Next Article in Journal
Production Performances and Profitability of Stocking Homestead Ponds with Advanced Carp Fingerlings for Maximizing Family Nutrition and Income Generation
Next Article in Special Issue
Detection of Macrobrachium rosenbergii Nodavirus (MrNV) of White Tail Disease (WTD) in Apparently Healthy Giant Freshwater Prawn, Macrobrachium rosenbergii in Korea
Previous Article in Journal
Genetic Diversity and Population Structure of the Giant Mottled Eel, Anguilla marmorata Quoy & Gaimard, 1824 in Central Vietnam
Previous Article in Special Issue
Cloning of Grass Carp Chemokine XC Receptor 1 (XCR1) Gene and Evaluation of Its Expression in Various Organs after GCRV Infection
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 7
Issue 5
10.3390/fishes7050287
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Antibacterial Activity of Bacillus Strains against Acute Hepatopancreatic Necrosis Disease-Causing Vibrio campbellii in Pacific White Leg Shrimp

by
Hye Jin Jeon
1,†,
Jae Won Song
2,†,
Chorong Lee
1,
Bumkeun Kim
1,
Seon Young Park
3,
Ji Hyung Kim
4,*,
Jee Eun Han
1,* and
Jae Hak Park
2,*
1
College of Veterinary Medicine, Kyungpook’ National University, Daegu 41566, Korea
2
Department of Laboratory Animal Medicine, College of Veterinary Medicine and Research Institute for Veterinary Science, Seoul National University, Seoul 08826, Korea
3
Division of Animal and Dairy Sciences, College of Agriculture and Life Science, Chungnam National University, Daejeon 34134, Korea
4
Department of Food Science and Biotechnology, Gachon University, Seongnam 13120, Korea
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Fishes 2022, 7(5), 287; https://doi.org/10.3390/fishes7050287
Submission received: 17 August 2022 / Revised: 11 October 2022 / Accepted: 14 October 2022 / Published: 15 October 2022
(This article belongs to the Special Issue Diseases in Fish and Shellfish)
Browse Figures
Versions Notes

Abstract

:
Acute hepatopancreatic necrosis disease (AHPND) is a bacterial disease caused by Vibrio parahaemolyticus. Currently, various Vibrio strains, including V. campbellii, V. owensii, and V. harveyi, have been reported as causative pathogens. Thus, controlling AHPND to maintain high production in shrimp aquaculture is difficult. We evaluated the antimicrobial activity of five Bacillus strains (B1, B3, B5, B7, and B8)—isolated from seawater in Jeju, South Korea—against 12 Vibrio strains (10 AHPND strains and 2 non-AHPND strains). All tested Bacillus strains inhibited the growth of at least one of the tested Vibrio strains in the dot-spot method. Among them, B1 and B3, the most effective Bacillus strains against the Vibrio strains, particularly against AHPND-causing V. campbellii (VcAHPND), were further used in a challenge test. After 48–60 h of VcAHPND immersion, a significantly higher survival rate was observed in the B1-treated group (100%) than in the non-Bacillus-treated group (64.3%). Based on the qPCR analysis of AHPND, the cycle threshold values were 31.63 ± 0.2 (B1-treated group) and 38.04 ± 0.58 (B3-treated group), versus 28.70 ± 0.42 in the control group. Genome sequencing and phylogenetic analysis revealed that B1 and B3 were classified as B. velezensis. The 16S rRNA sequences and complete genome sequences of B1 and B3 were deposited in GenBank.

1. Introduction

Acute hepatopancreatic necrosis disease (AHPND) is a bacterial disease caused by Vibrio spp. carrying toxin genes (pirA and pirB) located in a large plasmid (69 kb). AHPND affects the digestive tract of shrimp and the tubular cells of the hepatopancreas, disturbing digestion and resulting in mass mortality. V. parahaemolyticus is primarily associated with AHPND (VpAHPND), but other Vibrio species that carry binary toxin genes, including V. campbellii (VcAHPND), V. owensii (VoAHPND), and V. harveyi (VhAHPND), have been reported recently [1,2,3,4]. AHPND was first reported in China (2009), and it spread to several countries, including Vietnam (2010), Malaysia (2011), Thailand (2012), Mexico (2013), the Philippines (2015), the USA (2019), and South Korea (2020) [1,5,6,7,8,9,10]. This disease is known to cause tremendous economic losses in the shrimp aquaculture industry. Shrimp production has considerably decreased following the outbreak of AHPND, and the economic damage is estimated to exceed 1 billion dollars per year in Asia [11].
Although antibiotics have been extensively used to treat bacterial diseases in aquaculture for decades [12], their utilization particularly in the form of overuse or misuse has resulted in antibiotic resistance [13,14,15,16,17,18]. As antibiotic alternatives, probiotics have been frequently used in aquaculture to control bacterial diseases, especially against pathogenic Vibrio infections and AHPND. In a previous report, shrimp treated with Bacillus probiotics in the form of dietary supplements showed a higher survival rate following challenge with VpAHPND [19,20]. In addition to their antimicrobial activity, probiotics have various advantages in aquaculture such as promoting growth, strengthening immunity, and restoring water quality [21,22]. Meanwhile, spore-forming Bacillus spp. are resistant to heat and pressure and are widely used as feed additives [23].
Besides the use of probiotics, various methods have been utilized in shrimp aquaculture such as immunostimulant therapy, quorum sensing control of bacterial virulence, phage therapy, and herbal medicine [18,24,25,26]. Paopradit et al. [27] reported the reduced virulence and decreased mortality of VpAHPND following treatment with quorum sensing inhibitors such as indole or indole-containing compounds. In addition, previous studies [28,29] have confirmed the control of both growth and infection of VpAHPND using bacteriophages in double-layer agar culture and a series of bioassays, respectively.
Although V. parahaemolyticus is the cause of most cases of AHPND, other Vibrio spp., such as V. campbellii, V. harveyi, and V. owensii, are also known to cause this disease in fields, thereby resulting in substantial economic losses on farms. However, preventative methods and studies on AHPND have mainly focused on VpAHPND, and the antimicrobial activity against VcAHPND, VhAHPND, and VoAHPND has been poorly studied [25,30]. In this study, we isolated five Bacillus strains and evaluated their antimicrobial activity against ten AHPND-causing Vibrio strains and two non-AHPND Vibrio strains using a dot-spot test (in vitro). In addition, a challenge test against VcAHPND was performed using two Bacillus strains (B1 and B3) that strongly inhibited VcAHPND among five Bacillus strains in the dot-spot test. The findings revealed that B1 and B3 treatment groups significantly suppressed VcAHPND growth compared with the effect of the non-Bacillus treatment group. Finally, the genomic sequences of these two Bacillus strains were completely analyzed, and both strains were classified as B. velezensis. Their 16S rRNA sequences and complete genome sequences were deposited in GenBank. The results of this study provide useful and practical strategies that can be applied in the shrimp culture industry, which is currently experiencing declines in shrimp production because of harmful shrimp diseases, including AHPND caused by VpAHPND, and VcAHPND.

