Resveratrol Alleviates Zearalenone-Induced Intestinal Dysfunction in Mice through the NF-κB/Nrf2/HO-1 Signalling Pathway
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Transmission Electron Microscopy (TEM)
2.3. Periodic Acid-Schiff (PAS) Staining
2.4. Hematoxylin and Eosin (H&E) Staining and Immunostaining
2.5. Biochemical Assay
2.6. Quantitative Rt-PCR
2.7. Western Blot Analysis
2.8. Data Analysis
3. Results
3.1. RSV Prevents Intestinal Morphological Changes Caused by ZEA in Mice
3.2. RSV Alleviates the Upregulation of Intestinal Permeability Induced by ZEA
3.3. RSV Alleviates Intestinal Chemical Barrier Impairment in ZEA-Treated Mice
3.4. RSV Increases the Expression of the TJ Protein in the Intestine of Mice Treated with ZEA
3.5. RSV Regulates ZEA-Triggered Inflammatory Cytokine Secretion in Mice
3.6. RSV Relieves ZEA-Induced Intestinal Damage through the NF-κB Signalling Pathway
3.7. RSV Reduces the Oxidative Stress Caused by ZEA through the Nrf2 Pathway
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
References
- Awuchi, C.G.; Ondari, E.N.; Ogbonna, C.U.; Upadhyay, A.K.; Baran, K.; Okpala, C.; Korzeniowska, M.; Guine, R. Mycotoxins Affecting Animals, Foods, Humans, and Plants: Types, Occurrence, Toxicities, Action Mechanisms, Prevention, and Detoxification Strategies—A Revisit. Foods 2021, 10, 1279. [Google Scholar] [CrossRef] [Scilit]
- Zinedine, A.; Soriano, J.M.; Molto, J.C.; Manes, J. Review on the toxicity, occurrence, metabolism, detoxification, regulations and intake of zearalenone: An oestrogenic mycotoxin. Food Chem. Toxicol. 2007, 45, 1–18. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Chen, S.; Yu, Z.; Yao, J.; Jia, Y.; Liao, C.; Chen, J.; Wei, Y.; Guo, R.; He, L.; et al. A Novel Bacillus Velezensis for Efficient Degradation of Zearalenone. Foods 2024, 13, 530. [Google Scholar] [CrossRef] [Scilit]
- Lee, H.J.; Ryu, D. Worldwide Occurrence of Mycotoxins in Cereals and Cereal-Derived Food Products: Public Health Perspectives of Their Co-occurrence. J. Agric. Food Chem. 2017, 65, 7034–7051. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Benzoni, E.; Minervini, F.; Giannoccaro, A.; Fornelli, F.; Vigo, D.; Visconti, A. Influence of in vitro exposure to mycotoxin zearalenone and its derivatives on swine sperm quality. Reprod. Toxicol. 2008, 25, 461–467. [Google Scholar] [CrossRef] [Scilit]
- Yang, L.J.; Zhou, M.; Huang, L.B.; Yang, W.R.; Yang, Z.B.; Jiang, S.Z.; Ge, J.S. Zearalenone-Promoted Follicle Growth through Modulation of Wnt-1/beta-Catenin Signaling Pathway and Expression of Estrogen Receptor Genes in Ovaries of Postweaning Piglets. J. Agric. Food Chem. 2018, 66, 7899–7906. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, K.; Tan, X.; Li, Y.; Liang, G.; Ning, Z.; Ma, Y.; Li, Y. Transcriptional profiling analysis of Zearalenone-induced inhibition proliferation on mouse thymic epithelial cell line 1. Ecotoxicol. Environ. Saf. 2018, 153, 135–141. [Google Scholar] [CrossRef] [Scilit]
- Zhang, W.; Zhang, S.; Wang, J.; Shan, A.; Xu, L. Changes in intestinal barrier functions and gut microbiota in rats exposed to zearalenone. Ecotoxicol. Environ. Saf. 2020, 204, 111072. [Google Scholar] [CrossRef] [Scilit]
- Singh, R.; Chandrashekharappa, S.; Bodduluri, S.R.; Baby, B.V.; Hegde, B.; Kotla, N.G.; Hiwale, A.A.; Saiyed, T.; Patel, P.; Vijay-Kumar, M.; et al. Enhancement of the gut barrier integrity by a microbial metabolite through the Nrf2 pathway. Nat. Commun. 2019, 10, 89. [Google Scholar] [CrossRef] [Scilit]
- Wen, Z.; Liu, W.; Li, X.; Chen, W.; Liu, Z.; Wen, J.; Liu, Z. A Protective Role of the NRF2-Keap1 Pathway in Maintaining Intestinal Barrier Function. Oxidative Med. Cell. Longev. 2019, 2019, 1759149. [Google Scholar] [CrossRef] [Scilit]
