Occurrence of Antimicrobial-Resistant Enterococcus spp. in Healthy Chickens Never Exposed to Antimicrobial Agents in Central Italy
Abstract
1. Introduction
2. Results
2.1. Enterococcus spp. Isolation and Typing
2.2. Antimicrobial Susceptibility Tests
2.3. Genotypic Resistance
2.4. Resistance Patterns
3. Discussion
4. Materials and Methods
4.1. Ethical Statement
4.2. Sampling
4.3. Enterococcus spp. Isolation
4.4. Antimicrobial Susceptibility Tests
4.5. Genotypic Resistance
4.6. Statistical Analyses
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Cheng, W.N.; Han, S.G. Bovine mastitis: Risk factors, therapeutic strategies, and alternative treatments—A review. Asian Australas. J. Anim. Sci. 2020, 33, 1699–1713. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wood, M.W.; Lepold, A.; Tesfamichael, D.; Lasarev, M.R. Risk factors for enterococcal bacteriuria in dogs: A retrospective study. J. Vet. Intern. Med. 2020, 34, 2447–2453. [Google Scholar] [CrossRef] [Scilit]
- Robbins, K.M.; Suyemoto, M.M.; Lyman, R.L.; Martin, M.P.; Barnes, H.J.; Borst, L.B. An outbreak and source investigation of enterococcal spondylitis in broilers caused by Enterococcus cecorum. Avian Dis. 2012, 56, 768–773. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Seputiene, V.; Bogdaite, A.; Ruzauskas, M.; Suziedeliene, E. Antibiotic resistance genes and virulence factors in Enterococcus faecium and Enterococcus faecalis from diseased farm animals: Pigs, cattle and poultry. Pol. J. Vet. Sci. 2012, 15, 431–438. [Google Scholar] [PubMed]
- Hollenbeck, B.L.; Rice, L.B. Intrinsic and acquired resistance mechanisms in enterococcus. Virulence 2012, 3, 421–433. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kristich, C.J.; Rice, L.B.; Arias, C.A. Enterococcal Infection–Treatment and Antibiotic Resistance. In Enterococci: From Commensals to Leading Causes of Drug Resistant Infection; Gilmore, M.S., Clewell, D.B., Ike, Y., Shankar, N., Eds.; Eye and Ear Infirmary: Boston, MA, USA, 2014. [Google Scholar]
- García-Solache, M.; Rice, L.B. The Enterococcus: A Model of Adaptability to Its Environment. Clin. Microbiol. Rev. 2019, 32, e00058-18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hegstad, K.; Mikalsen, T.; Coque, T.M.; Werner, G.; Sundsfjord, A. Mobile genetics elements and their contribution to the emergence of antimicrobial resistant Enterococcus faecalis and Enterococcus faecium. Clin. Microbiol. Infect. 2010, 16, 541–554. [Google Scholar] [CrossRef] [PubMed]
- Alzahrani, O.M.; Fayez, M.; Alswat, A.S.; Alkafafy, M.; Mahmoud, S.F.; Al-Marri, T.; Almuslem, A.; Ashfaq, H.; Yusuf, S. Antimicrobial Resistance, Biofilm Formation, and Virulence Genes in Enterococcus Species from Small Backyard Chicken Flocks. Antibiotics 2022, 11, 380. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Staley, C.; Dunny, G.M.; Sadowsky, M.J. Environmental and animal-associated enterococci. Adv. Appl. Microbiol. 2014, 87, 147–186. [Google Scholar] [PubMed]
- Cagnoli, G.; Bertelloni, F.; Interrante, P.; Ceccherelli, R.; Marzoni, M.; Ebani, V.V. Antimicrobial-Resistant Enterococcus spp. in Wild Avifauna from Central Italy. Antibiotics 2022, 11, 852. [Google Scholar] [CrossRef] [Scilit]
- Kilonzo-Nthenge, A.; Brown, A.; Nahashon, S.N.; Long, D. Occurrence and antimicrobial resistance of enterococci isolated from organic and conventional retail chicken. J. Food Prot. 2015, 78, 760–766. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ayeni, F.A.; Odumosu, B.T.; Oluseyi, A.E.; Ruppitsch, W. Identification and prevalence of tetracycline resistance in enterococci isolated from poultry in Ilishan, Ogun State, Nigeria. J. Pharm. Bioallied Sci. 2016, 8, 69–73. [Google Scholar]
