The Antibacterial Activity Mode of Action of Plantaricin YKX against Staphylococcus aureus
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials and Strains
2.2. Determination of the Minimum Inhibitory Concentration (MIC)
2.3. Effect of Plantaricin YKX on S. aureus at Different Growth Phases
2.4. Effect of Plantaricin YKX on S. aureus Cells
2.4.1. Measurement of the Extracellular K+ Ion Concentration
2.4.2. Flow Cytometry
2.4.3. Scanning Electron Microscope Observation of E. coli Cells
2.5. Effect of Plantaricin YKX on the Biofilm of S. aureus
2.5.1. Inhibitory Activity of Plantaricin YKX on S. aureus Biofilm Formation
2.5.2. Confocal Laser Microscopy
2.6. Effect of Plantaricin YKX on the QS System of S. aureus
2.6.1. Molecular Docking Was Used to Investigate the Effect of Plantaricin YKX on AI-2 Molecules and the Lux S Enzyme
2.6.2. Effect of Plantaricin YKX on the mRNA Expression of QS System-Related Genes (ica, lux and hld)
2.7. Statistical Analyses
3. Results and Discussion
3.1. The MIC of Plantaricin YKX
3.2. Effect of Plantaricin YKX on S. aureus Cells at Different Growth Phases
3.3. Effect of Plantaricin YKX on S. aureus Cells
3.4. Inhibition of Biofilm Formation by Plantaricin YKX
3.5. Effect of Plantaricin YKX on the AI-2/Lux S QS System of S. aureus
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- Tong, S.Y.; Davis, J.S.; Eichenberger, E.; Holland, T.L.; Fowler, V.G. Staphylococcus aureus infections: Epidemiology, pathophysiology, clinical manifestations, and management. Clin. Microbiol. Rev. 2015, 28, 603–661. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bajaj, T.; Karapetians, A.; Karapetians, N.; Duong, H.; Heidari, A. Methicillin resistant Staphylococcus aureus infective endocarditis presenting as neutrophilic meningoencephalitis. AME Case Rep. 2020, 4, 4e. [Google Scholar] [CrossRef] [PubMed]
- Muñoz-Silvestre, A.; Penadés, M.; Selva, L.; Pérez-Fuentes, S.; Moreno-Grua, E.; García-Quirós, A.; Pascual, J.J.; Arnau-Bonachera, A.; Barragán, A.; Corpa, J.M.; et al. Pathogenesis of intradermal staphylococcal infections: Rabbit experimental approach to natural Staphylococcus aureus skin infections. Am. J. Pathol. 2020, 190, 1188–1210. [Google Scholar] [CrossRef] [PubMed]
- Hall-Stoodley, L.; Costerton, J.; Stoodley, P. Bacterial biofilms: From the natural environment to infectious diseases. Nat. Rev. Microbiol. 2004, 2, 95–108. [Google Scholar] [CrossRef]
- Gutiérrez, D.; Rodríguez-Rubio, L.; García, P.; Billington, C.; Premarante, A.; Rodríguez, A.; Martínez, B. Phage sensitivity and prophage carriage in Staphylococcus aureus isolated from foods in Spain and New Zealand. Int. J. Food Microbiol. 2016, 230, 16–20. [Google Scholar] [CrossRef] [Green Version]
- Archer, N.K.; Mazaitis, M.J.; Costerton, J.W.; Leid, J.G.; Powers, M.E.; Shirtliff, M.E. Staphylococcus aureus biofilms. Virulence 2011, 2, 445–459. [Google Scholar] [CrossRef] [Green Version]
- Flemming, H.C.; Wingender, J.; Szewzyk, U.; Steinberg, P.; Rice, S.A.; Kjelleberg, S. Biofifilms: An emergent form of bacterial life. Nat. Rev. Microbiol. 2016, 14, 563–575. [Google Scholar] [CrossRef]
- Römling, U.; Balsalobre, C. Biofilm infections, their resilience to therapy and innovative treatment strategies. J. Intern. Med. 2012, 272, 541–561. [Google Scholar] [CrossRef]
- Srivastava, S.; Bhargava, A. Biofilms and human health. Biotechnol. Lett. 2016, 38, 1–22. [Google Scholar] [CrossRef]
- Amit, S.K.; Uddin, M.M.; Rahman, R.; Islam, S.M.R.; Khan, M.S. A review on mechanisms and commercial aspects of food preservation and processing. Agric. Food Secur. 2017, 6, 51. [Google Scholar] [CrossRef]