2. Materials and Methods

2.1. Bacillus and Vibrio Candidate Isolation and Polymerase Chain Reaction (PCR)

For the isolation of Bacillus spp., seawater samples were collected from six different sites in Jeju Island, South Korea. These seawater samples were subjected to a serial dilution process, and dilutions were spread onto tryptic soy agar (TSA; Difco, Becton Dickinson, Franklin Lakes, NJ, USA) plates supplemented with 2% NaCl (TSA+). The plates were incubated at 28 °C for 24–48 h. Subsequently, we picked the bacterial colonies displaying sporulated shapes on the agar plates based on morphology, and the colonies were sub-cultured for pure culture isolation. Isolates were preserved in tryptic soy broth (TSB; Difco, Becton Dickinson, Franklin Lakes, NJ, USA) supplemented with 2% NaCl (TSB+) containing 25% glycerol at −80 °C until further analysis. Each isolate was grown in TSB+ (28 °C, 200 rpm, 24–48 h) and DNA was extracted using the protocol of the modified DNeasy® Blood & Tissue Kit (Qiagen, Germany). For Bacillus identification, PCR was performed using the extracted DNA, and the BacF/R primers, as described by Solichova et al. [31] (Table 1).
For the isolation of Vibrio spp., seawater and hepatopancreas samples were collected from Mexico, Vietnam, Thailand, South Korea, and the USA. These samples were serially diluted and spread on thiosulfate citrate bile salts sucrose (TCBS) (MB Cell, South Korea) agar plates, which were incubated at 28 °C for 24–48 h. Next, we picked green and yellow colonies from the TCBS plates, and the colonies were sub-cultured for pure culture isolation. Isolates were preserved in TSB+ containing 25% glycerol at −80 °C until further analysis. Each isolate was grown in TSB+ (28 °C, 200 rpm, 24–48 h) and used for DNA extraction using the boiling method described by Dashti et al. [32]. For Vibrio identification, PCR was conducted using the extracted DNA and the primer sets (Tox R-F/R, Vc.fts.z-F/R, and Vh.topA-F/R) described by Kim et al. [33] and Cano-Gomez et al. [34] (Table 1). To identify AHPND virulence genes, PCR targeting AHPND toxin genes (pirA and pirB) was conducted using the method described by Han et al. [35] (Table 1).
Table
Table 1. Primers for Bacillus, AHPND toxin genes (pirA and pirB), and Vibrio species.
Table 1. Primers for Bacillus, AHPND toxin genes (pirA and pirB), and Vibrio species.
TargetPrimersSequence (5′–3′)Amplicon Size (bp)Reference
BacillusBacFGCTGGTTAGAGCGCACGCCTGATA263[31]
BacRCATCCACCGTGCGCCCTTTCTAAC
AHPND toxinVpPirA-284FTGACTATTCTCACGATTGGACTG284[35]
VpPirA-284RCACGACTAGCGCCATTGTTA
VpPirA-392FTGATGAAGTGATGGGTGCTC392
VpPirA-392RTGTAAGCGCCGTTTAACTCA
V. parahaemolyticusTox R-FGTCTTCTGACGCAATCGTTG368[33]
Tox R-RATACGAGTGGTTGCTGTCATG
V. campbelliiVc.fts.z-FAAGACAGAGATAGACTTAAAGAT294[34]
Vc.fts.z-RCTTCTAGCAGCGTTACAC
V. harveyiVh.topA-FTGGCGCAGCGTCTATACG121
Vh.topA-RTATTTGTCACCGAACTCAGAACC

2.2. Antimicrobial Activity Test (In Vitro)

For antimicrobial activity testing, the Bacillus strains that were obtained were further tested for their ability to inhibit the growth of Vibrio strains using the dot-spot method described by Spelhaug and Harlander [36]. Vibrio strains were grown in TSB+ with shaking at 200 rpm and 28 °C for 24 h, and bacterial suspensions of each strain were normalized with 2.5% NaCl to obtain a final concentration of approximately 5 × 106 colony forming units (CFU) mL−1. Bacillus strains were grown in TSB+ with shaking at 200 rpm and 28 °C for 24–48 h to obtain a final concentration of approximately 5 × 108 CFU mL−1. Then, 100 μL of each Vibrio strain suspension was inoculated into 5 mL of soft agar and poured onto TSA+ plates. Ten-microliter aliquots of Bacillus strain suspensions were dot-spotted on the surface of Vibrio-overlaid agar. The plates were incubated at 28 °C for 12–24 h, and the clear zones around each Bacillus colony were recorded.
B. velezensis CR-502T (=NRRL B-41580T) was obtained from the Korean Collection for Type Cultures (KCTC) and set as the reference strain in this experiment. The experiments were also conducted using the same methods.

2.3. Antimicrobial Activity Test (Challenge Test)

Bacillus strains that showed the strongest inhibitory effects in the dot-spot test were further subjected to the challenge test. As experimental shrimp, the Pacific white leg shrimp (Penaeus vannamei) at the post-larval stage (stages PL15–PL16) were purchased from a local shrimp farm (Jeju Province, South Korea) and transported to the Laboratory of Aquatic Biomedicine, College of Veterinary Medicine, Kyungpook National University in South Korea. Shrimp were fed a commercial diet twice daily in a 700 L acrylic tank for 35 days to be acclimated to the experimental conditions and facilities. Then, the shrimp (average weight of 0.2 ± 0.05 g) were randomly distributed into 22 L acrylic tanks with 18 L of aerated artificial seawater. For the antimicrobial activity test (challenge test), experimental shrimp (N = 56) were divided into four groups with duplicates.
In group 1, the experimental shrimp (N = 14) were exposed to a suspension of Bacillus (B1) for 14 days via immersion at a concentration of 1.0 × 106 CFU mL−1 water. Then, the shrimp were challenged with a VcAHPND (16-904/1) suspension via immersion at a concentration of 2.0 × 106 CFU mL−1 water. In group 2, the experimental shrimp (N = 14) were exposed to Bacillus (B3) suspension for 14 days via immersion at a concentration of 1.0 × 106 CFU mL−1 water. Then, the shrimp were challenged with a VcAHPND (16-904/1) suspension via immersion at a concentration of 2.0 × 106 CFU mL−1 water. In group 3, the experimental shrimp (N = 14) were exposed to the same amount of fresh broth (TSB+) without Bacillus strains (B1 and B3) for 14 days via immersion. Then, they were challenged with a VcAHPND (16-904/1) suspension via immersion at a concentration of 2.0 × 106 CFU mL−1 water. In group 4, the experimental shrimp (N = 14) were exposed to the same amount of fresh broth (TSB+) without Bacillus for 14 days, and then they were not challenged VcAHPND (16-904/1). The experiment was started at the same time and under the same conditions for all groups. The tanks were filled with aerated artificial seawater and maintained without water change for 28 days. The water temperature, dissolved oxygen level, pH, and salinity were maintained at 25–28 °C, 6.39–7.21 ppm, 6.48–7.10, and 23–25 ppt, respectively. Shrimp were fed shrimp feed three times a day at 5% of their body weight and monitored for 28 days.
To confirm the presence of AHPND, dead shrimp were collected and tested using the PCR method previously described by Han et al. [35]. To quantify AHPND, surviving shrimp were randomly sampled on the day of termination (day 14). The hepatopancreas of each shrimp was collected aseptically; next, 30 mg of the hepatopancreas tissue was used for DNA extraction using the DNeasy® Blood & Tissue Kit. Using the extracted DNA, quantitative PCR was performed to quantify the AHPND toxin gene pirA in the hepatopancreas in the groups using the method described by Han et al. [37].

