264762. [Google Scholar]
  6. Ricciardi, B.F.; Muthukrishnan, G.; Masters, E.; Ninomiya, M.; Lee, C.C.; Schwarz, E.M. Staphylococcus aureus evasion of host immunity in the setting of Prosthetic Joint Infection: Biofilm and beyond. Curr. Rev. Musculoskelet. Med. 2018, 11, 389–400. [Google Scholar] [CrossRef]
  7. Costa, O.Y.; Raaijmakers, J.M.; Kuramae, E.E. Microbial extracellular polymeric substances: Ecological function and impact on soil aggregation. Front. Microbiol. 2018, 9, 1636. [Google Scholar] [CrossRef] [Green Version]
  8. Donlan, R.M. Biofilm Formation: A Clinically Relevant Microbiological Process. Clin. Infect. Dis. 2001, 33, 1387–1392. [Google Scholar] [CrossRef] [Green Version]
  9. Poudel, B.; Zhang, Q.; Trongtorsak, A.; Pyakuryal, B.; Egoryan, G.; Sous, M.; Ahmed, R.; Trelles-Garcia, D.P.; Yanez-Bello, M.A.; Trelles-Garcia, V.P.; et al. An overlooked cause of septic shock: Staphylococcal Toxic Shock Syndrome secondary to an axillary abscess. IDCases 2021, 23, e01039. [Google Scholar] [CrossRef]
  10. Schaumburg, F.; Ngoa, U.A.; Kösters, K.; Köck, R.; Adegnika, A.A.; Kremsner, P.G.; Lell, B.; Peters, G.; Mellmann, A.; Becker, K. Virulence factors and genotypes of Staphylococcus aureus from infection and carriage in Gabon. Clin. Microbiol. Infect. 2011, 17, 1507–1513. [Google Scholar] [CrossRef] [Green Version]
  11. Islam, M.S.; Paul, A.; Talukder, M.; Roy, K.; Sobur, M.A.; Ievy, S.; Nayeem, M.M.H.; Rahman, S.; Nazir, K.N.H.; Hossain, M.T.; et al. Migratory birds travelling to Bangladesh are potential carriers of multi-drug resistant Enterococcus spp., Salmonella spp., and Vibrio spp. Saudi J. Bio. Sci. 2021, 28, 5963–5970. [Google Scholar] [CrossRef]
  12. Islam, M.; Sobur, M.; Rahman, S.; Ballah, F.M.; Ievy, S.; Siddique, M.P.; Rahman, M.; Kafi, M.; Rahman, M. Detection of blaTEM, blaCTXM-M, blaCMY, and blaSHV Genes Among Extended-Spectrum Beta-Lactamase-Producing Escherichia coli Isolated from Migratory Birds Travelling to Bangladesh. Microb. Ecol. 2022, 83, 942–950. [Google Scholar] [CrossRef]
  13. Ievy, S.; Islam, M.; Sobur, M.; Talukder, M.; Rahman, M.; Khan, M.F.R. Molecular detection of avian pathogenic Escherichia coli (APEC) for the first time in layer farms in Bangladesh and their antibiotic resistance patterns. Microorganisms 2020, 8, 1021. [Google Scholar] [CrossRef]
  14. Murray, C.J.; Ikuta, K.S.; Sharara, F.; Swetschinski, L.; Aguilar, G.R.; Gray, A.; Han, C.; Bisignano, C.; Rao, P.; Wool, E.; et al. Global burden of bacterial antimicrobial resistance in 2019: A systematic analysis. Lancet 2022, 399, 629–655. [Google Scholar] [CrossRef]
  15. Roy, K.; Islam, M.S.; Paul, A.; Ievy, S.; Talukder, M.; Sobur, M.A.; Ballah, F.M.; Khan, M.S.R.; Rahman, M.T. Molecular detection and antibiotyping of multi-drug resistant Enterococcus faecium from healthy broiler chickens in Bangladesh. Vet. Med. Sci. 2022, 8, 200–210. [Google Scholar] [CrossRef]
  16. Talukder, M.; Islam, M.S.; Ievy, S.; Sobur, M.A.; Ballah, F.M.; Najibullah, M.; Rahman, M.B.; Rahman, M.T.; Khan, M.F.R. Detection of multidrug resistant Salmonella spp. From healthy and diseased broilers having potential public health significance. J. Adv. Biotechnol. Exp. Ther. 2021, 4, 248–255. [Google Scholar] [CrossRef]