- de Jong, A.; Simjee, S.; El Garch, F.; Moyaert, H.; Rose, M.; Youala, M.; Dry, M. Antimicrobial susceptibility of enterococci recovered from healthy cattle, pigs and chickens in nine EU countries (EASSA Study) to critically important antibiotics. Vet. Microbiol. 2018, 216, 168–175. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Makarov, D.A.; Ivanova, O.E.; Pomazkova, A.V.; Egoreva, M.A.; Prasolova, O.V.; Lenev, S.V.; Gergel, M.A.; Bukova, N.K.; Karabanov, S.Y. Antimicrobial resistance of commensal Enterococcus faecalis and Enterococcus faecium from food-producing animals in Russia. Vet. World 2022, 15, 611–621. [Google Scholar] [CrossRef] [Scilit]
- Souillard, R.; Laurentie, J.; Kempf, I.; Le Caër, V.; Le Bouquin, S.; Serror, P.; Allain, V. Increasing incidence of Enterococcus-associated diseases in poultry in France over the past 15 years. Vet. Microbiol. 2022, 269, 109426. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- EFSA AHAW Panel (EFSA Panel on Animal Health and Welfare); Nielsen, S.S.; Bicout, D.J.; Calistri, P.; Canali, E.; Drewe, J.A.; Garin-Bastuji, B.; Gonzales Rojas, J.L.; Gortázar, C.; Herskin, M.; et al. Assessment of listing and categorisation of animal diseases within the framework of the Animal Health Law (Regulation (EU) No 2016/429): Antimicrobial-resistant Enterococcus faecalis in poultry. EFSA J. 2022, 20, e07127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bertelloni, F.; Salvadori, C.; Moni, A.; Cerri, D.; Mani, P.; Ebani, V.V. Antimicrobial resistance in Enterococcus spp. isolated from laying hens of backyard poultry floks. Ann. Agric. Environ. Med. 2015, 22, 665–669. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hayes, J.R.; McIntosh, A.C.; Qaiyumi, S.; Johnson, J.A.; English, L.L.; Carr, L.E.; Wagner, D.D.; Joseph, S.W. High-frequency recovery of quinupristin-dalfopristin-resistant Enterococcus faecium isolates from the poultry production environment. J. Clin. Microbiol. 2001, 39, 2298–2299. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tamai, S.; Suzuki, Y. Diversity of Fecal Indicator Enterococci among Different Hosts: Importance to Water Contamination Source Tracking. Microorganisms 2023, 11, 2981. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aarestrup, F.M.; Agerso, Y.; Gerner-Smidt, P.; Madsen, M.; Jensen, L.B. Comparison of antimicrobial resistance phenotypes and resistance genes in Enterococcus faecalis and Enterococcus faecium from humans in the community, broilers, and pigs in Denmark. Diagn. Microbiol. Infect. Dis. 2000, 37, 127–137. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maasjost, J.; Mühldorfer, K.; Cortez de Jäckel, S.; Hafez, H.M. Antimicrobial Susceptibility Patterns of Enterococcus faecalis and Enterococcus faecium Isolated from Poultry Flocks in Germany. Avian Dis. 2015, 59, 143–148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stępień-Pyśniak, D.; Marek, A.; Banach, T.; Adaszek, Ł.; Pyzik, E.; Wilczyński, J.; Winiarczyk, S. Prevalence and antibiotic resistance of Enterococcus strains isolated from poultry. Acta Vet. Hung. 2016, 64, 148–163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Semedo-Lemsaddek, T.; Bettencourt Cota, J.; Ribeiro, T.; Pimentel, A.; Tavares, L.; Bernando, F.; Oliveira, M. Resistance and virulence distribution in enterococci isolated from broilers reared in two farming systems. Ir. Vet. J. 2021, 74, 22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fertner, M.E.; Olsen, R.H.; Bisgaard, M.; Christensen, H. Transmission and genetic diversity of Enterococcus faecalis among layer chickens during hatch. Acta Vet. 2011, 53, 56. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chai, W.L.; Hamimah, H.; Cheng, S.C.; Sallam, A.A.; Abdullah, M. Susceptibility of Enterococcus faecalis biofilm to antibiotics and calcium hydroxide. J. Oral Sci. 2007, 49, 161–166. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Diarra, M.S.; Rempel, H.; Champagne, J.; Masson, L.; Pritchard, J.; Topp, E. Distribution of antimicrobial resistance and virulence genes in Enterococcus spp. and characterization of isolates from broiler chickens. Appl. Environ. Microbiol. 2010, 76, 8033–8043. [Google Scholar]
- Song, H.; Bae, Y.; Jeon, E.; Kwon, Y.; Joh, S. Multiplex PCR analysis of virulence genes and their influence on antibiotic resistance in Enterococcus spp. isolated from broiler chicken. J. Vet. Sci. 2019, 20, e26. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Solway, S.; Vincent, L.; Tian, N.; Woodford, N.; Bendall, R. Isolation of streptogramin-resistant Enterococcus faecium from human and non-human sources in a rural community. J. Antimicrob. Chemother. 2003, 52, 707–710. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Holmberg, A.; Rasmussen, M. Antibiotic regimens with rifampicin for treatment of Enterococcus faecium in biofilms. Int. J. Antimicrob. Agents 2014, 44, 78–80. [Google Scholar] [CrossRef] [Scilit]
- Chen, W.; Wang, Q.; Wu, H.; Xia, P.; Tian, R.; Li, R.; Xia, L. Molecular epidemiology, phenotypic and genomic characterization of antibiotic-resistant enterococcal isolates from diverse farm animals in Xinjiang, China. Sci. Total Environ. 2024, 912, 168683. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cavaco, L.M.; Bernal, J.F.; Zankari, E.; Léon, M.; Hendriksen, R.S.; Perez-Gutierrez, E.; Aarestrup, F.M.; Donado-Godoy, P. Detection of linezolid resistance due to the optrA gene in Enterococcus faecalis from poultry meat from the American continent (Colombia). J. Antimicrob. Chemother. 2017, 72, 678–683. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yoon, S.; Kim, Y.B.; Seo, K.W.; Ha, J.S.; Noh, E.B.; Lee, Y.J. Characteristics of linezolid-resistant Enterococcus faecalis isolates from broiler breeder farms. Poult. Sci. 2020, 99, 6055–6061. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- World Health Organization (WHO). 19th WHO Model List of Essential Medicines (April 2015). Available online: https://www.iccp-portal.org/system/files/resources/EML2015_8-May-15.pdf (accessed on 18 December 2023).
- Noh, E.B.; Kim, Y.B.; Seo, K.W.; Son, S.H.; Ha, J.S.; Lee, Y.J. Antimicrobial resistance monitoring of commensal Enterococcus faecalis in broiler breeders. Poult. Sci. 2020, 99, 2675–2683. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bae, S.H.; Yoon, S.; Kim, K.; Kim, Y.B.; Lee, Y.J. Comparative Analysis of Chloramphenicol-Resistant Enterococcus faecalis Isolated from Dairy Companies in Korea. Vet. Sci. 2021, 8, 143. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hummel, A.; Holzapfel, W.H.; Franz, C.M. Characterisation and transfer of antibiotic resistance genes from enterococci isolated from food. Syst. Appl. Microbiol. 2007, 30, 1–7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tatsing Foka, F.E.; Ateba, C.N. Detection of Virulence Genes in Multidrug Resistant Enterococci Isolated from Feedlots Dairy and Beef Cattle: Implications for Human Health and Food Safety. Biomed. Res. Int. 2019, 2019, 5921840. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- CDC. Antibiotic Resistance Threats in The United States. 2019. Available online: https://www.cdc.gov/drugresistance/pdf/threats-report/2019-ar-threats-report-508.pdf (accessed on 10 September 2023).
- ECDC; WHO Europe. Antimicrobial Resistance Surveillance in Europe 2022 (2020 Data). 2022. Available online: https://www.ecdc.europa.eu/sites/default/files/documents/ECDC-WHO-AMR-report.pdf (accessed on 10 September 2023).
- Liu, C.; Yoon, E.J.; Kim, D.; Shin, J.H.; Shin, J.H.; Shin, K.S.; Kim, Y.A.; Uh, Y.; Kim, H.S.; Kim, Y.R.; et al. Antimicrobial resistance in South Korea: A report from the Korean global antimicrobial resistance surveillance system (Kor-GLASS) for 2017. J. Infect. Chemother. 2019, 25, 845–859. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Japan Nosocomial Infections Surveillance (JANIS). Annual Open Report 2020 (All Facilities). CLSI 2012 Version. Clinical Laboratory Division 2021. Available online: https://janis.mhlw.go.jp/english/report/open_report/2020/3/1/ken_Open_Report_Eng_202000_clsi2012.pdf (accessed on 18 December 2023).
- Yamaguchi, R.; Yamamoto, T.; Okamoto, K.; Harada, S.; Echizenya, M.; Tsutsumi, T.; Takada, T. Teicoplanin and vancomycin as treatment for glycopeptide-susceptible Enterococcus faecium bacteraemia: A propensity score-adjusted non-inferior comparative study, J. Antimicrob. Chemother. 2023, 78, 1231–1240. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, Y.J.; Kim, K.; Lee, Y.J. Dissemination and characteristics of high-level erythromycin-resistant Enterococcus faecalis from bulk tank milk of dairy companies in Korea. Can. J. Vet. Res. 2023, 87, 51–58. [Google Scholar] [PubMed]
- Sanlibaba, P.; Senturk, E. Prevalence, characterization, and antibiotic resistance of enterococci from traditional cheeses in turkey. Int. J. Food Prop. 2018, 21, 1955–1963. [Google Scholar] [CrossRef] [Scilit]
- Torres, C.; Alonso, C.A.; Ruiz-Ripa, L.; León-Sampedro, R.; Del Campo, R.; Coque, T.M. Antimicrobial Resistance in Enterococcus spp. of animal origin. Microbiol. Spectr. 2018, 6, 185–227. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Poeta, P.; Costa, D.; Rodrigues, J.; Torres, C. Antimicrobial resistance and the mechanisms implicated in faecal enterococci from healthy humans, poultry and pets in Portugal. Int. J. Antimicrob. Agents 2006, 27, 131–137. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ribeiro, J.; Silva, V.; Monteiro, A.; Vieira-Pinto, M.; Igrejas, G.; Reis, F.S.; Barros, L.; Poeta, P. Antibiotic Resistance among Gastrointestinal Bacteria in Broilers: A Review Focused on Enterococcus spp. and Escherichia coli. Animals 2023, 13, 1362. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Furtula, V.; Jackson, C.R.; Farrell, E.G.; Barrett, J.B.; Hiott, L.M.; Chambers, P.A. Antimicrobial resistance in Enterococcus spp. isolated from environmental samples in an area of intensive poultry production. Int. J. Environ. Res. Public Health 2013, 10, 1020–1036. [Google Scholar] [CrossRef] [Scilit]
- Manoil, D.; Cerit, E.E.; Fang, H.; Durual, S.; Brundin, M.; Belibasakis, G.N. Profiling Antibiotic Susceptibility among Distinct Enterococcus faecalis Isolates from Dental Root Canals. Antibiotics 2024, 13, 18. [Google Scholar] [CrossRef] [Scilit]
- Giovanetti, E.; Brenciani, A.; Lupidi, R.; Roberts, M.C.; Varaldo, P.E. Presence of the tet(O) gene in erythromycin- and tetracycline-resistant strains of Streptococcus pyogenes and linkage with either the mef(A) or the erm(A) gene. Antimicrob. Agents Chemother. 2003, 47, 2844–2849. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Doherty, N.; Trzcinski, K.; Pickerill, P.; Zawadzki, P.; Dowson, C.G. Genetic diversity of the tet(M) gene in tetracycline-resistant clonal lineages of Streptococcus pneumoniae. Antimicrob. Agents Chemother. 2000, 44, 2979–2984. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wiśniewski, P.; Zakrzewski, A.; Chajęcka-Wierzchowska, W.; Zadernowska, A. Possibility of transfer and activation of ‘silent’ tetracycline resistance genes among Enterococcus faecalis under high-pressure processing. Food Microbiol. 2024, 120, 104481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ding, J.; Dai, R.; Yang, L.; He, C.; Xu, K.; Liu, S.; Zhao, W.; Xiao, L.; Luo, L.; Zhang, Y.; et al. Inheritance and Establishment of Gut Microbiota in Chickens. Front. Microbiol. 2017, 8, 1967. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- CLSI M02; Performance Standards for Antimicrobial Disk Susceptibility Tests, 13th ed. Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2018.
- CLSI M100; Performance Standards for Antimicrobial Susceptibility Testing, 33rd ed. CLSI Supplement M100; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2023.
- EUCAST (The European Committee on Antimicrobial Susceptibility Testing). Breakpoint Tables for Interpretation of MICs and Zone Diameters, Version 13.0; The European Committee on Antimicrobial Susceptibility Testing: Basel, Switzerland, 2023. [Google Scholar]
- CLSI Standard M07; Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically, 11th ed. CLSI (Clinical and Laboratory Standards Institute): Wayne, PA, USA, 2018.
- Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; et al. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Malhotra-Kumar, S.; Lammens, C.; Piessens, J.; Goossens, H. Multiplex PCR for simultaneous detection of macrolide and tetracycline resistance determinants in streptococci. Antimicrob. Agents Chemother. 2005, 49, 4798–4800. [Google Scholar] [CrossRef] [Scilit]
| Antimicrobials | Susceptible | Intermediate | Resistant | ||||
|---|---|---|---|---|---|---|---|
| Class | Molecules | N. Isolates | % | N. Isolates | % | N. Isolates | % |
| Ansamycin | RD | 26 | 26.53 | 9 | 9.18 | 63 | 64.29 |
| Phenicols | C | 89 | 90.82 | 4 | 4.08 | 5 | 5.10 |
| Oxazolidinones | LZD | 87 | 88.78 | 6 | 6.12 | 5 | 5.10 |
| Nitrofurantoins | F | 93 | 94.90 | 1 | 1.02 | 4 | 4.08 |
| Fluoroquinolones | CIP | 39 | 39.80 | 41 | 41.84 | 18 | 18.37 |
| ENR | 15 | 15.31 | 42 | 42.86 | 41 | 41.84 | |
| Glycopeptides | TEC | 98 | 100 | 0 | 0.00 | 0 | 0.00 |
| VA | 53 | 54.08 | 34 | 34.69 | 11 | 11.22 | |
| Macrolides | E | 52 | 53.06 | 31 | 31.63 | 15 | 15.31 |
| Streptogramins | QD | 10 | 10.20 | 1 | 1.02 | 87 | 88.78 |
| Penicillins | AMC | 96 | 97.96 | 2 | 2.04 | 0 | 0.00 |
| AMP | 91 | 92.86 | 0 | 0.00 | 7 | 7.14 | |
| Tetracyclines | TE | 16 | 16.33 | 37 | 37.76 | 45 | 45.92 |
| TGC | 68 | 69.39 | 0 | 0.00 | 30 | 30.61 | |
| Antimicrobials | Susceptible | Intermediate | Resistant | ||||
|---|---|---|---|---|---|---|---|
| Class | Molecules | N. Strains | % | N. Strains | % | N. Strains | % |
| Ansamycin | RD | 13 | 18.06 | 2 | 2.78 | 57 | 79.17 |
| Phenicols | C | 69 | 95.83 | 1 | 1.39 | 2 | 2.78 |
| Oxazolidinones | LZD | 65 | 90.28 | 3 | 4.17 | 4 | 5.56 |
| Nitrofurantoins | F | 68 | 94.44 | 0 | 0.00 | 4 | 5.56 |
| Fluoroquinolones | CIP | 24 | 33.33 | 36 | 50.00 | 12 | 16.67 |
| ENR | 7 | 9.72 | 32 | 44.44 | 33 | 45.83 | |
| Glycopeptides | TEC | 72 | 100 | 0 | 0.00 | 0 | 0.00 |
| VA | 36 | 50.00 | 26 | 36.11 | 10 | 13.89 | |
| Macrolides | E | 45 | 62.50 | 22 | 30.56 | 5 | 6.94 |
| Streptogramins | QD | 3 | 4.17 | 0 | 0.00 | 69 | 95.83 |
| Penicillins | AMC | 70 | 97.22 | 2 | 2.78 | 0 | 0.00 |
| AMP | 67 | 93.06 | 0 | 0.00 | 5 | 6.94 | |
| Tetracyclines | TE | 6 | 8.33 | 31 | 43.06 | 35 | 48.61 |
| TGC | 50 | 69.44 | 0 | 0.00 | 22 | 30.56 | |
| Antimicrobials | Susceptible | Intermediate | Resistant | ||||
|---|---|---|---|---|---|---|---|
| Class | Molecules | N. Strains | % | N. Strains | % | N. Strains | % |
| Ansamycin | RD | 13 | 56.52 | 7 | 30.43 | 3 | 13.04 |
| Phenicols | C | 18 | 78.26 | 2 | 8.70 | 3 | 13.04 |
| Oxazolidinones | LZD | 19 | 82.61 | 3 | 13.04 | 1 | 4.35 |
| Nitrofurantoins | F | 22 | 95.65 | 1 | 4.35 | 0 | 0.00 |
| Fluoroquinolones | CIP | 13 | 56.52 | 5 | 21.74 | 5 | 21.74 |
| ENR | 7 | 30.43 | 9 | 39.13 | 7 | 30.43 | |
| Glycopeptides | TEC | 23 | 100 | 0 | 0.00 | 0 | 0.00 |
| VA | 15 | 65.22 | 7 | 30.43 | 1 | 4.35 | |
| Macrolides | E | 4 | 17.39 | 9 | 39.13 | 10 | 43.48 |
| Streptogramins | QD | 5 | 21.74 | 0 | 0.00 | 18 | 78.26 |
| Penicillins | AMC | 23 | 100 | 0 | 0.00 | 0 | 0.00 |
| AMP | 22 | 95.65 | 0 | 0.00 | 1 | 4.35 | |
| Tetracyclines | TE | 9 | 39.13 | 5 | 21.74 | 9 | 39.13 |
| TGC | 16 | 69.57 | 0 | 0.00 | 7 | 30.43 | |
| Antimicrobials | Susceptible | Intermediate | Resistant | ||||
|---|---|---|---|---|---|---|---|
| Class | Molecules | N. Strains | % | N. Strains | % | N. Strains | % |
| Ansamycin | RD | 0 | 0.00 | 0 | 0.00 | 3 | 100 |
| Phenicols | C | 2 | 66.66 | 1 | 33.33 | 0 | 0.00 |
| Oxazolidinones | LZD | 3 | 100 | 0 | 0.00 | 0 | 0.00 |
| Nitrofurantoins | F | 3 | 100 | 0 | 0.00 | 0 | 0.00 |
| Fluoroquinolones | CIP | 2 | 66.66 | 0 | 0.00 | 1 | 33.33 |
| ENR | 1 | 33.33 | 1 | 33.33 | 1 | 33.33 | |
| Glycopeptides | TEC | 3 | 100 | 0 | 0.00 | 0 | 0.00 |
| VA | 2 | 66.66 | 1 | 33.33 | 0 | 0.00 | |
| Macrolides | E | 3 | 100 | 0 | 0.00 | 0 | 0.00 |
| Streptogramins | QD | 2 | 66.66 | 1 | 33.33 | 0 | 0.00 |
| Penicillins | AMC | 3 | 100 | 0 | 0.00 | 0 | 0.00 |
| AMP | 2 | 66.66 | 0 | 0.00 | 1 | 33.33 | |
| Tetracyclines | TE | 1 | 33.33 | 1 | 33.33 | 1 | 33.33 |
| TGC | 2 | 66.66 | 0 | 0.00 | 1 | 33.33 | |
| Investigated Genes | E. faecium 72 Strains | E. faecalis 23 Strains | E. avium 3 Strains | Total 98 Strains |
|---|---|---|---|---|
| tet(M) | 53 (73.61%) | 9 (39.13%) | 2 (66.67%) | 64 (65.30%) |
| tet(L) | 4 (5.56%) | 6 (26.9%) | 0 (0.00%) | 10 (10.20%) |
| tet(O) | 0 (0.00%) | 2 (8.70%) | 0 (0.00%) | 2 (2.04%) |
| tet(K) | 0 (0.00%) | 0 (0.00%) | 0 (0.00%) | 0 (0.00%) |
| Int-Tn | 8 (11.11%) | 3 (13.04%) | 1 (33.33%) | 12 (12.24%) |
| Number of Isolates | Resistance Patterns | Resistance Genes |
|---|---|---|
| 2 | RD | tet(M) |
| 1 | E-QD | tet(M)-tet(L) |
| 1 | E-QD | tet(M)-Int-Tn |
| 2 | ENR-QD | |
| 2 | QD-TE | tet(M) |
| 1 | RD-ENR | tet(M) |
| 13 | RD-QD | tet(M) |
| 3 | RD-QD | |
| 2 | RD-QD | tet(M)-Int-Tn |
| 3 | RD-ENR-QD | tet(M) |
| 2 | RD-QD-TE | |
| 3 | RD-QD-TE | tet(M)-Int-Tn |
| 4 | RD-QD-TE | tet(M) |
| 2 | RD-QD-TGC | |
| 1 | RD-QD-TGC | tet(M) |
| 1 | CIP-ENR-E-QD-HLSR-HLGR | |
| 1 | CIP-ENR-QD-TGC | |
| 1 | ENR-QD-TE-TGC | tet(M) |
| 1 | LZD-CIP-ENR-QD | |
| 1 | RD-CIP-QD-TE | tet(M) |
| 2 | RD-ENR-QD-TE | tet(M) |
| 1 | RD-ENR-QD-TE | tet(M)-Int-Tn |
| 2 | RD-ENR-QD-TE | |
| 1 | RD-ENR-QD-TGC | tet(M) |
| 1 | RD-QD-TE-TGC | |
| 1 | RD-QD-TE-TGC | tet(M) |
| 1 | C-F-CIP-ENR-QD | |
| 1 | CIP-ENR-QD-TE-TGC | tet(M) |
| 1 | F-ENR-QD-AMP-TE | tet(M)-tet(L) |
| 2 | RD-ENR-QD-TE-TGC | |
| 3 | RD-ENR-QD-TE-TGC | tet(M) |
| 1 | RD-LZD-ENR-QD-TGC | |
| 1 | F-ENR-E-QD-AMP-TE | tet(M)-tet(L) |
| 1 | F-ENR-QD-AMP-TE-TGC | tet(M)-tet(L) |
| 3 | RD-CIP-ENR-QD-TE-TGC | tet(M) |
| 1 | RD-CIP-ENR-QD-AMP-TE-TGC | tet(M) |
| 1 | RD-LZD-CIP-ENR-QD-AMP-TE-TGC | tet(M)-Int-Tn |
| 1 | RD-C-LZD-CIP-ENR-E-QD-TE-TGC | tet(M) |
| Number of Isolates | Resistance Patterns | Resistance Genes |
|---|---|---|
| 4 | ||
| 1 | QD | tet(M)-tet(L) |
| 1 | QD | tet(M) |
| 1 | QD | |
| 1 | E-QD | |
| 1 | ENR-TGC | |
| 1 | QD-TE | tet(M)-Int-Tn |
| 1 | QD-TGC | |
| 1 | C-E-QD | tet(L) |
| 1 | C-E-QD | tet(M)-tet(L) |
| 1 | E-QD-TE-HLSR | tet(M)-tet(L) |
| 1 | E-QD-TE-HLSR | tet(L) |
| 1 | E-QD-TE-HLSR | |
| 1 | E-QD-TGC-HLSR | tet(M)-tet(L) |
| 1 | CIP-ENR-E-QD | |
| 1 | RD-ENR-QD-TE-TGC | tet(M)-Int-Tn |
| 1 | CIP-ENR-E-QD-TE-TGC-HLGR | tet(O) |
| 1 | RD-CIP-ENR-QD-TE-TGC | tet(M)-Int-Tn |
| 1 | C-LZD-CIP-ENR-E-QD-TE-HLGR | tet(O) |
| 1 | RD-CIP-ENR-QD-AMP-TE-TGC | tet(M) |
| Number of Isolates | Resistance Patterns | Resistance Genes |
|---|---|---|
| 1 | RD | |
| 1 | RD | tet(M) |
| 1 | RD-CIP-ENR-AMP-TE-TGC | tet(M)-Int-Tn |
| Target Gene | Sequence (5′-3′) | Annealing T (°C) | Amplicon Size (bp) | Reference |
|---|---|---|---|---|
| tet(M) | F: GTGGACAAAGGTACAACGAG R: CGGTAAAGTTCGTCACAC | 61 | 406 | [60] |
| tet(L) | F: TGGTGGAATGATAGCCCATT R: CAGGAATGACAGCACGCTAA | 61 | 229 | [60] |
| tet(O) | F: AACTTAGGCATTCTGGCTCAC R: TCCCACTGTTCCATATCGTCA | 61 | 515 | [60] |
| tet(K) | F: GATCAATTGTAGCTTTAGGTGAAGG R: TTTTGTTGATTTACCAGGTACCATT | 61 | 155 | [60] |
| Int-Tn | F: GCGTGATTGTATCTCACT R: GACGCTCCTGTTGCTTCT | 50 | 1028 | [52] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cagnoli, G.; Di Paolo, A.; Bertelloni, F.; Salvucci, S.; Buccioni, A.; Marzoni Fecia di Cossato, M.; Ebani, V.V. Occurrence of Antimicrobial-Resistant Enterococcus spp. in Healthy Chickens Never Exposed to Antimicrobial Agents in Central Italy. Antibiotics 2024, 13, 417. https://doi.org/10.3390/antibiotics13050417
Cagnoli G, Di Paolo A, Bertelloni F, Salvucci S, Buccioni A, Marzoni Fecia di Cossato M, Ebani VV. Occurrence of Antimicrobial-Resistant Enterococcus spp. in Healthy Chickens Never Exposed to Antimicrobial Agents in Central Italy. Antibiotics. 2024; 13(5):417. https://doi.org/10.3390/antibiotics13050417
Chicago/Turabian StyleCagnoli, Giulia, Alessia Di Paolo, Fabrizio Bertelloni, Sonia Salvucci, Arianna Buccioni, Margherita Marzoni Fecia di Cossato, and Valentina Virginia Ebani. 2024. "Occurrence of Antimicrobial-Resistant Enterococcus spp. in Healthy Chickens Never Exposed to Antimicrobial Agents in Central Italy" Antibiotics 13, no. 5: 417. https://doi.org/10.3390/antibiotics13050417
APA StyleCagnoli, G., Di Paolo, A., Bertelloni, F., Salvucci, S., Buccioni, A., Marzoni Fecia di Cossato, M., & Ebani, V. V. (2024). Occurrence of Antimicrobial-Resistant Enterococcus spp. in Healthy Chickens Never Exposed to Antimicrobial Agents in Central Italy. Antibiotics, 13(5), 417. https://doi.org/10.3390/antibiotics13050417