2.4. Genome Sequencing and Phylogenetic Analysis of the Selected Bacillus Strains

The genomes of two selected Bacillus strains (B1 and B3) were sequenced using a hybrid approach on a PacBio RS II system (Pacific Biosciences Inc., Menlo Park, CA, USA) by constructing a 20 kb SMRTbellTM template library and on the HiSeq X-10 platform (Illumina Inc., San Diego, CA, USA) by preparing a DNA library using the TruSeq Nano DNA Library Prep Kit (Illumina). Genome assembly of the filtered PacBio reads was performed using the HGAP (v3.0) pipeline, the 150-bp Illumina paired-end reads were mapped using BWA-MEM (v0.7.15), and errors were corrected using Pilon (v1.21) using the default parameters. Annotation was performed using the NCBI Prokaryotic Genome Annotation Pipeline (http://www.ncbi.nlm.nih.gov/books/NBK174280/ (accessed on August 2022) [38]. The regions and clusters of secondary metabolites present in the genomes of both strains were predicted using antibiotics & Secondary Metabolite Analysis Shell (anti-SMASH) v.6.1.1 [39]. The phylogenetic trees of the two Bacillus strains based on the 16S ribosomal RNA (rRNA) genes and whole-genome sequences were constructed using selected 20-type species of the genus Bacillus. First, the 16S rRNA sequences of the two isolates were aligned with 20 representative species of the genus Bacillus using Clustal X (ver. 2.0) [40] and BioEdit (ver. 7.0) [41], and the maximum-likelihood phylogenetic tree based on the concatenated sequences was generated using MEGA X [42] with 1000 bootstrap replicates. Second, the whole genome-based phylogenetic tree was generated using the Type (Strain) Genome Server and inferred with FastME 2.1.6.1 [43] from Genome BLAST Distance phylogeny approach (GBDP) distances calculated using genome sequences. The branch lengths were scaled in terms of GBDP distance formula D5, and the numbers above the branches were GBDP pseudo-bootstrap support values >60% from 100 replications. The regions and clusters of secondary metabolites present in the genomes of both the B1 and B3 strains and B. velezensis CR-502T (=NRRL B-41580T) were predicted using antibiotics & Secondary Metabolite Analysis Shell (anti-SMASH) v.6.1.1 [42] and compared.

2.5. Accession Numbers of Nucleotide Sequences and Strain Deposition

The 16S rRNA sequences of Bacillus B1 and B3 were deposited in GenBank under the accession numbers OP364972 and OP364977, respectively. The complete genome sequences of B1 and B3 were deposited in GenBank under the accession numbers CP100040 and CP100041, respectively.

2.6. Statistical Analysis

Survival data in the challenge test were analyzed via one-way analysis of variance (ANOVA) using SPSS version 24.0 (SPSS Inc., Chicago, IL, USA). The mean differences were compared using Duncan’s multiple range test when a significant difference was identified using ANOVA. For the comparison of means, the significance level was set at p ˂ 0.05. Data are presented as the mean ± SD, and the percentage data were arcsine-transformed before the comparisons.

3. Results

3.1. Identification of Bacillus and Vibrio Strains

In total, five Bacillus strains were obtained from seawater samples collected from Jeju Island, South Korea. Using PCR with primers specific for the genus Bacillus, all five strains (B1, B3, B5, B7, and B8) were confirmed to be Bacillus spp., as presented in Table 2 and Figure S1.
Twelve Vibrio strains were obtained from seawater and hepatopancreas tissue samples from shrimp. Using PCR with primers specific for V. parahaemolyticus, V. campbellii, and V. harveyi, one strain was identified as V. campbellii (16-904/1), 10 strains were identified as V. parahaemolyticus (13-028/A3, 15-250/20, CH49, CH50, CH51, CH52, CH53, 19-021D1, 19-022A1, and NSU116), and one strain was identified as V. harveyi (LB4). Using PCR targeting the AHPND toxin genes, ten strains (16-904/1, 15-250/20, 13-028/A3, CH49, CH50, CH51, CH52, CH53, 19-021D1, and 19-022A1) were identified as AHPND strains, and two strains (NSU116 and LB4) were identified as non-AHPND strains, as presented in Table 2 and Figure S1.

3.2. Antimicrobial Activity Test (In Vitro)

Using the dot-spot method, five Bacillus strains (B1, B3, B5, B7, and B8) were demonstrated to inhibit the growth of at least one of the tested Vibrio strains in shrimp, including VcAHPND (16-904/1), VpAHPND (13-028/A3, 15-250/20, CH49, CH50, CH51, CH52, CH53, 19-021D1, and 19-022A1), non-AHPND V. parahaemolyticus (NSU116), and non-AHPND V. harveyi (LB4), as evidenced by a clear zone around the Bacillus colonies (Table 3 and Table S1). In particular, B1 and B3 exhibited stronger inhibitory effects on VcAHPND than the other Bacillus strains (type strain, B5, B7, and B8), as presented in Table 3 and Table S2.

3.3. Antimicrobial Activity Test (Challenge Test)

Based on the dot-spot test result, we selected the B1 and B3 strains with a strong inhibitory effect against VcAHPND, and their antimicrobial activities against VcAHPND were evaluated using a challenge test. Rapid mortality was observed between 48 and 60 h. After 60 h of VcAHPND immersion, a significantly higher survival rate was observed in the B1 treatment group (group 1, 100%) than in the non-Bacillus treatment group (group 3, 64.3%) (Table 4). At the end of the challenge test, shrimp in group 1 (VcAHPND immersion after B1 treatment) and in group 2 (VcAHPND immersion after B3 treatment) had numerically higher cumulative survival rates than in group 3 (VcAHPND immersion without B1 and B3 treatment) (Figure 1 and Table 4). During the challenge test, 16 shrimp were dead (5 in group 1, 5 in group 2, and 6 in group 3), and 11 shrimp (3 in group 1, 2 in group 2, and 6 in group 3) were further examined for PCR (Figure S2).
The cycle threshold (Ct) values of the pirA toxin gene in the hepatopancreas tissue of shrimp were 31.63 ± 0.20 in group 1, 38.04 ± 0.58 in group 2, and 28.70 ± 0.42 in group 3. The pirA toxin gene was not detected in any tested samples in group 4.