  17. Saber, T.; Samir, M.; El-Mekkawy, R.M.; Ariny, E.; El-Sayed, S.R.; Enan, G.; Abdelatif, S.H.; Askora, A.; Merwad, A.M.; Tartor, Y.H. Methicillin-and vancomycin-resistant Staphylococcus aureus from humans and ready-to-eat meat: Characterization of antimicrobial resistance and biofilm formation ability. Front. Microbiol. 2021, 12, 735494. [Google Scholar] [CrossRef]
  18. Klevens, R.M.; Morrison, M.A.; Nadle, J.; Petit, S.; Gershman, K.; Ray, S.; Harrison, L.H.; Lynfield, R.; Dumyati, G.; Townes, J.M.; et al. Invasive methicillin-resistant Staphylococcus aureus infections in the United States. JAMA 2007, 298, 1763–1771. [Google Scholar] [CrossRef] [Green Version]
  19. Hossain, M.J.; Islam, M.S.; Sobur, M.A.; Zaman, S.B.; Nahar, A.; Rahman, M.; Rahman, M.T. Exploring poultry farm environment for antibiotic resistant Escherichia coli, Salmonella spp., and Staphylococcus spp. having public health significance. J. Bangladesh Agric. Univ. 2020, 18, 615–622. [Google Scholar]
  20. Rahman, M.T.; Kobayashi, N.; Alam, M.M.; Ishino, M. Genetic analysis of mecA homologues in Staphylococcus sciuri strains derived from mastitis in dairy cattle. Microb. Drug Resist. 2005, 11, 205–214. [Google Scholar] [CrossRef]
  21. Piechota, M.; Kot, B.; Frankowska-Maciejewska, A.; Gruzewska, A.; Woźniak-Kosek, A. Biofilm formation by Methicillin-resistant and Methicillin-sensitive Staphylococcus aureus strains from hospitalized patients in Poland. BioMed Res. Int. 2018, 2018, 4657396. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  22. Chen, Q.; Xie, S.; Lou, X.; Cheng, S.; Liu, X.; Zheng, W.; Zheng, Z.; Wang, H. Biofilm formation and prevalence of adhesion genes among Staphylococcus aureus isolates from different food sources. Microbiologyopen 2020, 9, e00946. [Google Scholar] [CrossRef] [PubMed]
  23. Li, H.; Andersen, P.S.; Stegger, M.; Sieber, R.N.; Ingmer, H.; Staubrand, N.; Dalsgaard, A.; Leisner, J.J. Antimicrobial Resistance and Virulence Gene Profiles of Methicillin-Resistant and -Susceptible Staphylococcus aureus from Food Products in Denmark. Front. Microbiol. 2019, 10, 2681. [Google Scholar] [CrossRef] [PubMed]
  24. Islam, M.A.; Parveen, S.; Rahman, M.; Huq, M.; Nabi, A.; Khan, Z.U.M.; Ahmed, N.; Wagenaar, J.A. Occurrence and characterization of methicillin resistant Staphylococcus aureus in processed raw foods and ready-to-eat foods in an urban setting of a developing country. Front. Microbiol. 2019, 10, 503. [Google Scholar] [CrossRef]
  25. Mashouf, R.Y.; Hosseini, S.M.; Mousavi, S.M.; Arabestani, M.R. Prevalence of enterotoxin genes and antibacterial susceptibility pattern of Staphylococcus aureus strains isolated from animal originated foods in West of Iran. Oman Med. J. 2015, 30, 283–290. [Google Scholar] [CrossRef]
  26. Puah, S.M.; Chua, K.H.; Tan, J.A.M.A. Virulence Factors and Antibiotic Susceptibility of Staphylococcus aureus Isolates in Ready-to-Eat Foods: Detection of S. aureus Contamination and a High Prevalence of Virulence Genes. Int. J. Environ. Res. Public Health 2016, 13, 199. [Google Scholar] [CrossRef] [Green Version]
  27. Rong, D.; Wu, Q.; Xu, M.; Zhang, J.; Yu, S. Prevalence, virulence genes, antimicrobial susceptibility, and genetic diversity of Staphylococcus aureus from retail aquatic products in China. Front. Microbiol. 2017, 8, 714. [Google Scholar] [CrossRef] [Green Version]