- Gao, Y.; Jia, S.; Gao, Q.; Tan, Z. A novel bacteriocin with a broad inhibitory spectrum produced by Lactobacillus sake C2, isolated from traditional Chinese fermented cabbage. Food Control 2010, 21, 76–81. [Google Scholar] [CrossRef]
- Pei, J.J.; Feng, Z.Z.; Ren, T.; Sun, H.Y.; Hao, H.; Jin, W.G.; Dang, J.; Tao, Y.D. Purification, characterization and application of a novel antibacterial peptide from Andrias davidianus blood. Lett. Appl. Microbiol. 2017, 66, 38–43. [Google Scholar] [CrossRef]
- Cotter, P.D.; Ross, R.P.; Hill, C. Bacteriocins—A viable alternative to antibiotics? Nat. Rev. Microbiol. 2013, 11, 95–105. [Google Scholar] [CrossRef]
- Cotter, P.D.; Hill, C.; Ross, R.P. Bacteriocins: Developing innate immunity for food. Nat. Rev. Microbiol. 2005, 3, 777–788. [Google Scholar] [CrossRef]
- Gálvez, A.; López, R.L.; Pulido, R.P.; Burgos, M.J.G. Application of Lactic Acid Bacteria and Their Bacteriocins for Food Biopreservation. In Food Biopreservation; Springer: New York, NY, USA, 2014; pp. 15–22. [Google Scholar]
- Asioli, D.; Aschemann-Witzel, J.; Caputo, V.; Vecchio, R.; Annunziata, A.; Næs, T.; Varela, P. Making sense of the “clean label” trends: A review of consumer food choice behavior and discussion of industry implications. Food Res. Int. 2017, 99, 58–71. [Google Scholar] [CrossRef]
- Gálvez, A.; López, R.; Abriouel, H.; Valdivia, E.; Omar, N.B. Application of bacteriocins in the control of foodborne pathogenic and spoilage bacteria. Crit. Rev. Biotechnol. 2008, 28, 125–152. [Google Scholar] [CrossRef]
- Wen, L.S.; Philip, K.; Ajam, N. Purification, characterization and mode of action of plantaricin K25 produced by Lactobacillus plantarum. Food Control 2016, 60, 430–439. [Google Scholar] [CrossRef]
- Pang, X.; Song, X.; Chen, M.; Tian, S.; Lu, Z.; Sun, J.; Li, X.; Lu, Y.; Yuk, H. Combating biofilms of foodborne pathogens with bacteriocins by lactic acid bacteria in the food industry. Compr. Rev. Food Sci. Food Saf. 2022, 21, 1657–1676. [Google Scholar] [CrossRef]
- Kim, N.N.; Kim, W.J.; Kang, S.S. Anti-biofilm effect of crude bacteriocin derived from Lactobacillus brevis DF01 on Escherichia coli and Salmonella Typhimurium. Food Control 2019, 98, 274–280. [Google Scholar] [CrossRef]
- Pei, J.; Jin, W.; Wang, J.; Huang, Y.; Li, X.; Zhang, H.; Zhang, Y.; Ramadan, A.; El-Aty, A.M.A. Purification and Characterization of Plantaricin YKX and Assessment of Its Inhibitory Activity Against Alicyclobacillus spp. Front. Microbiol. 2021, 12, 783266. [Google Scholar] [CrossRef]
- Clinical and Laboratory Standards Institute. Methods for Dilution Antibacterial Susceptibility Tests for Bacteria That Grow Aerobically: Approved Standards, 9th ed.; Document M07-A9; CLSI: Wayne, PA, USA, 2012. [Google Scholar]
- Pei, J.; Yuan, Y.; Yue, T. Primary characterization of bacteriocin paracin C—A novel bacteriocin produced by Lactobacillus paracasei. Food Control 2013, 34, 168–176. [Google Scholar] [CrossRef]
- Pei, J.J.; Li, X.S.; Han, H.; Tao, Y.D. Purification and characterization of plantaricin SLG1, a novel bacteriocin produced by Lb. plantarum isolated from yak cheese. Food Control 2018, 84, 111–117. [Google Scholar] [CrossRef]
- Acuna, L.; Picariello, G.; Sesma, F.; Morero, R.D.; Bellomio, A. A new hybrid bacteriocin, Ent35-MccV, displays antibacterial activity against pathogenic Gram-positive and Gram-negative bacteria. FEBS Open Bio 2012, 2, 12–19. [Google Scholar] [CrossRef] [Green Version]
- Pei, J.; Jin, W.; Abd El-Aty, A.M.; Baranenko, D.A.; Gou, X.; Zhang, H.; Geng, J.; Jiang, L.; Chen, D.; Yue, T. Isolation, purification, and structural identification of a new bacteriocin made by Lactobacillus plantarum found in conventional kombucha. Food Control 2020, 110, 106923. [Google Scholar] [CrossRef]
