Anti-Obesity and Anti-Adipogenic Effects of Administration of Arginyl-Fructose-Enriched Jeju Barley (Hordeum vulgare L.) Extract in C57BL/6 Mice and in 3T3-L1 Preadipocytes Models
Abstract
:1. Introduction
2. Results
2.1. BEE Inhibits Adipocyte Differentiation
2.2. BEE Alleviates HFD-Induced Obesity in In Vivo Model
2.3. BEE Administration Decreases the Expression of Adipogenesis/Lipogenesis-Related Genes in Epididymal Fat Biopsy from C57BL/6 Mice
2.4. BEE Administration Decreases the Fat Accumulation in the HFD-Induced C57BL/6 Mice
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Sample Preparation
4.3. Determination of Cell Viability and Morphometric Analysis
4.4. Oil Red O (ORO) Staining
4.5. Quantitative Real-Time PCR
4.6. In Vivo Experimental Design
4.7. Blood Analysis
4.8. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- Pigeyre, M.; Yazdi, F.T.; Kaur, Y.; Meyre, D. Recent progress in genetics, epigenetics and metagenomics unveils the pathophysiology of human obesity. Clin. Sci. 2016, 130, 943–986. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lutz, T.A.; Wood, S.C. Overview of animal models of obesity. Curr. Protoc. Pharmacol. 2012, 58, 5–61. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lamont, B.J.; Waters, M.F.; Andrikopoulos, S. A low-carbohydrate high-fat diet increases weight gain and does not improve glucose tolerance, insulin secretion or β-cell mass in NZO mice. Nutr. Diabetes 2016, 6, 194–200. [Google Scholar] [CrossRef] [PubMed]
- Kaare, M.; Mikheim, K.; Lilleväli, K.; Kilk, K.; Jagomäe, T.; Leidmaa, E.; Piirsalu, M.; Porosk, R.; Singh, K.; Reimets, R.; et al. High-fat diet induces pre-diabetes and distinct sex-specific metabolic alterations in negr1-deficient mice. Biomedicines 2021, 9, 1148. [Google Scholar] [CrossRef] [PubMed]
- Jeon, G.; Choi, Y.; Lee, S.M.; Kim, Y.; Jeong, H.S.; Lee, J. Anti-obesity activity of methanol extract from hot pepper (Capsicum annuum L.) seeds in 3T3-L1 adipocyte. Food Sci. Biotechnol. 2010, 19, 1123–1127. [Google Scholar] [CrossRef]
- Klop, B.; Elte, J.W.F.; Cabezas, M.C. Dyslipidemia in obesity: Mechanisms and potential targets. Nutrients 2013, 5, 1218–1240. [Google Scholar] [CrossRef] [Green Version]
- Jadhav, S.J.; Lutz, S.E.; Ghorpade, V.M.; Salunkhe, D.K. Barley: Chemistry and value-added processing. Crit. Rev. Food Sci. Nutr. 1998, 38, 123–171. [Google Scholar] [CrossRef]
- Goupy, P.; Hugues, M.; Boivin, P.; Amiot, M.J. Antioxidant composition and activity of barley (Hordeum vulgare) and malt extracts and of isolated phenolic compounds. J. Sci. Food Agric. 1999, 79, 1625–1634. [Google Scholar] [CrossRef]
- Mickowska, B.; Socha, P.; Urminská, D.; Cieślik, E. The comparison of prolamines extracted from different varieties of wheat, barley, rye triricale species; Amino acid composition, electrophoresis and immunodetection. J. Microbiol. Biotechnol. Food Sci. 2012, 1, 742–752. [Google Scholar]
- Tatsu, S.; Matsuo, Y.; Nakahara, K.; Hofmann, T.; Steinhaus, M. Key Odorants in Japanese Roasted Barley Tea (Mugi-Cha)—Differences between Roasted Barley Tea Prepared from Naked Barley and Roasted Barley Tea Prepared from Hulled Barley. J. Agric. Food Chem. 2020, 68, 2728–2737. [Google Scholar] [CrossRef]
- Lee, J.S.; Kim, G.N.; Lee, S.H.; Kim, E.S.; Ha, K.S.; Kwon, Y.I.; Jeong, H.S.; Jang, H.D. In vitro and cellular antioxidant activity of arginyl-fructose and arginyl-fructosyl-glucose. Food Sci. Biotechnol. 2009, 18, 1505–1510. [Google Scholar]
- Ha, K.S.; Jo, S.H.; Kang, B.H.; Apostolidis, E.; Lee, M.S.; Jang, H.D.; Kwon, Y.I. In vitro and in vivo antihyperglycemic effect of 2 amadori rearrangement compounds, Arginyl-fructose and arginyl-fructosyl-glucose. J. Food Sci. 2011, 76, 188–193. [Google Scholar] [CrossRef] [PubMed]
- Lee, K.-H.; Ha, K.S.; Jo, S.H.; Lee, C.-M.; Kim, Y.-C.; Chung, K.-H.; Kwon, Y.-I. Effect of long-term dietary arginyl-fructose (AF) on hyperglycemia and HbA1c in diabetic db/db mice. Int. J. Mol. Sci. 2014, 15, 8352–8359. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Park, S.E.; Kin, O.-H.; Kwak, J.H.; Lee, K.H.; Kwon, Y.-I.; Chung, K.H.; Lee, J.H. Antihyperglycemic effect of short-term arginyl-fructose supplementation in subjects with prediabetes and newly diagnosed type 2 diabetes: Randomized, double-blinded, placebo-controlled trial. Trials 2015, 16, 521–528. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vuksan, V.; Sievenpipper, J.; Jovanovski1, E.; Jenkins, A.L. Current clinical evidence for Korean red ginseng in management of diabetes and vascular disease: A Toronto’s ginseng clinical testing program. J. Ginseng Res. 2010, 34, 264–273. [Google Scholar] [CrossRef] [Green Version]
- Papetti, G.; Daglia, M.; Aceti, C.; Quaglia, M.; Gregotti, C.; Gazzani, G. Isolation of an In Vitro and Ex Vivo Antiradical Melanoidin from Roasted Barley. J. Agric. Food Chem. 2006, 54, 1209–1216. [Google Scholar] [CrossRef]
- Ariemma, F.; Desposito, V.; Liguoro, D. Low-dose bisphenol-A impairs adipogenesis and generates dysfunctional 3T3-L1 adipocytes. PLoS ONE 2016, 11, e0150762. [Google Scholar] [CrossRef] [Green Version]
- Jang, B. Artesunate inhibits adipogeneis in 3T3-L1 preadipocytes by reducing the expression and/or phosphorylation levels of C/EBP-α, PPAR-γ, FAS, perilipin A, and STAT-3. Biochem. Biophys. Res. Commun. 2016, 474, 220–225. [Google Scholar] [CrossRef]
- Lee, H.; Park, Y. Identifcation of metabolic pathways related to the bisphenol A-induced adipogenesis in diferentiated murine adipocytes by using RNA-sequencing. Environ. Res. 2019, 171, 161–169. [Google Scholar] [CrossRef]
- Ali, A.T.; Penny, C.B.; Paiker, J.E.; Niekerk, C.V.; Smit, A.; Ferris, W.F.; Crowther, N.J. Alkaline phosphatase is involved in the control of adipogenesis in the murine preadipocyte cell line, 3T3-L1. Clin. Chim. Acta. 2005, 354, 101–109. [Google Scholar] [CrossRef]
- Ntambi, J.M.; Kim, Y.C. Adipocyte differentiation and gene expression. J. Nutr. 2000, 130, 3122S–3126S. [Google Scholar] [CrossRef] [PubMed]
- Friedman, J.M.; Halaas, J.L. Leptin and the regulation of body weight in mammals. Nature 1998, 395, 763–770. [Google Scholar] [CrossRef] [PubMed]
- Elmquist, J.K.; Maratos-Flier, E.; Saper, C.B.; Flier, J.S. Unraveling the central nervous system pathways underlying responses to leptin. Nat. Neurosci. 1998, 1, 445–449. [Google Scholar] [CrossRef] [PubMed]
- Bates, S.H.; Myers, M.G. The role of leptin receptor signaling in feeding and neuroendocrine function. Trends Endocrinol. Metab. 2003, 14, 447–452. [Google Scholar] [CrossRef]
- Myers, M.G.; Cowley, M.A.; Munzberg, H. Mechanisms of leptin action and leptin resistance. Ann. Rev. Physiol. 2008, 70, 537–556. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.-Y.; Kim, T.Y.; Kang, H.; Oh, J.B.; Park, J.W.; Kim, S.-C.; Kim, M.; Apostolidis, E.; Kim, Y.-C.; Kwon, Y.I. Anti-Obesity and Anti-Adipogenic Effects of Chitosan Oligosaccharide (GO2KA1) in SD Rats and in 3T3-L1 Preadipocytes Models. Molecules 2021, 26, 331. [Google Scholar] [CrossRef]
- Yu, S.Y.; Choi, Y.; Kwon, Y.I.; Lee, O.-H.; Kim, Y.C. Mechanism of Formononetin-Induced Stimulation of Adipocyte Fatty Acid Oxidation and Preadipocyte Differentiation. J. Food. Nutr. Res. 2021, 9, 90–99. [Google Scholar] [CrossRef]
Parameters | C57BL/6 | |
---|---|---|
HFD | BEE | |
Initial body weight (g) | 28.90 ± 1.66 | 28.90 ± 1.97 |
Final body weight (g) | 45.26 ± 2.17 | 37.60 ± 2.60 ** |
Final body weight gain (g) | 16.06 ± 2.44 | 9.40 ± 1.39 ** |
FER (%) † | 8.70 ± 2.75 | 4.99 ± 1.63 ** |
Total cholesterol (mg/dL) | 125.10 ± 11.42 | 112.26 ± 11.35 |
Triglyceride (mg/dL) | 79.76 ± 5.60 | 52.36 ± 9.81 ** |
HDL Cholesterol (mg/dL) | 38.34 ± 11.28 | 62.94 ± 13.06 * |
LDL Cholesterol (mg/dL) | 70.81 ± 8.62 | 38.85 ± 14.00 ** |
Parameters (mg/g) | C57BL/6 | |
---|---|---|
HFD | BEE | |
Liver | 40.892 ± 4.691 | 35.059 ± 3.917 |
Kidney | 7.215 ± 0.458 | 8.321 ± 0.564 ** |
Cecum | 3.433 ± 0.619 | 4.589 ± 1.084 |
Mesenteric fat | 20.805 ± 1.276 | 15.337 ± 1.791 ** |
Retroperitoneal fat | 11.945 ± 1.801 | 11.301 ± 2.289 * |
Kidney fat | 4.027 ± 2.347 | 3.177 ± 0.699 |
Subcutaneous fat | 54.673 ± 8.099 | 33.792 ± 8.907 ** |
Epididymal fat | 49.196 ± 5.720 | 37.537 ± 6.018 * |
Small intestine | 17.553 ± 1.853 | 21.095 ± 4.944 |
Parameters | C57BL/6 | |
---|---|---|
HFD | BEE | |
Adiponectin (μg/mL) | 34.93 ± 8.46 | 54.81 ± 10.81 * |
Leptin (ng/mL) | 41.26 ± 8.60 | 22.19 ± 8.24 ** |
TNF-α (pg/mL) | 31.00 ± 2.58 | 42.03 ± 9.09 * |
IL-6 (μg/mL) | 67.55 ± 14.84 | 41.92 ± 11.82 * |
Insulin (μg/mL) | 0.77 ± 0.08 | 0.48 ± 0.06 ** |
Genes | Primer Sequences | |
---|---|---|
Accession Number | Forward (5′-3′) | Reverse (5′-3′) |
GAPDH | CGTCCCGTAGACAAAATGGT | TTGATGGCAACAATCTCCAC |
NM_008084 | ||
PPARγ | GAAAGACAACGGACAAATCACC | GGGGGTGATATGTTTGAACTTG |
NM_011146 | ||
C/EBPα | TTGTTTGGCTTTATCTCGGC | CCAAGAAGTCGGTGGACAAG |
NM_007678 | ||
FABP4 | AGCCTTTCTCACCTGGAAGA | TTGTGGCAAAGCCCATC |
NM_024406 | ||
FAS | TGATGTGGAACACAGCAAGG | GGCTGTGGTGACTCTTAGTGATAA |
NM_007988 | ||
SREBP-1c | ACGGAGCCATGGATTGCACA | AAGGGTGCAGGTGTCACCTT |
NM_011480 | ||
LPL | GGACGGTAACGGGAATGTATGA | TGACATTGGAGTCAGGTTCTCTCT |
NM_008509 |
High Fat Diets (g/kg) | |
---|---|
Corn starch | 321 |
Sucrose | 100 |
Casein | 200 |
Corn oil | 100 |
Lard | 200 |
Cellulose | 30 |
DL-methionine | 2 |
Vitamin mix (1) | 10 |
Mineral mix (2) | 35 |
Choline bitartrate | 2 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, S.-Y.; Kim, T.-Y.; Hong, J.-Y.; Kim, G.-J.; Oh, J.-B.; Kim, M.-J.; Apostolidis, E.; Lee, J.-Y.; Kwon, Y.-I. Anti-Obesity and Anti-Adipogenic Effects of Administration of Arginyl-Fructose-Enriched Jeju Barley (Hordeum vulgare L.) Extract in C57BL/6 Mice and in 3T3-L1 Preadipocytes Models. Molecules 2022, 27, 3248. https://doi.org/10.3390/molecules27103248
Lee S-Y, Kim T-Y, Hong J-Y, Kim G-J, Oh J-B, Kim M-J, Apostolidis E, Lee J-Y, Kwon Y-I. Anti-Obesity and Anti-Adipogenic Effects of Administration of Arginyl-Fructose-Enriched Jeju Barley (Hordeum vulgare L.) Extract in C57BL/6 Mice and in 3T3-L1 Preadipocytes Models. Molecules. 2022; 27(10):3248. https://doi.org/10.3390/molecules27103248
Chicago/Turabian StyleLee, Soo-Young, Tae-Yang Kim, Ji-Yoon Hong, Gi-Jung Kim, Jung-Bae Oh, Min-Joo Kim, Emmanouil Apostolidis, Jung-Yun Lee, and Young-In Kwon. 2022. "Anti-Obesity and Anti-Adipogenic Effects of Administration of Arginyl-Fructose-Enriched Jeju Barley (Hordeum vulgare L.) Extract in C57BL/6 Mice and in 3T3-L1 Preadipocytes Models" Molecules 27, no. 10: 3248. https://doi.org/10.3390/molecules27103248