  28. Yang, X.; Yu, S.; Wu, Q.; Zhang, J.; Wu, S.; Rong, D. Multilocus Sequence Typing and Virulence-Associated Gene Profile Analysis of Staphylococcus aureus Isolates from Retail Ready-to-Eat Food in China. Front. Microbiol. 2018, 9, 197. [Google Scholar] [CrossRef]
  29. Adame-Gómez, R.; Castro-Alarcón, N.; Vences-Velázquez, A.; Toribio-Jiménez, J.; Pérez-Valdespino, A.; Leyva-Vázquez, M.A.; Ramírez-Peralta, A. Genetic diversity and virulence factors of S. aureus isolated from food, humans, and animals. Int. J. Microbiol. 2020, 2020, 1048097. [Google Scholar] [CrossRef]
  30. Lv, G.; Jiang, R.; Zhang, H.; Wang, L.; Li, L.; Gao, W.; Zhang, H.; Pei, Y.; Wei, X.; Dong, H.; et al. Molecular Characteristics of Staphylococcus aureus From Food Samples and Food Poisoning Outbreaks in Shijiazhuang, China. Front. Microbiol. 2021, 12, 1436. [Google Scholar] [CrossRef]
  31. Zschöck, M.; Kloppert, B.; Wolter, W.; Hamann, H.P.; Lämmler, C.H. Pattern of enterotoxin genes seg, seh, sei and sej positive Staphylococcus aureus isolated from bovine mastitis. Vet. Microbiol. 2005, 108, 243–249. [Google Scholar] [CrossRef] [PubMed]
  32. Wang, X.; Li, G.; Xia, X.; Yang, B.; Xi, M.; Meng, J. Antimicrobial susceptibility and molecular typing of methicillin-resistant Staphylococcus aureus in retail foods in Shaanxi, China. Foodborne Pathog. Dis. 2014, 11, 281–286. [Google Scholar] [CrossRef]
  33. Weber, J.T. Community-associated methicillin-resistant Staphylococcus aureus. Clin. Infect. Dis. 2005, 41, S269–S272. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Ferreira, J.S.; Costa, W.L.R.; Cerqueira, E.S.; Carvalho, J.S.; Oliveira, L.C.; Almeida, R.C.C. Food handler-associated methicillin-resistant Staphylococcus aureus in public hospitals in Salvador, Brazil. Food Control 2014, 37, 395–400. [Google Scholar] [CrossRef]
  35. Yang, X.; Zhang, J.; Yu, S.; Wu, Q.; Guo, W.; Huang, J.; Cai, S. Prevalence of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus in retail ready-to-eat foods in China. Front. Microbiol. 2016, 7, 816. [Google Scholar] [CrossRef]
  36. Devkota, S.P.; Paudel, A.; Gurung, K. Vancomycin Intermediate MRSA Isolates Obtained from Retail Chicken Meat and Eggs Collected at Pokhara, Nepal. Nepal J. Biotechnol. 2019, 7, 90–95. [Google Scholar] [CrossRef] [Green Version]
  37. Sivakumar, M.; Dubal, Z.B.; Kumar, A.; Bhilegaonkar, K.; Vinodh Kumar, O.R.; Kumar, S.; Kadwalia, A.; Shagufta, B.; Grace, M.R.; Ramees, T.P.; et al. Virulent methicillin resistant Staphylococcus aureus (MRSA) in street vended foods. J. Food Sci. Technol. 2019, 56, 1116–1126. [Google Scholar] [CrossRef]
  38. Mahros, M.A.; Abd-Elghany, S.M.; Sallam, K.I. Multidrug-, methicillin-, and vancomycin-resistant Staphylococcus aureus isolated from ready-to-eat meat sandwiches: An ongoing food and public health concern. Int. J. Food Microbiol. 2021, 346, 109165. [Google Scholar] [CrossRef]
  39. Krumperman, P.H. Multiple antibiotic resistance indexing of Escherichia coli to identify high-risk sources of fecal contamination of foods. Appl. Environ. Microbiol. 1983, 46, 165–170. [Google Scholar] [CrossRef] [Green Version]