3.4. Genome Sequencing and Phylogenetic Analysis of the Selected Bacillus Strains

Two Bacillus strains (B1 and B3) were selected and further analyzed for genomic investigations. The genomes of B1 and B3 consisted of circular double-stranded DNA having a length of 3,929,791 bp and 3,929,788 bp, respectively, with 46.50% G+C content, and both genomes encoded 3750 protein-coding genes, 86 transfer RNAs, and 27 rRNAs (Table 5). Direct comparison of the 16S rRNA sequences of the B1 and B3 strains against the GenBank database revealed that the two Bacillus isolates were most similar to B. siamensis KCTC 13613T (NR_117274.1; 99.1% and 99.1%) and B. velezensis CR-502T (AY603658.1; 99.6% and 99.7%). However, the resultant phylogeny did not clearly differentiate the two strains at the species level (Figure 2a). Therefore, we conducted a whole genome-based phylogenetic analysis to confirm the exact taxonomical position of the strains, and the resultant phylogeny revealed that the two isolates were clustered together with B. velezensis NRRL B-41580T (LLZC00000000.1) (Figure 2b). Based on these results, B1 and B3 were finally classified as B. velezensis, one of the recently classified species in the operational group B. amyloliquefaciens [44].
During the in silico search for biosynthetic gene clusters (BCGs) for the production of potential antibiotics and/or secondary metabolites, four types of BCGs, including non-ribosomal peptide, ribosomally synthesized and post-translationally modified peptide, polyketide, and lipopeptide gene clusters, were detected in B1 and B3 genomes. A more thorough analysis revealed that these BCGs were detected in seven of 12 predicted regions of the two genomes, and a total of 54 substances related to secondary metabolites were detected. When limited to the cutoff similarity value of 80% for substances that have been identified till date, fourteens substances in total, namely bacillibactin, amylocyclicin, paenibactin, difficidin, fengycin, plipastatin, bacillomycin D, mycosubtilin, iturin, paenilarvins, bacillaene, macrolactin (H, B, 1c, and E), surfactin, and bacilysin, were identified from the B1 and B3 strains (Table 6 and Table 7). Although a comparison of the substances detected in the type strains of B. velezensis used in this study with the B1 and B3 genomes (cutoff > 80%) indicated that they were mostly similar, differences in the three substances (mersacidin, plipastatin, and surfactin) were found (Table S3). First, mersacidin which was detected in the genome of B. velezensis NRRL B-41580T was not identified in the genomes of the B1 and B3 isolates. Second, plipastatin and surfactin were only detected in the two Bacillus isolates obtained in this study. Additional detailed information on the other five predicted regions of the Bacillus isolates B1 and B3 is presented in Table S4.

4. Discussion

In this study, we evaluated the antimicrobial activity of five Bacillus isolates against 12 shrimp Vibrio strains (10 AHPND Vibrio strains [9 V. parahaemolyticus and 1 V. campbellii] and 2 non-AHPND Vibrio strains [1 V. parahaemolyticus and 1 V. harveyi]). Bacillus spp. are usually isolated from soil, fermented soybean paste (cheonggukjang), plants, and pond water, and are incubated at 30–37 °C [45,46,47]. The Bacillus strains described in this study were isolated from seawater and were found to grow well at 28–37 °C. Additionally, all Bacillus strains exhibited growth in both TSA and TSA+ (supplemented with 2% NaCl), indicating that these strains could be applied to water with wide ranges of salinity.
In the dot-spot test, B1, B3, B5, B7, and B8 exerted inhibitory effects on at least one of tested Vibrio strain. In addition, these strains showed inhibitory effects against isolates from both South Korea and several other countries (Mexico, Vietnam, Latin America, Thailand, and the USA). This indicates that the Bacillus strains used in this study can be used globally in various shrimp-farming countries to control AHPND. Management of AHPND, a disease which results in extensive mortality in shrimp, could increase shrimp production and decrease economic losses in shrimp farming.
In the challenge test, the B1 treatment group (100%) exhibited a significantly higher survival rate than the non-Bacillus treatment group (64.3%) at 60 h. In a previous study by Han et al. [48], VcAHPND was highly pathogenic to shrimp, similar to VpAHPND, and the accumulative mortality in shrimp was as high as 100% within 2 days of VcAHPND laboratory infection. In this study, two Bacillus strains (B1 and B3) displayed prominent antimicrobial effects within 2–3 days (48–60 h) of VcAHPND infection compared with the findings in the positive control group (VcAHPND immersion without B1 and B3 treatment); thus, both strains are expected to emerge as alternatives to antibiotics for controlling VcAHPND. Moreover, among the live shrimp collected on the day of experiment termination, the Ct value was higher in samples of the Bacillus-treated groups than in the positive control group. Therefore, these results suggested that the two Bacillus strains identified in this study exhibited antimicrobial activity against pathogenic VcAHPND. Additionally, the histopathology of the hepatopancreas was examined after exposure to Bacillus spp. for 14 days in our preliminary study. The structure of the hepatopancreas was found to be similar between the Bacillus treatment groups and the control group (not exposed to VcAHPND and Bacillus), indicating that Bacillus strains are harmless to shrimp.
The two strains (B1 and B3), which showed antimicrobial activity using the dot-spot test (in vitro) and challenge test, were finally classified as B. velezensis based on their whole genome-based phylogeny. Several studies have examined the probiotic effects of B. velezensis in various organisms. For example, Chauyod et al. [49] demonstrated that B. velezensis significantly inhibited the growth of Vibrio spp. isolated from shrimp, including VpAHPND, using the disk diffusion test. Li et al. [50] reported that the expression of immune-related genes such as IL-8 and IgM was upregulated in the hybrid grouper fed a feed supplemented with B. velezensis (1 × 107 CFU g−1) compared with the findings in the control group, and the former also exhibited increased resistance to V. harveyi. Other studies described the antibacterial activity of B. velezensis against V. parahaemolyticus isolated from shrimp [51] and V. anguillarum isolated from seabass [52]. Although the predicted secondary metabolites derived from the B1 and B3 Bacillus strains were relatively similar to those previously reported from related Bacillus species [39], plipastatin and surfactin were only found in the two isolates, and they were not detected during our in silico analysis of the type strain of B. velezensis. These results suggest that the newly isolated B1 and B3 strains will have additional advantageous characteristics in terms of their potential use in the aquaculture industry. Till date, most previously reported secondary metabolites produced by Bacillus spp. were known to have surfactant and antibiotic activity [53]. In particular, the potential presence of surfactin, which was previously reportedly associated with antibacterial activity against multidrug-resistant Vibrio spp. [54] in the two Bacillus strains might explain their antimicrobial activity against pathogenic VcAHPND in this study; however, further studies are warranted regarding the predicted presence of surfactin in the isolates because of its relatively low similarity with previously reported compounds. Moreover, the potential presence of iturin and fengycin, which have been associated with the antifungal activity of some Bacillus strains [55], may contribute to the potential usability of the Bacillus strains identified in this study.

5. Conclusions

In summary, two Bacillus strains isolated from seawater in Korea were shown to have antimicrobial activity against Vibrio strains in shrimp using dot-spot and challenge test, and secondary metabolites derived from the B1 and B3 strains were more various than those previously reported for Bacillus spp., indicating that both strains can be used as potential candidates for the management of vibriosis and AHPND, including VcAHPND, in shrimp aquaculture.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/fishes7050287/s1, Figure S1: (a) PCR analysis for Bacillus identification (263 bp). Lane M: 100-bp ladder, Lane N: Negative control (DDH2O), Lane 1: B1, Lane 2: B3, Lane 3: B5, Lane 4: B7, and Lane 5: B8. (b) PCR analysis for Vibrio spp. identification (V. parahaemolyticus: 349 bp, V. campbellii: 294 bp, V. harveyi: 121 bp). Lane M: 100-bp ladder, Lane N: Negative control (DDH2O), Lane 1: 13-028/A3, Lane 2: 15-250/20, Lane 3: CH49, Lane 4: CH50, Lane 5: CH51, Lane 6: CH52, Lane 7: CH53, Lane 8: 19-021D1, Lane 9: 19-022A1, Lane 10: NSU116, Lane 11: 16-904/1, and Lane 12: LB4; Figure S2: PCR analysis was performed to identify AHPND toxin genes (pirA: 284 bp, pirB: 392 bp) in dead shrimp; Table S1: Clear zone diameter (mm) illustrating the antibacterial activity of Bacillus strains used in this study against 12 Vibrio strains; Table S2: Clear zone images of Bacillus strains (type strain, B1 and B3) against the representative Vibrio strains (16-904/1, 19-021D1, and 19-022A1); Table S3: The predicted secondary metabolite gene clusters in Bacillus velezensis NRRL B-41580T using anti-SMASH; Table S4: The additional secondary metabolite gene clusters in Bacillus isolates B1 and B3 using anti-SMASH.