- Todorov, S.D.; Prévost, H.; Lebois, M.; Dousset, X.; LeBlanc, J.G.; Franco, B.D.G.M. Bacteriocinogenic Lactobacillus plantarum ST16 Pa isolated from papaya (Carica papaya)—From isolation to application: Characterization of a bacteriocin. Food Res. Int. 2011, 44, 1351–1363. [Google Scholar] [CrossRef]
- Lohans, C.T.; Towle, K.M.; Miskolzie, M.; McKay, R.T.; van Belkum, M.J.; McMullen, L.M.; Vederas, J.C. Solution structures of the linear leaderless bacteriocins enterocin 7A and 7B resemble carnocyclin A, a circular antimicrobial peptide. Biochem.-US 2013, 52, 3987–3994. [Google Scholar] [CrossRef]
- Liu, G.; Song, Z.; Yang, X.; Gao, Y.; Wang, C.; Sun, B. Antibacterial mechanism of bifidocin A, a novel broad-spectrum bacteriocin produced by Bifidobacterium animalis BB04. Food Control 2016, 62, 309–316. [Google Scholar] [CrossRef]
- Hu, M.; Zhao, H.; Zhang, C.; Yu, J.; Lu, Z. Purification and characterization of plantaricin 163, a novel bacteriocin produced by Lactobacillus plantarum 163 isolated from traditional Chinese fermented vegetables. J. Agric. Food Chem. 2013, 61, 11676–11682. [Google Scholar] [CrossRef]
- Winkelströter, L.K.; Tulini, F.L.; De Martinis, E.C.P. Identification of the bacteriocin produced by cheese isolate Lactobacillus paraplantarum, FT259 and its potential influence on Listeria monocytogenes, biofilm formation. LWT-Food Sci. Technol. 2015, 64, 586–592. [Google Scholar] [CrossRef]
- Houry, A.; Briandet, R.; Aymerich, S.; Gohar, M. Involvement of motility and flagella in Bacillus cereus biofilm formation. Microbiology 2010, 156, 1009–1018. [Google Scholar] [CrossRef] [Green Version]
- Zhao, S.M.; Han, J.Z.; Bie, X.M.; Lu, Z.X.; Zhang, C.; Lv, F.X. Purification and characterization of plantaricin JLA-9: A novel bacteriocin against Bacillus spp. produced by Lactobacillus plantarum JLA-9 from Suan-Tsai, a traditional Chinese fermented cabbage. J. Agric. Food Chem. 2016, 64, 2754–2764. [Google Scholar] [CrossRef] [PubMed]
Strains of S. aureus | MIC |
S. aureus CMCC 26560 | 16 μg/mL |
S. aureus CMCC 26563 | 16 μg/mL |
S.aureus CMCC 26565 | 16 μg/mL |
S. aureus CMCC 26570 | 16 μg/mL |
S. aureus CMCC 26573 | 32 μg/mL |
S. aureus CMCC 26581 | 16 μg/mL |
S. aureus CMCC 26590 | 32 μg/mL |
S. aureus CMCC 26575 | 16 μg/mL |
S.aureus CMCC 26585 | 16 μg/mL |
S. aureus CMCC 26579 | 16 μg/mL |
S. qureus ATCC 25923 | 16 μg/mL |
Gene | Primers (5′-3′) |
lux | F: TCCTATGGGTTGTCAAACTGG |
R: CCTTCTCCGTAGATGTCATTCC | |
icaC | F: TGCTTACACCAACATATTTGAAGATAATAC |
R: GACGCCTATACAAATTCCTAGAATCATT | |
hld | F: GAAGTTATGATGGCAGCAGAT |
R: GTTGGGATGGCTCAACAACT | |
16S rRNA | F: GCGGTCGCCTCCTAAAAG R: TCCCGGTCCTCTCGTACTA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pei, J.; Huang, Y.; Ren, T.; Guo, Y.; Dang, J.; Tao, Y.; Zhang, Y.; Abd El-Aty, A.M. The Antibacterial Activity Mode of Action of Plantaricin YKX against Staphylococcus aureus. Molecules 2022, 27, 4280. https://doi.org/10.3390/molecules27134280
Pei J, Huang Y, Ren T, Guo Y, Dang J, Tao Y, Zhang Y, Abd El-Aty AM. The Antibacterial Activity Mode of Action of Plantaricin YKX against Staphylococcus aureus. Molecules. 2022; 27(13):4280. https://doi.org/10.3390/molecules27134280
Chicago/Turabian StylePei, Jinjin, Yigang Huang, Ting Ren, Yaodong Guo, Jun Dang, Yanduo Tao, Yonggui Zhang, and A. M. Abd El-Aty. 2022. "The Antibacterial Activity Mode of Action of Plantaricin YKX against Staphylococcus aureus" Molecules 27, no. 13: 4280. https://doi.org/10.3390/molecules27134280