  40. Guo, Y.; Song, G.; Sun, M.; Wang, J.; Wang, Y. Prevalence and therapies of antibiotic-resistance in Staphylococcus aureus. Front. Cell. Infect. Microbiol. 2020, 10, 107. [Google Scholar] [CrossRef] [Green Version]
  41. Davies, D. Understanding biofilm resistance to antibacterial agents. Nat. Rev. Drug Discov. 2003, 2, 114–122. [Google Scholar] [CrossRef] [PubMed]
  42. Sobur, M.; Islam, M.; Haque, Z.F.; Orubu, E.S.F.; Toniolo, A.; Choudhury, M.; Rahman, M. Higher seasonal temperature enhances the occurrence of methicillin resistance of Staphylococcus aureus in house flies (Musca domestica) under hospital and environmental settings. Folia Microbiol. 2022, 67, 109–119. [Google Scholar] [CrossRef] [PubMed]
  43. Martineau, F.; Picard, F.J.; Lansac, N.; Ménard, C.; Roy, P.H.; Ouellette, M.; Bergeron, M.G. Correlation between the resistance genotype determined by multiplex PCR assays and the antibiotic susceptibility patterns of Staphylococcus aureus and Staphylococcus epidermidis. Antimicrob. Agents Chemother. 2000, 44, 231–238. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Ballah, F.M.; Islam, M.S.; Rana, M.L.; Ferdous, F.B.; Ahmed, R.; Pramanik, P.K.; Karmoker, J.; Ievy, S.; Sobur, M.A.; Siddique, M.P.; et al. Phenotypic and Genotypic Detection of Biofilm-Forming Staphylococcus aureus from Different Food Sources in Bangladesh. Biology 2022, 11, 949. [Google Scholar] [CrossRef] [PubMed]
  45. Lee, J.H. Methicillin (oxacillin)-resistant Staphylococcus aureus strains isolated from major food animals and their potential transmission to humans. Appl. Environ. Microbiol. 2003, 69, 6489–6494. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  46. Randall, L.P.; Cooles, S.W.; Osborn, M.K.; Piddock, L.J.; Woodward, M.J. Antibiotic resistance genes, integrons and multiple antibiotic resistance in thirty-five serotypes of Salmonella enterica isolated from humans and animals in the UK. J. Antimicrob. Chemother. 2004, 53, 208–216. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  47. Ng, L.K.; Martin, I.; Alfa, M.; Mulvey, M. Multiplex PCR for the detection of tetracycline resistant genes. Mol. Cell. Probes 2001, 15, 209–215. [Google Scholar] [CrossRef] [PubMed]
  48. Rosato, A.E.; Kreiswirth, B.N.; Craig, W.A.; Eisner, W.; Climo, M.W.; Archer, G.L. mecA-blaZ corepressors in clinical Staphylococcus aureus isolates. Antimicrob. Agents Chemother. 2003, 47, 1460–1463. [Google Scholar] [CrossRef] [Green Version]
  49. Becker, K.; Roth, R.; Peters, G. Rapid and Specific Detection of Toxigenic Staphylococcus aureus: Use of Two Multiplex PCR Enzyme Immunoassays for Amplification and Hybridization of Staphylococcal Enterotoxin Genes, Exfoliative Toxin Genes, and Toxic Shock Syndrome Toxin 1 Gene. J. Clin. Microbiol. 1998, 36, 2548–2553. [Google Scholar] [CrossRef] [Green Version]
  50. Lina, G.; Piémont, Y.; Godail-Gamot, F.; Bes, M.; Peter, M.O.; Gauduchon, V.; Vandenesch, F.; Etienne, J. Involvement of panton-valentine leukocidin—Producing Staphylococcus aureus in primary skin infections and pneumonia. Genet. Mol. Res. 1999, 29, 1128–1132. [Google Scholar] [CrossRef]
