α-Linolenic Acid Screened by Molecular Docking Attenuates Inflammation by Regulating Th1/Th2 Imbalance in Ovalbumin-Induced Mice of Allergic Rhinitis
Abstract
:1. Introduction
2. Results
2.1. ALA Ameliorated Nasal Symptoms in OVA-induced AR in Mice
2.2. ALA Reduced the OVA-sIgE Level in the Serum
2.3. ALA Relieved the Histopathological Injuries in the Nasal Mucosa
2.4. Effect of ALA on the mRNA Expression Levels of IL-6, IL-1β, IFN-γ, and IL-4 in the Nasal Mucosa
2.5. Effect of ALA on the Percentages of CD3+CD4+IFN-γ+ Th1 and CD3+CD4+IL-4+ Th2 Cells in the Spleen
2.6. Effect of ALA on the mRNA Expression Levels of T-bet, GATA3, STAT1, and STAT6 in the Nasal Mucosa
3. Discussion
4. Materials and Methods
4.1. Reagents
4.2. Animals
4.3. Ovalbumin-Induced AR Model and ALA Treatment
4.4. Evaluation of Nasal Symptoms
4.5. Histological Analysis
4.6. Measurement of OVA-sIgE in the Serum by ELISA Assay
4.7. Isolation of SMCs
4.8. Flow Cytometry Analysis
4.9. RNA Isolation and qRT-PCR Analyses
4.10. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Sample Availability
References
- Al Suleimani, Y.M.; Walker, M.J. Allergic rhinitis and its pharmacology. Pharmacol. Therapeut. 2007, 114, 233–260. [Google Scholar] [CrossRef] [PubMed]
- Bernstein, D.I.; Schwartz, G.; Bernstein, J.A. Allergic Rhinitis: Mechanisms and Treatment. Immunol. Allergy Clin. N. Am. 2016, 36, 261–278. [Google Scholar] [CrossRef] [PubMed]
- Yang, L.Z.; Yu, B.L. New progress in the treatment of allergic rhinitis. Pharm. Clin. Res. 2013, 21, 543–546. [Google Scholar]
- Shark, A.H.; Crawford, M.A.; Reifen, R. Update on alpha-linelic acid. Nutr. Rev. 2008, 66, 326–332. [Google Scholar]
- Kim, K.; Nam, Y.A.; Kim, H.S.; Hayes, A.W.; Lee, B.-M. alpha-Linolenic acid: Nutraceutical, pharmacological and toxicological evaluation. Food Chem. Toxicol. 2014, 70, 163–178. [Google Scholar] [CrossRef]
- Erdinest, N.; Shmueli, O.; Grossman, Y.; Ovadia, H.; Solomon, A. Anti-inflammatory effects of alpha linolenic acid on human corneal epithelial cells. Investig. Ophthalmol. Vis. Sci. 2012, 53, 4396–4406. [Google Scholar] [CrossRef]
- Pauls, S.D.; Rodway, L.A.; Winter, T.; Taylor, C.G.; Zahradka, P.; Aukema, H.M. Anti-inflammatory effects of α-linolenic acid in M1-like macrophages are associated with enhanced production of oxylipins from α-linolenic and linoleic acid. J. Nutr. Biochem. 2018, 57, 121–129. [Google Scholar] [CrossRef]
- Park, B.K.; Park, S.; Park, J.B.; Park, M.C.; Min, T.S.; Jin, M. Omega-3 fatty acids suppress Th2-associated cytokine gene expressions and GATA transcription factors in mast cells. J. Nutr. Biochem. 2013, 24, 868–876. [Google Scholar] [CrossRef]
- Sliwoski, G.; Kothiwale, S.; Meiler, J.; Lowe, E.W., Jr. Computational methods in drug discovery. Pharmacol. Rev. 2014, 66, 334–395. [Google Scholar] [CrossRef]
- Chaudhari, R.; Tan, Z.; Huang, B.; Zhang, S. Computational polypharmacology: A new paradigm for drug discovery. Expert Opin. Drug Discov. 2017, 12, 279–291. [Google Scholar] [CrossRef]
- Ren, M.Y. Study on the Treatment of Allergic Rhinitis in Rats with Yang Deficiency and the Functional Components of Regulating Th1/Th2 Balance of Mahuang Fuzi Xixin Decoction; Southern Medical University: Guangzhou, China, 2018. [Google Scholar]
- Galli, S.J.; Tsai, M.; Piliponsky, A.M. The development of allergic inflammation. Nature 2008, 454, 445–454. [Google Scholar] [CrossRef] [PubMed]
- Farhadi, M.; Barati, M.; Tabatabaii, A.; Shekarabi, M.; Noorbakhsh, S.; Javadinia, S. Th1 and Th2 cytokine gene expression in atopic and nonatopic patients with nasal polyposis. Ear Nose Throat J. 2015, 94, 228–235. [Google Scholar] [CrossRef] [PubMed]
- Wei, J.K.; Hou, R.X.; Xi, Y.Z.; Kowalski, A.; Wang, T.; Yu, Z.; Hu, Y.; Chandrasekar, E.K.; Sun, H.; Ali, M.K. The association and dose-response relationship between dietary intake of alpha-linolenic acid and risk of CHD: A systematic review and meta—Analysis of cohort studies. Br. J. Nutr. 2018, 119, 83–89. [Google Scholar] [CrossRef]
- Bourourou, M.; Heurteaux, C.; Blondeau, N. Alpha-linolenic acid given as enteral or parenteral nutritional intervention against sensorimotor and cognitive deficits in a mouse model of ischemic stroke. Neuropharmacology 2016, 108, 60–72. [Google Scholar] [CrossRef] [PubMed]
- Finnegan, Y.E.; Minihane, A.M.; Leigh-Firbank, E.C.; Kew, S.; Meijer, G.W.; Muggli, R.; Calder, P.C.; Williams, C.M. Plant- and marine-derived n-3 polyunsaturated fatty acids have differential effects on fasting and postprandial blood lipid concentrations and on the susceptibility of LDL to oxidative modification in moderately hyperlipidemic subjects. Am. J. Clin. Nutr. 2003, 77, 783–795. [Google Scholar] [CrossRef]
- Deshpande, R.; Mansara, P.; Suryavanshi, S.; Kaul-Ghanekar, R. Alpha-linolenic acid regulates the growth of breast and cervical cancer cell lines through regulation of NO release and induction of lipid peroxidation. J. Mol. Biochem. 2013, 2, 6–17. [Google Scholar]
- Tang, L.; Li, X.; Wan, L.; Wang, H.; Mai, Q.; Deng, Z.; Ding, H. Ameliorative effect of orally administered different linoleic acid/α-linolenic acid ratios in a mouse model of DNFB-induced atopic dermatitis. J. Funct. Foods 2020, 65, 103754. [Google Scholar] [CrossRef]
- Winnik, S.; Lohmann, C.; Richter, E.; Schäfer, N.; Song, W.-L.; Leiber, F.; Mocharla, P.; Hofmann, J.; Klingenberg, R.; Borén, J.; et al. Dietary α-linolenic acid diminishes experimental atherogenesis and restricts T cell-driven inflammation. Eur. Heart J. 2011, 32, 2573–2584. [Google Scholar] [CrossRef]
- Tuccinardi, T. Docking-based virtual screening: Recent developments. Comb. Chem. High Throughput Screen. 2009, 12, 303–314. [Google Scholar] [CrossRef]
- Steinhilber, D.; Hofmann, B. Recent advances in the search for novel 5-lipoxygenase inhibitors. Basic Clin. Pharmacol. Toxicol. 2014, 114, 70–77. [Google Scholar] [CrossRef]
- Zhang, L.; Han, D.M. H1-antihistamines. J. Clin. Otorhinolaryngol. Head Neck Surg. 2013, 27, 104–109. [Google Scholar]
- Meyer, E.J.; Nenke, M.A.; Rankin, W.; Lewis, J.G.; Torpy, D.J. Corticosteroid-Binding Globulin: A Review of Basic and Clinical Advances. Horm. Metab. Res. 2016, 48, 359–371. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.; Han, X.; Rawson, N.E.; Zhang, L.K. Nasal mucosal effects of muscarinic acetylcholine receptors. Prog. Physiol. Sci. 2009, 40, 261–263. [Google Scholar]
- Schmidt, B.M.; Kusma, M.; Feuring, M.; Timmer, W.E.; Neuhäuser, M.; Bethke, T.; Stuck, B.A.; Hörmann, K.; Wehling, M. The phosphodiesterase 4 inhibitor roflumilast is effective in the treatment of allergic rhinitis. J. Allergy Clin. Immunol. 2001, 108, 530–536. [Google Scholar] [CrossRef]
- Smith, V.B.; Spina, D. Selective phosphodiesterase 4 inhibitors in the treatment of allergy and inflammation. Curr. Opin. Investig. Drugs 2005, 6, 1136–1141. [Google Scholar]