- Zhang, S.; Xu, W.; Wang, H.; Cao, M.; Li, M.; Zhao, J.; Hu, Y.; Wang, Y.; Li, S.; Xie, Y.; et al. Inhibition of CREB-mediated ZO-1 and activation of NF-κB-induced IL-6 by colonic epithelial MCT4 destroys intestinal barrier function. Cell Prolif. 2019, 52, e12673. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gilbert, S.; Zhang, R.; Denson, L.; Moriggl, R.; Steinbrecher, K.; Shroyer, N.; Lin, J.; Han, X. Enterocyte STAT5 promotes mucosal wound healing via suppression of myosin light chain kinase-mediated loss of barrier function and inflammation. EMBO Mol. Med. 2012, 4, 109–124. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rathinam, V.; Chan, F.K. Inflammasome, Inflammation, and Tissue Homeostasis. Trends Mol. Med. 2018, 24, 304–318. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jakobsson, H.E.; Rodriguez-Pineiro, A.M.; Schutte, A.; Ermund, A.; Boysen, P.; Bemark, M.; Sommer, F.; Backhed, F.; Hansson, G.C.; Johansson, M.E. The composition of the gut microbiota shapes the colon mucus barrier. EMBO Rep. 2015, 16, 164–177. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Johansson, M.E.; Sjovall, H.; Hansson, G.C. The gastrointestinal mucus system in health and disease. Nat. Rev. Gastroenterol. Hepatol. 2013, 10, 352–361. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ren, B.; Kwah, M.X.; Liu, C.; Ma, Z.; Shanmugam, M.K.; Ding, L.; Xiang, X.; Ho, P.C.; Wang, L.; Ong, P.S.; et al. Resveratrol for cancer therapy: Challenges and future perspectives. Cancer Lett. 2021, 515, 63–72. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Singh, A.P.; Singh, R.; Verma, S.S.; Rai, V.; Kaschula, C.H.; Maiti, P.; Gupta, S.C. Health benefits of resveratrol: Evidence from clinical studies. Med. Res. Rev. 2019, 39, 1851–1891. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lai, X.; Pei, Q.; Song, X.; Zhou, X.; Yin, Z.; Jia, R.; Zou, Y.; Li, L.; Yue, G.; Liang, X.; et al. The enhancement of immune function and activation of NF-κB by resveratrol-treatment in immunosuppressive mice. Int. Immunopharmacol. 2016, 33, 42–47. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Svajger, U.; Jeras, M. Anti-inflammatory effects of resveratrol and its potential use in therapy of immune-mediated diseases. Int. Rev. Immunol. 2012, 31, 202–222. [Google Scholar] [CrossRef] [Scilit]
- Mayangsari, Y.; Suzuki, T. Resveratrol Ameliorates Intestinal Barrier Defects and Inflammation in Colitic Mice and Intestinal Cells. J. Agric. Food Chem. 2018, 66, 12666–12674. [Google Scholar] [CrossRef] [Scilit]
- Zhuang, Y.; Wu, H.; Wang, X.; He, J.; He, S.; Yin, Y. Resveratrol Attenuates Oxidative Stress-Induced Intestinal Barrier Injury through PI3K/Akt-Mediated Nrf2 Signaling Pathway. Oxidative Med. Cell. Longev. 2019, 2019, 7591840. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, H.; Wang, Y.; Liu, M.; Liu, X.; Jiao, Y.; Jin, S.; Shan, A.; Feng, X. Effects of Dietary Resveratrol Supplementation on Growth Performance and Anti-Inflammatory Ability in Ducks (Anas platyrhynchos) through the Nrf2/HO-1 and TLR4/NF- κB Signaling Pathways. Animals 2021, 11, 3588. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Videmann, B.; Koraichi, F.; Mazallon, M.; Lecoeur, S. Effect of gender, pregnancy and exposure conditions on metabolism and distribution of zearalenone in rats. World Mycotoxin J. 2012, 5, 57–69. [Google Scholar] [CrossRef] [Scilit]
- Ropejko, K.; Twaruzek, M. Zearalenone and Its Metabolites-General Overview, Occurrence, and Toxicity. Toxins 2021, 13, 35. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, Y.; Meng, L.; Liu, H.; Wang, J.; Zheng, N. The Compromised Intestinal Barrier Induced by Mycotoxins. Toxins 2020, 12, 619. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Berman, A.Y.; Motechin, R.A.; Wiesenfeld, M.Y.; Holz, M.K. The therapeutic potential of resveratrol: A review of clinical trials. npj Precis. Oncol. 2017, 1, 35. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xun, W.; Fu, Q.; Shi, L.; Cao, T.; Jiang, H.; Ma, Z. Resveratrol protects intestinal integrity, alleviates intestinal inflammation and oxidative stress by modulating AhR/Nrf2 pathways in weaned piglets challenged with diquat. Int. Immunopharmacol. 2021, 99, 107989. [Google Scholar] [CrossRef] [Scilit]
- Wu, L.; Chen, Q.; Dong, B.; Han, D.; Zhu, X.; Liu, H.; Yang, Y.; Xie, S.; Jin, J. Resveratrol attenuated oxidative stress and inflammatory and mitochondrial dysfunction induced by acute ammonia exposure in gibel carp (Carassius gibelio). Ecotoxicol. Environ. Saf. 2023, 251, 114544. [Google Scholar] [CrossRef] [Scilit]
- Graziani, C.; Talocco, C.; De Sire, R.; Petito, V.; Lopetuso, L.R.; Gervasoni, J.; Persichilli, S.; Franceschi, F.; Ojetti, V.; Gasbarrini, A.; et al. Intestinal permeability in physiological and pathological conditions: Major determinants and assessment modalities. Eur. Rev. Med. Pharmacol. Sci. 2019, 23, 795–810. [Google Scholar]
- Ji, J.; Gu, Z.; Li, H.; Su, L.; Liu, Z. Cryptdin-2 predicts intestinal injury during heatstroke in mice. Int. J. Mol. Med. 2018, 41, 137–146. [Google Scholar] [CrossRef] [Scilit]
- Obremski, K.; Zielonka, L.; Gajecka, M.; Jakimiuk, E.; Bakula, T.; Baranowski, M.; Gajecki, M. Histological estimation of the small intestine wall after administration of feed containing deoxynivalenol, T-2 toxin and zearalenone in the pig. Pol. J. Vet. Sci. 2008, 11, 339–345. [Google Scholar] [PubMed]
- Yang, S.; Yu, M. Role of Goblet Cells in Intestinal Barrier and Mucosal Immunity. J. Inflamm. Res. 2021, 14, 3171–3183. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rodriguez-Pineiro, A.M.; Bergstrom, J.H.; Ermund, A.; Gustafsson, J.K.; Schutte, A.; Johansson, M.E.; Hansson, G.C. Studies of mucus in mouse stomach, small intestine, and colon. II. Gastrointestinal mucus proteome reveals Muc2 and Muc5ac accompanied by a set of core proteins. Am. J. Physiol.-Gastrointest. Liver Physiol. 2013, 305, G348–G356. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tao, S.; Luo, Y.; Bin, H.; Liu, J.; Qian, X.; Ni, Y.; Zhao, R. Paraoxonase 2 modulates a proapoptotic function in LS174T cells in response to quorum sensing molecule N-(3-oxododecanoyl)-L-homoserine lactone. Sci. Rep. 2016, 6, 28778. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Awad, W.A.; Hess, C.; Hess, M. Enteric Pathogens and Their Toxin-Induced Disruption of the Intestinal Barrier through Alteration of Tight Junctions in Chickens. Toxins 2017, 9, 60. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Paradis, T.; Begue, H.; Basmaciyan, L.; Dalle, F.; Bon, F. Tight Junctions as a Key for Pathogens Invasion in Intestinal Epithelial Cells. Int. J. Mol. Sci. 2021, 22, 2506. [Google Scholar] [CrossRef] [Scilit]
- Llewellyn, S.R.; Britton, G.J.; Contijoch, E.J.; Vennaro, O.H.; Mortha, A.; Colombel, J.F.; Grinspan, A.; Clemente, J.C.; Merad, M.; Faith, J.J. Interactions Between Diet and the Intestinal Microbiota Alter Intestinal Permeability and Colitis Severity in Mice. Gastroenterology 2018, 154, 1037–1046. [Google Scholar] [CrossRef] [Scilit]
- Oz, H.S.; Chen, T.S.; Nagasawa, H. Comparative efficacies of 2 cysteine prodrugs and a glutathione delivery agent in a colitis model. Transl. Res. 2007, 150, 122–129. [Google Scholar] [CrossRef] [Scilit]
- Liu, M.; Gao, R.; Meng, Q.; Zhang, Y.; Bi, C.; Shan, A. Toxic effects of maternal zearalenone exposure on intestinal oxidative stress, barrier function, immunological and morphological changes in rats. PLoS ONE 2014, 9, e106412. [Google Scholar] [CrossRef] [Scilit]
- Hu, Q.; Ren, J.; Li, G.; Wu, J.; Wu, X.; Wang, G.; Gu, G.; Ren, H.; Hong, Z.; Li, J. The mitochondrially targeted antioxidant MitoQ protects the intestinal barrier by ameliorating mitochondrial DNA damage via the Nrf2/ARE signaling pathway. Cell Death Dis. 2018, 9, 403. [Google Scholar] [CrossRef] [Scilit]
- Kourakis, S.; Timpani, C.A.; de Haan, J.B.; Gueven, N.; Fischer, D.; Rybalka, E. Targeting Nrf2 for the treatment of Duchenne Muscular Dystrophy. Redox Biol. 2021, 38, 101803. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wei, X.; Zhang, L.; Zhang, R.; Koci, M.; Si, D.; Ahmad, B.; Cheng, J.; Wang, J.; Aihemaiti, M.; Zhang, M. A Novel Cecropin-LL37 Hybrid Peptide Protects Mice Against EHEC Infection-Mediated Changes in Gut Microbiota, Intestinal Inflammation, and Impairment of Mucosal Barrier Functions. Front. Immunol. 2020, 11, 1361. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhan, C.Y.; Chen, D.; Luo, J.L.; Shi, Y.H.; Zhang, Y.P. Protective role of down-regulated microRNA-31 on intestinal barrier dysfunction through inhibition of NF-κB/HIF-1alpha pathway by binding to HMOX1 in rats with sepsis. Mol. Med. 2018, 24, 55. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wong, E.T.; Tergaonkar, V. Roles of NF-κB in health and disease: Mechanisms and therapeutic potential. Clin. Sci. 2009, 116, 451–465. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| Gene Name | Primer Sequences (5′ to 3′) | Product Length (bp) |
|---|---|---|
| GAPDH | TGAACGGGAAGCTCACTGG | 307 |
| TCCACCACCCTGTTGCTGTA | ||
| MUC-2 | AGGGCTCGGAACTCCAGAAA | 106 |
| CCAGGGAATCGGTAGACATCG | ||
| NQO1 | CATTGCAGTGGTTTGGGGTG | 111 |
| TCTGGAAAGGACCGTTGTCG | ||
| γ-GCS | TGGATGATGCCAACGAGTC | 185 |
| CCTAGTGAGCAGTACCACGAATA | ||
| GSH-PX | GAAGTGCGAAGTGAATGG | 224 |
| TGTCGATGGTACGAAAGC | ||
| Occludin | GCAATGACATGTATGGCGGA | 162 |
| GGCGACGTCCATTTGTAGAAG | ||
| Claudin-1 | TGGGGCTGATCGCAATCTTT | 158 |
| CCCAATGACAGCCATCCACA | ||
| ZO-1 | GCATTATTCGCCTTCATACA | 230 |
| GCTCCATACCAACCATCAT | ||
| IL-1β | TGCCACCTTTTGACAGTGATG | 118 |
| TGTGCTGCTGCGAGATTTGA | ||
| IL-6 | TGATGGATGCTACCAAACTGG | 97 |
| GTGACTCCAGCTTATCTCTTGG | ||
| TNF-α | TTCTCATTCCTGCTTGTGGCA | 179 |
| CTCCACTTGGTGGTTTGTGAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xia, S.; Yan, C.; Gu, J.; Yuan, Y.; Zou, H.; Liu, Z.; Bian, J. Resveratrol Alleviates Zearalenone-Induced Intestinal Dysfunction in Mice through the NF-κB/Nrf2/HO-1 Signalling Pathway. Foods 2024, 13, 1217. https://doi.org/10.3390/foods13081217
Xia S, Yan C, Gu J, Yuan Y, Zou H, Liu Z, Bian J. Resveratrol Alleviates Zearalenone-Induced Intestinal Dysfunction in Mice through the NF-κB/Nrf2/HO-1 Signalling Pathway. Foods. 2024; 13(8):1217. https://doi.org/10.3390/foods13081217
Chicago/Turabian StyleXia, Sugan, Chaoyue Yan, Jianhong Gu, Yan Yuan, Hui Zou, Zongping Liu, and Jianchun Bian. 2024. "Resveratrol Alleviates Zearalenone-Induced Intestinal Dysfunction in Mice through the NF-κB/Nrf2/HO-1 Signalling Pathway" Foods 13, no. 8: 1217. https://doi.org/10.3390/foods13081217
APA StyleXia, S., Yan, C., Gu, J., Yuan, Y., Zou, H., Liu, Z., & Bian, J. (2024). Resveratrol Alleviates Zearalenone-Induced Intestinal Dysfunction in Mice through the NF-κB/Nrf2/HO-1 Signalling Pathway. Foods, 13(8), 1217. https://doi.org/10.3390/foods13081217