  51. Islam, M.S.; Nayeem, M.M.H.; Sobur, M.A.; Ievy, S.; Islam, M.A.; Rahman, S.; Kafi, M.A.; Ashour, H.M.; Rahman, M.T. Virulence determinants and multidrug resistance of Escherichia coli isolated from migratory birds. Antibiotics 2021, 10, 190. [Google Scholar] [CrossRef] [PubMed]
  52. Tawyabur, M.; Islam, M.; Sobur, M.; Hossain, M.; Mahmud, M.; Paul, S.; Hossain, M.T.; Ashour, H.M.; Rahman, M. Isolation and characterization of multidrug-resistant Escherichia coli and Salmonella spp. from healthy and diseased turkeys. Antibiotics 2020, 9, 770. [Google Scholar] [CrossRef] [PubMed]
  53. Bayer, A.W.; Kirby, W.M.; Sherris, J.C.; Turck, M. Antibiotic susceptibility testing by a standardized single disc method. Am. J. Clin. Pathol. 1966, 45, 493–496. [Google Scholar] [CrossRef]
  54. CLSI. Performance Standards for Antimicrobial Susceptibility Testing, 30th ed.; CLSI Supplement M100s; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2020. [Google Scholar]
  55. Sweeney, M.T.; Lubbers, B.V.; Schwarz, S.; Watts, J.L. Applying definitions for multidrug resistance, extensive drug resistance and pandrug resistance to clinically significant livestock and companion animal bacterial pathogens. J. Antimicrob. Chemother. 2018, 73, 1460–1463. [Google Scholar] [CrossRef] [PubMed]
  56. Brown, L.D.; Cai, T.T.; DasGupta, A. Interval estimation for a binomial proportion. Stat. Sci. 2001, 16, 101–133. [Google Scholar] [CrossRef]
Antibiotics 11 01666 g001 550
Figure 1. Antibiogram profiles of biofilm-forming S. aureus isolated from different foods and human hand swab samples. C = Chloramphenicol, E = Erythromycin, COT = Co-trimoxazole, CIP = Ciprofloxacin, AZM = Azithromycin, GEN = Gentamicin, OX = Oxacillin, AMP = Ampicillin, TE = Tetracycline, P = Penicillin, CX = Cefoxitin, S = Sensitive, I = Intermediate, and R = Resistant.
Figure 1. Antibiogram profiles of biofilm-forming S. aureus isolated from different foods and human hand swab samples. C = Chloramphenicol, E = Erythromycin, COT = Co-trimoxazole, CIP = Ciprofloxacin, AZM = Azithromycin, GEN = Gentamicin, OX = Oxacillin, AMP = Ampicillin, TE = Tetracycline, P = Penicillin, CX = Cefoxitin, S = Sensitive, I = Intermediate, and R = Resistant.
Antibiotics 11 01666 g001
Table
Table 1. Detection of virulence genes in biofilm-forming S. aureus strains (n = 100) isolated from different foods and hand swab samples.
Table 1. Detection of virulence genes in biofilm-forming S. aureus strains (n = 100) isolated from different foods and hand swab samples.
Virulence GenesVirulence in Different Degrees of Biofilm FormationTotal No. of Positive Isolates (%, 95% CI)p-Value
No. of Strong Biofilm Formers (n = 20)No. of Intermediate Biofilm Formers (n = 77)No. of Non-Biofilm Formers (n = 3)
sea20 (100% a)10 (12.98% b)0 (0% b)30 (30, 21.90–39.59%)<0.001
seb0 (0% a)0 (0% a)0 (0% a)0 (0, 00.00–3.70%)NA
tst14 (70% a)6 (7.79% b)0 (0% b)20 (20, 13.34–28.88%)<0.001
PVL11 (55% a)4 (5.19% b)0 (0% b)15 (15, 9.31–23.28%)<0.001
Values with different superscripts differ significantly (p < 0.05) within the variable under assessment, CI = Confidence interval, NA = Not applied, n = number of isolates.
Table
Table 2. Pearson correlation coefficient to assess the pairs of any of two virulence genes detected in biofilm-forming S. aureus isolated from different foods and human hand swab samples.