- Kupczyk, M.; Kuna, P. Targeting the PGD2/CRTH2/DP1 Signaling Pathway in Asthma and Allergic Disease: Current Status and Future Perspectives. Drugs 2017, 77, 1281–1294. [Google Scholar] [CrossRef] [Green Version]
- Greiner, A.N.; Hellings, P.W.; Rotiroti, G.; Scadding, G.K. Allergic rhinitis. Lancet 2011, 378, 2112–2122. [Google Scholar] [CrossRef]
- Rose, M.C.; Nickola, T.J.; Voynow, J.A. Airway mucus obstruction: Mucin glycoproteins, MUC gene regulation and goblet cell hyperplasia. Am. J. Respir. Cell Mol. Biol. 2001, 25, 533–537. [Google Scholar] [CrossRef]
- Frei, R.; Lauener, R.P.; Crameri, R.; O’Mahony, L. Microbiota and dietary interactions: An update to the hygiene hypothesis. Allergy 2012, 67, 451–461. [Google Scholar] [CrossRef]
- Kumar, Y.; Bhatia, A. Immunopathogenesis of allergic disorders: Current concepts. Clin. Immunol. 2013, 9, 211–216. [Google Scholar] [CrossRef]
- Villarino, A.V.; Kanno, Y.; Ferdinand, J.R.; O’Shea, J.J. Mechanisms of Jak/STAT signaling in immunity and disease. J. Immunol. 2015, 194, 21–27. [Google Scholar] [PubMed]
- Bowen, H.; Kelly, A.; Lee, T.; Lavender, P. Control of cytokine gene transcription in Th1 and Th2 cells. Clin. Exp. Allergy 2008, 38, 1422–1431. [Google Scholar] [PubMed]
- Oestreich, K.J.; Weinmann, A.S. Transcriptional mechanisms that regulate T helper 1 cell differentiation. Curr. Opin. Immunol. 2012, 24, 191–195. [Google Scholar] [PubMed]
- Zeng, W.P. ‘All things considered’: Transcriptional regulation of T helper type 2 cell differentiation from precursor to effector activation. Immunology 2013, 140, 31–38. [Google Scholar] [PubMed]
Targets | PDB ID | Docking Scores [11] | Binding Energy (kJ/mol) |
---|---|---|---|
HRH1 | 3RZE | 5.77 | −6.5 |
5-LO | 3V98 | 8.85 | −9.1 |
CBG | 4C41 | 9.11 | −11.8 |
mAChR M1 | 6ZFZ | 8.28 | −12.2 |
mAChR M3 | 4DAJ | 9.66 | −6.9 |
PDE4B | 2QYL | 8.72 | −9.5 |
PGD2S | 7M8W | 7.52 | −7.7 |
Gene | Primer | Sequences (5′-3′) |
---|---|---|
IL-1β | Forward | GCAACTGTTCCTGAACTCAACT |
Reverse | ATCTTTTGGGGTCCGTCAACT | |
IL-6 | Forward | TAGTCCTTCCTACCCCAATTTCC |
Reverse | TTGGTCCTTAGCCACTCCTTC | |
INF-γ | Forward | TCAAGTGGCATAGATGTGGAAGAA |
Reverse | TGGCTCTGCAGGATTTTCATG | |
IL-4 | Forward | ACAGGAGAAGGGACGCCAT |
Reverse | GAAGCCCTACAGACGAGCTCA | |
T-bet | Forward | AGCAAGGACGGCGAATGTT |
Reverse | GTGGACATATAAGCGGTTCCC | |
GATA-3 | Forward | AAGCTCAGTATCCGCTGACG |
Reverse | GTTTCCGTAGTAGGACGGGAC | |
STAT1 | Forward | TCACAGTGGTTCGAGCTTCAG |
Reverse | CGAGACATCATAGGCAGCGTG | |
STAT6 | Forward | CTCTGTGGGGCCTAATTTCCA |
Reverse | CATCTGAACCGACCAGGAACT | |
GAPDH | Forward | ACCTGCCAAGTATGATGACATCA |
Reverse | GGTCCTCAGTGTAGCCCAAGAT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ren, M.; Wang, Y.; Lin, L.; Li, S.; Ma, Q. α-Linolenic Acid Screened by Molecular Docking Attenuates Inflammation by Regulating Th1/Th2 Imbalance in Ovalbumin-Induced Mice of Allergic Rhinitis. Molecules 2022, 27, 5893. https://doi.org/10.3390/molecules27185893
Ren M, Wang Y, Lin L, Li S, Ma Q. α-Linolenic Acid Screened by Molecular Docking Attenuates Inflammation by Regulating Th1/Th2 Imbalance in Ovalbumin-Induced Mice of Allergic Rhinitis. Molecules. 2022; 27(18):5893. https://doi.org/10.3390/molecules27185893
Chicago/Turabian StyleRen, Mengyue, Yi Wang, Lin Lin, Shaoqiang Li, and Qinhai Ma. 2022. "α-Linolenic Acid Screened by Molecular Docking Attenuates Inflammation by Regulating Th1/Th2 Imbalance in Ovalbumin-Induced Mice of Allergic Rhinitis" Molecules 27, no. 18: 5893. https://doi.org/10.3390/molecules27185893