Author Contributions

Writing—original draft preparation, H.J.J. and J.W.S.; formal analysis, C.L.; B.K. and S.Y.P. writing—review and editing and supervision, J.H.K.; J.E.H. and J.H.P. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (NRF2019R1C1C1006212, NRF2021R1I1A1A01040303 and NRF-2022R1I1A3066435). This research was also supported by Development of technology for biomaterialization of marine fisheries by-products of Korea institute of Marine Science & Technology Promotion (KIMST) funded by the Ministry of Oceans and Fisheries (KIMST-20220128).

Institutional Review Board Statement

The animal study protocol was approved by the Ethics Committee of Kyungpook National University (KNU 2020-0052 and 23 April 2020).

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Tran, L.; Nunan, L.; Redman, R.M.; Mohney, L.L.; Pantoja, C.R.; Fitzsimmons, K.; Lightner, D.V. Determination of the infectious nature of the agent of acute hepatopancreatic necrosis syndrome affecting penaeid shrimp. Dis. Aquat. Org. 2013, 105, 45–55. [Google Scholar] [CrossRef] [PubMed]
  2. Kondo, H.; Van, P.T.; Dang, L.T.; Hirono, I. Draft genome sequence of non-Vibrio parahaemolyticus acute hepatopancreatic necrosis disease strain KC13. 17.5, isolated from diseased shrimp in Vietnam. Genome Announc. 2015, 3, e00978-15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  3. Dong, X.; Wang, H.; Zou, P.; Chen, J.; Liu, Z.; Wang, X.; Huang, J. Complete genome sequence of Vibrio campbellii strain 20130629003S01 isolated from shrimp with acute hepatopancreatic necrosis disease. Gut Pathog. 2017, 9, 31. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  4. Liu, F.; Li, S.; Yu, Y.; Yuan, J.; Yu, K.; Li, F. Pathogenicity of a Vibrio owensii strain isolated from Fenneropenaeus chinensis carrying pirAB genes and causing AHPND. Aquaculture 2021, 530, 735747. [Google Scholar] [CrossRef]
  5. Kua, B.C.; Iar, A.; Siti Zahrah, A.; Irene, J.; Norazila, J.; Nik Haiha, N.Y.; Fadzilah, Y.; Mohammed, M.; Siti Rokhaiya, B.; Omar, M.; et al. Current status of acute hepatopancreatic necrosis disease (AHPND) of farmed shrimp in Malaysia. In Proceedings of the Addressing Acute Hepatopancreatic Necrosis Disease (AHPND) and Other Transboundary Diseases for Improved Aquatic Animal Health in Southeast Asia, Makati City, Philippines, 22–24 February 2016; pp. 55–59. [Google Scholar]
  6. Joshi, J.; Srisala, J.; Truong, V.H.; Chen, I.T.; Nuangsaeng, B.; Suthienkul, O.; Lo, C.F.; Flegel, T.W.; Sritunyalucksana, K.; Thitamadee, S. Variation in Vibrio parahaemolyticus isolates from a single Thai shrimp farm experiencing an outbreak of acute hepatopancreatic necrosis disease (AHPND). Aquaculture 2014, 428, 297–302. [Google Scholar] [CrossRef]
  7. Nunan, L.; Lightner, D.; Pantoja, C.; Gomez-Jimenez, S. Detection of acute hepatopancreatic necrosis disease (AHPND) in Mexico. Dis. Aquat. Org. 2014, 111, 81–86. [Google Scholar] [CrossRef] [Green Version]
  8. Leobert, D.; Cabillon, N.A.R.; Catedral, D.D.; Amar, E.C.; Usero, R.C.; Monotilla, W.D.; Calpe, A.T.; Fernandez, D.D.G.; Saloma, C.P. Acute hepatopancreatic necrosis disease (AHPND) outbreaks in Penaeus vannamei and P. monodon cultured in the Philippines. Dis. Aquat. Org. 2015, 116, 251–254. [Google Scholar]
  9. Dhar, A.K.; Piamsomboon, P.; Caro, L.F.A.; Kanrar, S.; Adami, R., Jr.; Juan, Y.S. First report of acute hepatopancreatic necrosis disease (AHPND) occurring in the USA. Dis. Aquat. Org. 2019, 132, 241–247. [Google Scholar] [CrossRef]
  10. Han, J.E.; Choi, S.K.; Han, S.H.; Lee, S.C.; Jeon, H.J.; Lee, C.; Kim, K.Y.; Lee, Y.S.; Park, S.C.; Rhee, G.; et al. Genomic and histopathological characteristics of Vibrio parahaemolyticus isolated from an acute hepatopancreatic necrosis disease outbreak in Pacific white shrimp (Penaeus vannamei) cultured in Korea. Aquaculture 2020, 524, 735284. [Google Scholar] [CrossRef]
  11. Lee, C.T.; Chen, I.T.; Yang, Y.T.; Ko, T.P.; Huang, Y.T.; Huang, J.Y.; Huang, M.F.; Lin, S.J.; Chen, C.Y.; Lin, S.S.; et al. The opportunistic marine pathogen Vibrio parahaemolyticus becomes virulent by acquiring a plasmid that expresses a deadly toxin. Proc. Natl. Acad. Sci. USA 2015, 112, 10798–10803. [Google Scholar] [CrossRef] [Green Version]
  12. Dawood, M.A.; Koshio, S.; Esteban, M.Á. Beneficial roles of feed additives as immunostimulants in aquaculture: A review. Rev. Aquac. 2018, 10, 950–974. [Google Scholar] [CrossRef]
  13. Rekiel, A.; Wiecek, J.; Bielecki, W.; Gajewska, J.; Cichowicz, M.; Kulisiewicz, J.; Batorska, M.; Roszkowski, T.; Beyga, K. Effect of addition of feed antibiotic flavomycin or prebiotic BIO-MOS on production results of fatteners, blood biochemical parameters, morphometric indices of intestine and composition of microflora. Archi. Tierz. Dummerstorf 2007, 50, 172–180. [Google Scholar]
  14. Defoirdt, T.; Sorgeloos, P.; Bossier, P. Alternatives to antibiotics for the control of bacterial disease in aquaculture. COMICR 2011, 14, 251–258. [Google Scholar] [CrossRef]
  15. Capita, R.; Alonso-Calleja, C. Antibiotic-resistant bacteria: A challenge for the food industry. Crit. Rev. Food Sci. Nutr. 2013, 53, 11–48. [Google Scholar] [CrossRef]
  16. Hai, N.V. The use of probiotics in aquaculture. J. Appl. Microbiol. 2015, 119, 917–935. [Google Scholar] [CrossRef]
  17. Lulijwa, R.; Rupia, E.J.; Alfaro, A.C. Antibiotic use in aquaculture, policies and regulation, health and environmental risks: A review of the top 15 major producers. Rev. Aquac. 2020, 12, 640–663. [Google Scholar] [CrossRef]
  18. Zhu, F. A review on the application of herbal medicines in the disease control of aquatic animals. Aquaculture 2020, 526, 735422. [Google Scholar] [CrossRef]
  19. Vogeley, J.L.; Interaminense, J.A.; Buarque, D.S.; da Silva, S.M.B.C.; Coimbra, M.R.M.; Peixoto, S.M.; Soares, R.B. Growth and immune gene expression of Litopenaeus vannamei fed Bacillus subtilis and Bacillus circulans supplemented diets and challenged with Vibrio parahaemolyticus. Aquac. Int 2019, 27, 1451–1464. [Google Scholar] [CrossRef]
  20. Amoah, K.; Dong, X.H.; Tan, B.P.; Zhang, S.; Chi, S.Y.; Yang, Q.H.; Liu, H.; Yang, Y.; Zhang, H.T. Administration of probiotic Bacillus licheniformis induces growth, immune and antioxidant enzyme activities, gut microbiota assembly and resistance to Vibrio parahaemolyticus in Litopenaeus vannamei. Aquac. Nutr. 2020, 26, 1604–1622. [Google Scholar] [CrossRef]
  21. Chauhan, A.; Singh, R. Probiotics in aquaculture: A promising emerging alternative approach. Symbiosis 2019, 77, 99–113. [Google Scholar] [CrossRef]
  22. Khademzade, O.; Zakeri, M.; Haghi, M.; Mousavi, S.M. The effects of water additive Bacillus cereus and Pediococcus acidilactici on water quality, growth performances, economic benefits, immunohematology, and bacterial flora of whiteleg shrimp (Penaeus vannamei Boone, 1931) reared in earthen ponds. Aquac. Res. 2020, 51, 1759–1770. [Google Scholar] [CrossRef]
  23. Nithya, V.; Halami, P.M. Evaluation of the probiotic characteristics of Bacillus species isolated from different food sources. Ann. Microbiol. 2013, 63, 129–137. [Google Scholar] [CrossRef]
  24. Flegel, T.W.; Lightner, D.V.; Lo, C.F.; Owens, L. Shrimp Disease Control: Past, Present, and Future; Bondad-Reantaso, M.G., Mohan, C.V., Crumlish, M., Subasinghe, R.P., Eds.; Diseases in Asian Aquaculture VI. Fish Health Section; Asian Fisheries Society: Manila, Philippines, 2008; Volume 505, pp. 355–378. [Google Scholar]
  25. Kewcharoen, W.; Srisapoome, P. Probiotic effects of Bacillus spp. from Pacific white shrimp (Litopenaeus vannamei) on water quality and shrimp growth, immune responses, and resistance to Vibrio parahaemolyticus (AHPND strains). Fish Shellfish Immunol. 2019, 94, 175–189. [Google Scholar] [CrossRef]
  26. Galaviz-Silva, L.; Cázares-Jaramillo, G.E.; Ibarra-Gámez, J.C.; Molina-Garza, V.M.; Sánchez-Díaz, R.; Molina-Garza, Z.J. Assessment of probiotic bacteria from marine coasts against Vibrio parahaemolyticus (AHPND strains) in Litopenaeus vannamei. Aquac. Res. 2021, 52, 6396–6409. [Google Scholar] [CrossRef]
  27. Paopradit, P.; Aksonkird, T.; Mittraparp-arthorn, P. Indole inhibits quorum sensing-dependent phenotypes and virulence of acute hepatopancreatic necrosis disease-causing Vibrio parahaemolyticus. Aquac. Res. 2022, 53, 3586–3597. [Google Scholar] [CrossRef]
  28. Jun, J.W.; Han, J.E.; Tang, K.F.; Lightner, D.V.; Kim, J.; Seo, S.W.; Park, S.C. Potential application of bacteriophage pVp-1: Agent combating Vibrio parahaemolyticus strains associated with acute hepatopancreatic necrosis disease (AHPND) in shrimp. Aquaculture 2016, 457, 100–103. [Google Scholar] [CrossRef] [Green Version]
  29. Jun, J.W.; Han, J.E.; Giri, S.S.; Tang, K.F.; Zhou, X.; Aranguren, L.F.; Kim, H.J.; Yun, S.; Chi, C.; Kim, S.G.; et al. Phage application for the protection from acute hepatopancreatic necrosis disease (AHPND) in Penaeus vannamei. Indian J. Microbiol. 2018, 58, 114–117. [Google Scholar] [CrossRef]
  30. Nguyen, N.D.; Pande, G.S.J.; Kashem, M.A.; Baruah, K.; Bossier, P. Acute hepatopancreatic necrosis disease (AHPND) toxin degradation by Bacillus subtilis DSM33018. Aquaculture 2021, 540, 736634. [Google Scholar] [CrossRef]
  31. Solichová, K.; Němečková, I.; Šviráková, E.; Horáčková, Š. Novel identification methods including a species-specific PCR for hazardous Bacillus species. Acta Aliment. 2019, 48, 415–422. [Google Scholar] [CrossRef] [Green Version]
  32. Dashti, A.A.; Jadaon, M.M.; Abdulsamad, A.M.; Dashti, H.M. Heat treatment of bacteria: A simple method of DNA extraction for molecular techniques. Kuwait Med. J. 2009, 41, 117–122. [Google Scholar]
  33. Kim, Y.B.; Okuda, J.U.N.; Matsumoto, C.; Takahashi, N.; Hashimoto, S.; Nishibuchi, M. Identification of Vibrio parahaemolyticus strains at the species level by PCR targeted to the toxR gene. J. Clin. Microbiol. 1999, 37, 1173–1177. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  34. Cano-Gomez, A.; Høj, L.; Owens, L.; Baillie, B.K.; Andreakis, N. A multiplex PCR-based protocol for identification and quantification of Vibrio harveyi-related species. Aquaculture 2015, 437, 195–200. [Google Scholar] [CrossRef]
  35. Han, J.E.; Tang, K.F.; Tran, L.H.; Lightner, D.V. Photorhabdus insect-related (Pir) toxin-like genes in a plasmid of Vibrio parahaemolyticus, the causative agent of acute hepatopancreatic necrosis disease (AHPND) of shrimp. Dis. Aquat. Org. 2015, 113, 33–40. [Google Scholar] [CrossRef] [PubMed]
  36. Spelhaug, S.R.; Harlander, S.K. Inhibition of foodborne bacterial pathogens by bacteriocins from Lactococcus lactis and Pediococcus pentosaceous. J. Food Prot. 1989, 52, 856–862. [Google Scholar] [CrossRef]
  37. Han, J.E.; Tang, K.F.; Pantoja, C.R.; White, B.L.; Lightner, D.V. qPCR assay for detecting and quantifying a virulence plasmid in acute hepatopancreatic necrosis disease (AHPND) due to pathogenic Vibrio parahaemolyticus. Aquaculture 2015, 442, 12–15. [Google Scholar] [CrossRef]