Table 2. Pearson correlation coefficient to assess the pairs of any of two virulence genes detected in biofilm-forming S. aureus isolated from different foods and human hand swab samples.
seasebtstPVL
seaρ1
p-value-
sebρ.a.a
p-value--
tstρ0.600 **.a1
p-value0.000--
PVLρ0.458 **.a0.420 **1
p-value0.000-0.000-
ρ = Pearson correlation coefficient, ** Significant correlation at the 0.01 level (p-value), .a = Not calculable, as at least one of the input variables is fixed.
Table
Table 3. Association of antibiotic resistance patterns and biofilm formation in S. aureus strains detected in different food and hand swab samples.
Table 3. Association of antibiotic resistance patterns and biofilm formation in S. aureus strains detected in different food and hand swab samples.
AntibioticsAntibiotic Resistance in Different Degrees of Staphylococcal Biofilm FormationTotal No. of Resistant Isolates (%, 95% CI)p-Value
No. of Strong Biofilm Formers (n = 20)No. of Intermediate Biofilm Formers (n = 77)No. of Non-Biofilm Formers (n = 3)
C0 (0% a)1 (1.30% a)0 (0% a)1 (1, 0.05–5.45%)0.860
E11 (55% a)19 (24.68% b)0 (0% b)30 (30, 21.90–39.59%)0.016
COT1 (5% a)3 (3.90% a)0 (0% a)4 (4, 1.57–9.84%)0.914
CIP0 (0% a)1 (1.30% a)0 (0% a)1 (1, 0.05–5.45%)0.860
AZM2 (10% a)2 (2.60% a)0 (0% a)4 (4, 1.57–9.84%)0.302
GEN3 (15% a)8 (10.39% a)0 (0% a)11 (11, 6.25–18.63%)0.695
OX20 (100% a)77 (100% a)3 (100% a)100 (100, 96.30–100%)NA
AMP20 (100% a)77 (100% a)3 (100% a)100 (100, 96.30–100%)NA
TE3 (15% a)4 (5.20% a)0 (0% a)7 (7, 3.43–13.75%)0.276
CX20 (100% a)77 (100% a)3 (100% a)100 (100, 96.30–100%)NA
P20 (100% a)77 (100% a)3 (100% a)100 (100, 96.30–100%)NA
Values with different superscripts differ significantly (p < 0.05) within the variable under assessment, CI = Confidence interval, NA= Not applied, n = number of isolates, C = Chloramphenicol, E = Erythromycin, COT = Co-trimoxazole, CIP = Ciprofloxacin, AZM = Azithromycin, GEN = Gentamicin, OX = Oxacillin, AMP = Ampicillin, TE = Tetracycline, P = Penicillin, and CX = Cefoxitin.
Table
Table 4. MDR and MAR profiles of S. aureus isolates detected from different foods and hand swab samples.
Table 4. MDR and MAR profiles of S. aureus isolates detected from different foods and hand swab samples.
No. of PatternAntibiotic Resistance PatternsNo. of Antibiotics (Classes)No. of IsolatesOverall MDR Isolates (%)MAR Index
1E, COT, OX, AMP, P, CX6 (4)151/100 (51)0.55
2AZM, GEN, OX, AMP, P, CX6 (4)1
3E, OX, AMP, P, CX, TE6 (4)3
4E, GEN, OX, AMP, P, CX6 (4)2
5E, OX, AMP, P, CX5 (3)240.46
6AZM, OX, AMP, P, CX5 (3)3
7GEN, OX, AMP, P, CX5 (3)8
8COT, OX, AMP, P, CX5 (3)3
9OX, AMP, P, CX, TE5 (3)4
10CIP, OX, AMP, P, CX5 (3)1
11C, OX, AMP, P, CX5 (3)1
12 *OX, AMP, P, CX4 (2)49-0.33
MDR = multidrug resistant, MAR = multiple antibiotic resistance, C = Chloramphenicol, E = Erythromycin, COT = Co-trimoxazole, CIP = Ciprofloxacin, AZM= Azithromycin, GEN = Gentamicin, OX = Oxacillin, AMP = Ampicillin, TE = Tetracycline, P = Penicillin, and CX = Cefoxitin; * Non-multidrug-resistant.
Table
Table 5. Detection of antibiotic resistance genes in biofilm-forming S. aureus strains (n= 100) detected from different foods and hand swab samples.
