The Effects and Mechanisms of Periplaneta americana Extract Reversal of Multi-Drug Resistance in BEL-7402/5-FU Cells
Abstract
:1. Introduction
2. Results
2.1. BEL-7402 and BEL-7402/5-FU Cells Have Different Growth Curves
2.2. BEL-7402 and BEL-7402/5-FU Cells Have Different Sensitivity to Some Chemotherapeutic Drugs
2.3. The PACC and PADF Extracts Have Similar Cytotoxicity in BEL-7402/5-FU Cells
2.4. The PACC and PADF Extracts Increase the Intracellular Accumulation of ADM
2.5. The BEL-7402/5-FU Cells Have Higher Expression of Multidrug Resistance-Associated Genes Than Their Drug-sensitive Counterpart Cells
2.6. The PACC and PADF extRacts Inhibit P-gp, MRP, and LRP Protein Expression in BEL-7402/5-FU Cells
2.7. The PACC and PADF Extracts Reduced the Expression of Some Multidrug Resistance-associated Genes and Altered the Expression of Some Multidrug Resistance-associated Enzymes
3. Discussion
4. Materials and Methods
4.1. Cell Lines and Test Drugs
4.2. Chemicals and Reagents
4.3. Cell Culture
4.4. Determination of Growth Curve
4.5. Determination of Sensitivity of Cells to Chemotherapeutic Drugs
4.6. Cytotoxicity of PACC and PADF
4.7. Design of Experimental Group
4.8. Intracellular Accumulation of ADM Assay
4.9. Immunocytochemical Assay
4.10. Real-Time Fluorescence Quantitative PCR Analysis Assay
4.11. Data Analysis Statistics
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Yang, J.D.; Roberts, L.R. Hepatocellular carcinoma: A global view. Nat. Rev. Gastroenterol. Hepatol. 2010, 7, 448–458. [Google Scholar] [CrossRef] [PubMed]
- Jemal, A.; Bray, F.; Center, M.M.; Ferlay, J.; Ward, E.; Forman, D. Global cancer statistics. CA: Cancer. J. Clin. 2011, 61, 69–90. [Google Scholar] [CrossRef] [PubMed]
- Ferenci, P.; Fried, M.; Labrecque, D.; Bruix, J.; Sherman, M.; Omata, M.; Heathcote, J. Hepatocellular carcinoma (HCC): A global perspective. J. Clin. Gastroenterol. 2010, 19, 311–317. [Google Scholar] [CrossRef] [PubMed]
- Torrel, L.A.; Bray, F.; Siegel, R.L.; Ferlay, J.; Lortet-Tieulent, J.; Jemal, A. Global cancer statistics, 2012. CA: Cancer. J. Clin. 2015, 65, 87–108. [Google Scholar]
- Baguley, B.C. Multiple drug resistance mechanisms in cancer. Mol. Biotechnol. 2010, 46, 308–316. [Google Scholar] [CrossRef] [PubMed]
- Pérez-Tomás, R. Multidrug resistance: Retrospect and prospects in anti-cancer drug treatment. Curr. Med. Chem. 2006, 13, 1859–1876. [Google Scholar] [CrossRef] [PubMed]
- Yan, Y.; Björnmalm, M.; Caruso, F. Particle carriers for combating multidrug-resistant cancer. ACS. Nano 2013, 7, 9512–9517. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Zhao, Y.; Guo, Q.; Wang, Z.; Wang, H.; Yang, Y.; Huang, Y. TAT-modified nanosilver for combating multidrug-resistant cancer. Biomaterials 2012, 33, 6155–6161. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.P.; Xu, D.J.; Huang, C.; Xu, W.K.; Luan, J.J. Effects of astragaloside Ⅱ on reversing multidrug resistance in resistant human hepatocellular carcinoma cell line BEL-7402/5-FU. Chin. J. Clin. Pharmacol. Ther. 2014, 19, 139–144. [Google Scholar]
- Ren, J.M.; Ji, H.Y.; Tang, J.L.; Li, M.T.; Cui, C.; Wu, L.H. Research progress of curcumin on anti-tumor and reversing multidrug resistanc. China Pharm. 2013, 16, 1582–1585. [Google Scholar]
- Wang, X.B. Inhibitory Effect Of Ligustrazine On The ABC Family Of Multidrug-resistant Human Hepatocellular Carcinoma Cells; Huazhong University of Science and Technology: Wuhan, China, 2009. [Google Scholar]
- Wang, X.X.; Hr, Z.C.; Song, L.Y.; Spencer, S.; Yang, L.X.; Peng, F.; Liu, G.M.; Hu, M.H.; Li, H.B.; Wu, X.M.; et al. Chemotherapeutic effects of bioassay-guided extracts of the American cockroach, P. americana. Integr. Cancer Ther. 2011, 10. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.Y. Sheng Nong′s Herbal Classic; The Commercial Press: Beijing, China, 1955; p. 90. [Google Scholar]
- Leonard, G.D.; Fojo, T.; Bates, S.E. The role of ABC transporters in clinical practice. Oncologist 2003, 8, 411–424. [Google Scholar] [CrossRef] [PubMed]
- Yasuhisa, K.; Michinori, M.; Kei, T.; Tohru, S.; Noriyuki, K.; Teruo, A.; Kazumitsu, U. ATP hydrolysis-dependent multidrug efflux transporter: MDR1/P-glycoprotein. Curr. Drug Metab. 2004, 5, 1–10. [Google Scholar]
- Takashi, T.; Mikihiko, N.; Akihiro, T.; Naoya, F.; Tetsuo, M.; Hiroshi, S.; Naomi, H. Molecular targeting therapy of cancer: Drug resistance, apoptosis and survival signal. Cancer. Sci. 2003, 94, 15–21. [Google Scholar]
- Jie, H.; You, M.Q.; Liu, H.; Zhang, H.; Wu, M. Progress in study on mechanism of multidrug resistance in tumor and reversal strategy. Chin. Arch. Tradit. Chin. Med. 2013, 31, 1686–1690. [Google Scholar]
- Sun, W.X.; Huang, C.G. Multidrug resistance: Mechanisms and reversal agents. Chem. Life 2012, 32, 395–399. [Google Scholar]
- Liu, J. Research progress on mechanisms and reversal project of mutidrug resistance. Chin. J. Surg. Oncol. 2010, 2, 174–178. [Google Scholar]
- Shukla, S.; Ohnuma, S.; Ambudkar, S.V. Improving cancer chemotherapy with modulators of ABC drug transporters. Curr. Drug Targets 2011, 12, 621–630. [Google Scholar] [CrossRef] [PubMed]
- Pu, X.F.; Luo, Y.J.; Peng, L.; Li, J.; Zeng, J.; Niu, C.L.; Peng, F. Experimental study on anti-HSV-2 effect of CII-3 extracted from P. americana in vitro and in vivo. J. Dali Univ. 2009, 13, 5–9. [Google Scholar]
- Li, H.W.; Geng, L.; Liu, G.M.; Li, D.M. Research on antimicrobial activity by P. americana Cockroach skimmed cream and active carbon material in vitro. Chin. J. Exp. Tradit. Med. Formulae 2012, 18, 159–161. [Google Scholar]
- Situ, Z.Q.; Wu, J.Z. Cell Culture, 2nd ed.; World Book Inc.: Xi’an, China, 2007. [Google Scholar]
- Liu, D.L.; Li, Y.J.; Yao, N.; Xu, J.; Chen, Z.S.; Yiu, A.; Zhang, C.X.; Ye, W.C.; Zhang, D.M. Acerinol, a cyclolanstane triterpenoid from cimicifuga acerina, reverses ABCB1-mediated multidrug resistance in HepG2/ADM and MCF-7/ADR cells. Eur. J. Pharmacol. 2014, 733, 34–44. [Google Scholar] [CrossRef] [PubMed]
- Xu, S.Y.; Bian, R.L.; Chen, X. Experimental Methodology of Pharmacology, 3rd ed.; People’s Medical Publishing House: Beijing, China, 2005; p. 1785. [Google Scholar]
- Tang, K.; Lin, Y.; Li, L.M. The role of phenethyl isothiocyanate on bladder cancer ADM resistance reversal and its molecular mechanism. Anat. Record 2013, 296, 899–906. [Google Scholar] [CrossRef] [PubMed]
- Yan, X.; Ruan, W.W.; Wang, X.M. The effects of multidrug resistance on cell proliferation, apoptosis and invasion activity and the expression of mitogen-activated protein kinase in human hepatocellular cancer cells. Tumor 2012, 32, 507–515. [Google Scholar]
- Sample Availability: Samples of the compounds are available from the authors.
Drugs | IC50 (µg/mL) | RI | |
---|---|---|---|
BEL-7402 | BEL-7402/5-FU | ||
5-FU | 2.787 ± 0.34 | 202.910 ± 1.49 ** | 72.81 |
ADM | 0.529 ± 0.07 | 4.595 ± 0.32 * | 8.69 |
DDP | 7.379 ± 0.40 | 6.066 ± 0.19 | 0.82 |
Drugs | BEL-7402/5-FU | |
---|---|---|
IC5 (µg/mL) | IC10 (µg/mL) | |
PACC | 50.12 ± 3.77 | 84.25 ± 3.20 |
PADF | 23.24 ± 0.74 | 46.03 ± 1.29 |
Primers | Sequence (5′ to 3′) | Base Numbers | Purification Method | |
---|---|---|---|---|
β-actin | Forward | AAGGCTGTGGGCAAGG | 16 | HAP * |
β-actin | Reverse | TGGAGGAGTGGGTGTCG | 17 | HAP |
MDR1 | Forward | GGAGCGGTTCTACGA | 15 | HAP |
MDR1 | Reverse | ACGATGCCCAGGTGT | 15 | HAP |
MRP1 | Forward | GTCGGAACAAGTCGTGCCTG | 20 | HAP |
MRP1 | Reverse | CAAAGCCTCCACCTCCTCA | 19 | HAP |
LRP | Forward | GGCTCCTTCCGCTACGT | 17 | HAP |
LRP | Reverse | GCCGAGACCGCTCAATAC | 18 | HAP |
GST-π | Forward | CTGGAAGGAGGAGGTGGTG | 19 | HAP |
GST-π | Reverse | GACGCAGGATGGTATTGGAC | 20 | HAP |
PKC | Forward | CCCAAACATTGACAAATCCTAACC | 24 | HAP |
PKC | Reverse | CAACCAAGGAGGGTACCAGATG | 22 | HAP |
Topo II β | Forward | GAAACGGAATCCTTGGTCAGAT | 22 | HAP |
Topo II β | Reverse | TTTCGGCTGCTGCTCTCCTA | 20 | HAP |
© 2016 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC-BY) license ( http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yuan, F.; Liu, J.; Qiao, T.; Li, T.; Shen, Q.; Peng, F. The Effects and Mechanisms of Periplaneta americana Extract Reversal of Multi-Drug Resistance in BEL-7402/5-FU Cells. Molecules 2016, 21, 852. https://doi.org/10.3390/molecules21070852
Yuan F, Liu J, Qiao T, Li T, Shen Q, Peng F. The Effects and Mechanisms of Periplaneta americana Extract Reversal of Multi-Drug Resistance in BEL-7402/5-FU Cells. Molecules. 2016; 21(7):852. https://doi.org/10.3390/molecules21070852
Chicago/Turabian StyleYuan, Falu, Junyong Liu, Tingting Qiao, Ting Li, Qi Shen, and Fang Peng. 2016. "The Effects and Mechanisms of Periplaneta americana Extract Reversal of Multi-Drug Resistance in BEL-7402/5-FU Cells" Molecules 21, no. 7: 852. https://doi.org/10.3390/molecules21070852