  38. Silva, F.D.J.; Ferreira, L.C.; Campos, V.P.; Cruz-Magalhães, V.; Barros, A.F.; Andrade, J.P.; Roberts, D.P.; de Souza, J.T. Complete genome sequence of the biocontrol agent Bacillus velezensis UFLA258 and its comparison with related species: Diversity within the commons. GBE 2019, 11, 2818–2823. [Google Scholar] [CrossRef]
  39. Blin, K.; Shaw, S.; Kloosterman, A.M.; Charlop-Powers, Z.; Van Wezel, G.P.; Medema, M.H.; Weber, T. antiSMASH 6.0: Improving cluster detection and comparison capabilities. Nucleic Acids Res. 2021, 49, W29–W35. [Google Scholar] [CrossRef]
  40. Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef] [Green Version]
  41. Hall, T.; Biosciences, I.; Carlsbad, C. BioEdit: An important software for molecular biology. GERF Bull. Biosci. 2011, 2, 60–61. [Google Scholar]
  42. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Bio. Evol. 2018, 35, 1547. [Google Scholar] [CrossRef]
  43. Lefort, V.; Desper, R.; Gascuel, O.F. 2.0: A comprehensive, accurate, and fast 684 distance-based phylogeny inference program. Mol. Biol. Evol. 2015, 685, 32. [Google Scholar]
  44. Fan, B.; Blom, J.; Klenk, H.P.; Borriss, R. Bacillus amyloliquefaciens, Bacillus velezensis, and Bacillus siamensis form an “operational group B. amyloliquefaciens” within the B. subtilis species complex. Front. Microbiol. 2017, 8, 22. [Google Scholar] [CrossRef] [Green Version]
  45. Amin, M.; Rakhisi, Z.; Ahmady, A.Z. Isolation and identification of Bacillus species from soil and evaluation of their antibacterial properties. AJCMI 2015, 2, 23233. [Google Scholar] [CrossRef]
  46. Jeon, H.L.; Yang, S.J.; Son, S.H.; Kim, W.S.; Lee, N.K.; Paik, H.D. Evaluation of probiotic Bacillus subtilis P229 isolated from cheonggukjang and its application in soybean fermentation. LWT 2018, 97, 94–99. [Google Scholar] [CrossRef]
  47. Mohamed, E.A.; Farag, A.G.; Youssef, S.A. Phosphate solubilization by Bacillus subtilis and Serratia marcescens isolated from tomato plant rhizosphere. J. Environ. Prot. Sci. 2018, 9, 266. [Google Scholar] [CrossRef]
  48. Han, J.E.; Tang, K.F.J.; Aranguren, L.F.; Piamsomboon, P. Characterization and pathogenicity of acute hepatopancreatic necrosis disease natural mutants, pirABvp (−) V. parahaemolyticus, and pirABvp (+) V. campbellii strains. Aquaculture 2017, 470, 84–90. [Google Scholar] [CrossRef]
  49. Chauyod, K.; Rattanavarin, S.; Sarapukdee, P.; Porntheeraphat, S.; Sritunyalucksana, K.; Khemthongcharoen, N. Bacillus velezensis suppression on the growth of Vibrio parahaemolyticus causing acute hepatopancreatic necrosis disease in marine shrimp. J. Appl. Aquac. 2022, 1–15. [Google Scholar] [CrossRef]
  50. Li, J.; Wu, Z.B.; Zhang, Z.; Zha, J.W.; Qu, S.Y.; Qi, X.Z.; Wang, G.X.; Ling, F. Effects of potential probiotic Bacillus velezensis K2 on growth, immunity and resistance to Vibrio harveyi infection of hybrid grouper (Epinephelus lanceolatus♂× E. fuscoguttatus♀). Fish Shellfish. Immunol. 2019, 93, 1047–1055. [Google Scholar] [CrossRef]
  51. Li, X.; Gao, X.; Zhang, S.; Jiang, Z.; Yang, H.; Liu, X.; Jiang, Q.; Zhang, X. Characterization of a Bacillus velezensis with antibacterial activity and inhibitory effect on common aquatic pathogens. Aquaculture 2020, 523, 735165. [Google Scholar] [CrossRef]
  52. Monzón-Atienza, L.; Bravo, J.; Torrecillas, S.; Montero, D.; Canales, A.F.G.D.; de la Banda, I.; Galindo-Villegas, J.; Ramos-Vivas, J.; Acosta, F. Isolation and Characterization of a Bacillus velezensis D-18 Strain, as a Potential Probiotic in European Seabass Aquaculture. Probiotics Antimicrob. Proteins 2021, 13, 1404–1412. [Google Scholar] [CrossRef]
  53. Sumi, C.D.; Yang, B.W.; Yeo, I.C.; Hahm, Y.T. Antimicrobial peptides of the genus Bacillus: A new era for antibiotics. Can. J. Microbiol. 2015, 61, 93–103. [Google Scholar] [CrossRef]
  54. Xu, H.M.; Rong, Y.J.; Zhao, M.X.; Song, B.; Chi, Z.M. Antibacterial activity of the lipopetides produced by Bacillus amyloliquefaciens M1 against multidrug-resistant Vibrio spp. isolated from diseased marine animals. Appl. Microbiol. Biotechnol. 2014, 98, 127–136. [Google Scholar] [CrossRef]
  55. Devi, S.; Kiesewalter, H.T.; Kovács, R.; Frisvad, J.C.; Weber, T.; Larsen, T.O.; Kovacs, A.T.; Ding, L. Depiction of secondary metabolites and antifungal activity of Bacillus velezensis DTU001. Synth. Syst. Biotechnol. 2019, 4, 142–149. [Google Scholar] [CrossRef]
Fishes 07 00287 g001 550
Figure 1. The survival rates (%) of Pacific white leg shrimp challenged with VcAHPND (16-904/1).
Figure 1. The survival rates (%) of Pacific white leg shrimp challenged with VcAHPND (16-904/1).
Fishes 07 00287 g001
Fishes 07 00287 g002a 550Fishes 07 00287 g002b 550
Figure 2. Phylogenetic tree based on the 16S rRNA gene sequences (a) and whole-genome sequences (b) detailing the relationships of Bacillus isolates B1 and B3 with 20 type strains of Bacillus spp. and the outgroup Lactobacillus casei ATCC 393T. The bootstrapping values are indicated at the branches using 1000 and 100 replicates, and only bootstrap values >70 are presented. The scale bar represents 0.02 or 0.05 nucleotide substitutions per site.
Figure 2. Phylogenetic tree based on the 16S rRNA gene sequences (a) and whole-genome sequences (b) detailing the relationships of Bacillus isolates B1 and B3 with 20 type strains of Bacillus spp. and the outgroup Lactobacillus casei ATCC 393T. The bootstrapping values are indicated at the branches using 1000 and 100 replicates, and only bootstrap values >70 are presented. The scale bar represents 0.02 or 0.05 nucleotide substitutions per site.
Fishes 07 00287 g002aFishes 07 00287 g002b
Table
Table 2. Bacillus and Vibrio strains and their identification using PCR.
Table 2. Bacillus and Vibrio strains and their identification using PCR.
StrainOriginSourceIsolation YearPCR IdentificationAccession No a
Bacillus strains
B1South KoreaSeawater2019Bacillus spp.OP364972
B3South KoreaSeawater2019Bacillus spp.OP364977
B5South KoreaSeawater2019Bacillus spp.-
B7South KoreaSeawater2019Bacillus spp.-
B8South KoreaSeawater2019Bacillus spp.-
Vibrio strains
16-904/1MexicoShrimp2016AHPND Vibrio campbellii-
13-028/A3VietnamShrimp2015AHPND V. parahaemolyticusKM067908
15-250/20Latin AmericaShrimp2015AHPND V. parahaemolyticus-
CH49ThailandSeawater2019AHPND V. parahaemolyticus-
CH50ThailandSeawater2019AHPND V. parahaemolyticus-
CH51ThailandSeawater2019AHPND V. parahaemolyticus-
CH52ThailandSeawater2019AHPND V. parahaemolyticus-
CH53ThailandSeawater2019AHPND V. parahaemolyticus-
19-021D1South KoreaSeawater2019AHPND V. parahaemolyticusMN631018, MN631020
19-022A1South KoreaSeawater2019AHPND V. parahaemolyticusMN631019, MN631021
NSU116Latin AmericaShrimp2016Non-AHPND V. parahaemolyticus-
LB4USASeawater2017Non-AHPND V. harveyi-
a: Accession number of 16S rRNA sequences.
Table
Table 3. Inhibitory effects of Bacillus strains against Vibrio strains (dot-spot test).
Table 3. Inhibitory effects of Bacillus strains against Vibrio strains (dot-spot test).
Vibrio StrainsBacillus Strains
Type Strain a (B. velezensis)B1B3B5B7B8
16-904/1+++++−++
13-028/A3++−+−−−
15-250/20+−++−+
CH49+++−−−
CH50+−+−−+
CH51−−+++−−
CH52+−+−−−
CH53−++++++++
19-021D1+++++++++
19-022A1+++++++++
NSU116++++++++
LB4−+++−−
a: CR-502T (= NRRL B-41580T). +: clear zone smaller than 1 mm, ++: clear zone between 1 and 2 mm in size. −: No clear zones were observed.
Table
Table 4. The survival rates (%) of Pacific white leg shrimp at 60 and 336 h after VcAHPND (16-904/1) immersion.
Table 4. The survival rates (%) of Pacific white leg shrimp at 60 and 336 h after VcAHPND (16-904/1) immersion.
Survival (%)Treatments
Group 1Group 2Group 3Group 4
60 h100 ± 0.0 a85.7 ± 20.2 ab64.3 ± 10.1 b100 ± 0.0 a
336 h64.3 ± 10.164.3 ± 30.357.1 ± 0.0100 ± 0.0
Values are presented as mean ± SD of duplicate groups. Values with different superscript letters in the same row are significantly different (p < 0.05). Values without superscript letters are not significantly different.
Table
Table 5. Features of the B1 and B3 genomes.
Table 5. Features of the B1 and B3 genomes.
FeaturesStrains
B1B3
Size (bp)3,929,7913,929,788
G+C content (%)46.5046.50
Contigs11
Chromosomes11
Plasmids00
tRNAs8686
rRNAs2727
Protein-coding genes37503750
GenBank accession numberCP100040CP100041
Table
Table 6. The secondary metabolite gene clusters in the isolate B1 obtained using anti-SMASH.
Table 6. The secondary metabolite gene clusters in the isolate B1 obtained using anti-SMASH.
RegionPositionBiosynthetic Gene ClustersSubstanceSimilarity (%)
FromTo
1127,555178,059NRP 1Bacillibactin100
RiPP:head-to-tail cyclized peptide 2Amylocyclicin100
NRPPaenibactin100
NRP:NRP siderophoreBacillibactin100
2804,233896,592Polyketide + NRPDifficidin100
51,180,1561,314,466NRPFengycin100
NRPPlipastatin100
Polyketide + NRP:lipopeptideBacillomycin D100
Polyketide + NRPMycosubtilin100
Polyketide + NRPIturin88
NRPPaenilarvins100
61,388,2081,488,773Polyketide + NRPBacillaene100
71,707,9611,796,194PolyketideMacrolactin H100
PolyketideMacrolactin H/
macrolactin B/macrolactin 1c/macrolactin E		100
112,792,6162,858,023NRP:lipopeptideSurfactin82
123,479,6183,521,036OtherBacilysin100
OtherBacilysin100
1 NRP, non-ribosomal peptide. 2 RiPP, ribosomally synthesized and post-translationally modified peptide.
Table
Table 7. The secondary metabolite gene clusters in the isolate B3 obtained using anti-SMASH.
Table 7. The secondary metabolite gene clusters in the isolate B3 obtained using anti-SMASH.
RegionPositionBiosynthetic Gene ClustersSubstanceSimilarity (%)
fromto
2117,650251,960NRP 1Fengycin100
NRPPlipastatin100
Polyketide + NRP:lipopeptideBacillomycin D100
Polyketide + NRPMycosubtilin100
Polyketide + NRPIturin88
NRPPaenilarvins100
3325,702426,267Polyketide + NRPBacillaene100
4645,796733,631PolyketideMacrolactin H100
PolyketideMacrolactin H/100
macrolactin B/
macrolactin 1c/
macrolactin E
81,730,3281,794,305NRP:LipopeptideSurfactin82
92,417,1082,458,526OtherBacilysin100
OtherBacilysin100
102,994,8363,046,627NRPBacillibactin100
RiPP:head-to-tail cyclized peptide 2Amylocyclicin100
NRPPaenibactin100
NRP:NRP siderophoreBacillibactin100
113,671,3313,765,123Polyketide + NRPDifficidin100
1 NRP, non-ribosomal peptide. 2 RiPP, ribosomally synthesized and post-translationally modified peptide.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Jeon, H.J.; Song, J.W.; Lee, C.; Kim, B.; Park, S.Y.; Kim, J.H.; Han, J.E.; Park, J.H. Antibacterial Activity of Bacillus Strains against Acute Hepatopancreatic Necrosis Disease-Causing Vibrio campbellii in Pacific White Leg Shrimp. Fishes 2022, 7, 287. https://doi.org/10.3390/fishes7050287

AMA Style

Jeon HJ, Song JW, Lee C, Kim B, Park SY, Kim JH, Han JE, Park JH. Antibacterial Activity of Bacillus Strains against Acute Hepatopancreatic Necrosis Disease-Causing Vibrio campbellii in Pacific White Leg Shrimp. Fishes. 2022; 7(5):287. https://doi.org/10.3390/fishes7050287

Chicago/Turabian Style

Jeon, Hye Jin, Jae Won Song, Chorong Lee, Bumkeun Kim, Seon Young Park, Ji Hyung Kim, Jee Eun Han, and Jae Hak Park. 2022. "Antibacterial Activity of Bacillus Strains against Acute Hepatopancreatic Necrosis Disease-Causing Vibrio campbellii in Pacific White Leg Shrimp" Fishes 7, no. 5: 287. https://doi.org/10.3390/fishes7050287

Article Metrics

Back to TopTop