Table 5. Detection of antibiotic resistance genes in biofilm-forming S. aureus strains (n= 100) detected from different foods and hand swab samples.
Antibiotic Resistance GenesOccurrence of Antibiotic Resistance Genes in Different Degrees of Staphylococcal Biofilm FormationTotal No. of Positive Isolates (%, 95% CI)p-Value
No. of Strong Biofilm Formers (n = 20)No. of Intermediate Biofilm Formers (n = 77)No. of Non-Biofilm Formers (n = 3)
mecA16 (80% a)45 (58.44% b)0 (0% b)61 (61, 51.20–69.98%)0.0189
blaZ20 (100% a)77 (100% a)3 (100% a)100 (100, 96.30–100.00%)NA
tetA0 (0% a)3 (3.90% a)0 (0% a)3 (3, 0.82–8.45%)0.6301
tetB0 (0% a)0 (0% a)0 (0% a)0 (0, 0.00–3.70%)NA
tetC2 (10% a)1 (1.30% a)0 (0% a)3 (3, 0.82–8.45%)0.1209
Values with different superscripts differ significantly (p < 0.05) within the variable under assessment, CI = Confidence interval, NA = Not applied, n = number of isolates.
Table
Table 6. Primers’ list associated with the virulence and antibiotic resistance.
Table 6. Primers’ list associated with the virulence and antibiotic resistance.
FactorsTargeted GenesPrimer Sequence (5′–3′)Annealing TemperatureAmplicon Size (Bp)References
Antibiotic resistancemecAF: AAAATCGATGGTAAAGGTTGG
R: AGTTCTGGCACTACCGGATTTTGC		55533[45]
tetAF: GGTTCACTCGAACGACGTCA
R: CTGTCCGACAAGTTGCATGA		57577[46]
tetBF: CCTCAGCTTCTCAACGCGTG
R: GCACCTTGCTCATGACTCTT		56634
tetCF: CTT GAGAGCCTTCAACCCAG
R: ATG GTCGTCATCTACCTGCC		57418[47]
blaZF: TCAAACAGTTCACATGCC
R: TTCATTACACTCTGGCG		46900[48]
VirulenceseaF: CCTTTGGAAACGGTTAAAACG
R: TCTGAACCTTCCCATCAAAAAC		55128[49]
sebF: TCGCATCAAACTGACAAACG
R: GCAGGTACTCTATAAGTGCCTGC		55477
tstF: AAGCCCTTTGTTGCTTGCG
R: ATCGAACTTTGGCCCATACTTT		55445
PVLF: ATCATTAGGTAAAATGTCTGGACATGATCCA
R: GCATCAAGTGTATTGGATAGCAAAAGC		55433[50]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Ballah, F.M.; Islam, M.S.; Rana, M.L.; Ullah, M.A.; Ferdous, F.B.; Neloy, F.H.; Ievy, S.; Sobur, M.A.; Rahman, A.T.; Khatun, M.M.; et al. Virulence Determinants and Methicillin Resistance in Biofilm-Forming Staphylococcus aureus from Various Food Sources in Bangladesh. Antibiotics 2022, 11, 1666. https://doi.org/10.3390/antibiotics11111666

AMA Style

Ballah FM, Islam MS, Rana ML, Ullah MA, Ferdous FB, Neloy FH, Ievy S, Sobur MA, Rahman AT, Khatun MM, et al. Virulence Determinants and Methicillin Resistance in Biofilm-Forming Staphylococcus aureus from Various Food Sources in Bangladesh. Antibiotics. 2022; 11(11):1666. https://doi.org/10.3390/antibiotics11111666

Chicago/Turabian Style

Ballah, Fatimah Muhammad, Md. Saiful Islam, Md. Liton Rana, Md. Ashek Ullah, Farhana Binte Ferdous, Fahim Haque Neloy, Samina Ievy, Md. Abdus Sobur, AMM Taufiquer Rahman, Mst. Minara Khatun, and et al. 2022. "Virulence Determinants and Methicillin Resistance in Biofilm-Forming Staphylococcus aureus from Various Food Sources in Bangladesh" Antibiotics 11, no. 11: 1666. https://doi.org/10.3390/antibiotics11111666

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop