A New Butyrate Releaser Exerts a Protective Action against SARS-CoV-2 Infection in Human Intestine
Abstract
:1. Introduction
2. Results
2.1. FBA Reduces the Expression of the Main Molecular Mediators of SARS-CoV-2 Infection and Inflammatory Cytokines in Ex Vivo and In Vitro Intestinal Models
2.2. FBA Regulates the Expression of Genes Related to Anti-Viral Pathways
2.3. FBA Prevents the SARS-CoV-2 Infection through Nf-Kb and Nuclear Factor Erythroid 2-Related factor 2 (Nfr2) Regulation
3. Discussion
4. Methods
4.1. Virus
4.2. Human Enterocytes
4.3. Ethics
4.4. Organ Culture of Mucosal Biopsies from Human Small Intestine
4.5. Cell Treatment for Basal and Infection Conditions
4.6. Infectivity Assays: Immunofluorescence Staining and Real-Time PCR for Nucleocapsid Protein
4.7. SARS-CoV-2 Molecular Mediators and Inflammatory Cytokine Analyses with Quantitative Real-Time PCR
4.8. cDNA Library Construction for RNA Sequencing Analysis
4.9. RNA-Seq Data Analysis
4.10. Western Blotting for Nf-kB and Nfr2 Protein Detection
4.11. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- Atzrodt, C.L.; Maknojia, I.; McCarthy, R.D.P.; Oldfield, T.M.; Po, J.; Ta, K.T.L.; Stepp, H.E.; Clements, T.P. A Guide to COVID-19: A global pandemic caused by the novel coronavirus SARS-CoV-2. FEBS J. 2020, 287, 3633–3650. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Yan, L.-M.; Wan, L.; Xiang, T.-X.; Le, A.; Liu, J.-M.; Peiris, M.; Poon, L.L.M.; Zhang, W. Viral dynamics in mild and severe cases of COVID-19. Lancet Infect. Dis. 2020, 20, 656–657. [Google Scholar] [CrossRef] [Green Version]
- Cheung, K.S.; Hung, I.F.N.; Chan, P.P.Y.; Lung, K.C.; Tso, E.; Liu, R.; Ng, Y.Y.; Chu, M.Y.; Chung, T.W.H.; Tam, A.R.; et al. Gastrointestinal Manifestations of SARS-CoV-2 Infection and Virus Load in Fecal Samples From a Hong Kong Cohort: Systematic Review and Meta-analysis. Gastroenterology 2020, 159, 81–95. [Google Scholar] [CrossRef]
- Hoffmann, M.; Kleine-Weber, H.; Schroeder, S.; Krüger, N.; Herrler, T.; Erichsen, S.; Schiergens, T.S.; Herrler, G.; Wu, N.-H.; Nitsche, A.; et al. SARS-CoV-2 Cell Entry Depends on ACE2 and TMPRSS2 and Is Blocked by a Clinically Proven Protease Inhibitor. Cell 2020, 181, 271–280.e8. [Google Scholar] [CrossRef]
- Berni Canani, R.; Comegna, M.; Paparo, L.; Cernera, G.; Bruno, C.; Strisciuglio, C.; Zollo, I.; Gravina, A.G.; Miele, E.; Cantone, E.; et al. Age-Related Differences in the Expression of Most Relevant Mediators of SARS-CoV-2 Infection in Human Respiratory and Gastrointestinal Tract. Front. Pediatr. 2021, 9, 697390. [Google Scholar] [CrossRef] [PubMed]
- Cantuti-Castelvetri, L.; Ojha, R.; Pedro, L.D.; Djannatian, M.; Franz, J.; Kuivanen, S.; van der Meer, F.; Kallio, K.; Kaya, T.; Anastasina, M.; et al. Neuropilin-1 facilitates SARS-CoV-2 cell entry and infectivity. Science 2020, 370, 856–860. [Google Scholar] [CrossRef]
- Daly, J.L.; Simonetti, B.; Klein, K.; Chen, K.-E.; Williamson, M.K.; Antón-Plágaro, C.; Shoemark, D.K.; Simón-Gracia, L.; Bauer, M.; Hollandi, R.; et al. Neuropilin-1 is a host factor for SARS-CoV-2 infection. Science 2020, 370, 861–865. [Google Scholar] [CrossRef]
- Mehta, P.; McAuley, D.F.; Brown, M.; Sanchez, E.; Tattersall, R.S.; Manson, J.J.; HLH Across Speciality Collaboration, UK. COVID-19: Consider cytokine storm syndromes and immunosuppression. Lancet 2020, 395, 1033–1034. [Google Scholar] [CrossRef]
- Liao, M.; Liu, Y.; Yuan, J.; Wen, Y.; Xu, G.; Zhao, J.; Cheng, L.; Li, J.; Wang, X.; Wang, F.; et al. Single-cell landscape of bronchoalveolar immune cells in patients with COVID-19. Nat. Med. 2020, 26, 842–844. [Google Scholar] [CrossRef]
- Zhang, W.; Zhao, Y.; Zhang, F.; Wang, Q.; Li, T.; Liu, Z.; Wang, J.; Qin, Y.; Zhang, X.; Yan, X.; et al. The use of anti-inflammatory drugs in the treatment of people with severe coronavirus disease 2019 (COVID-19): The Perspectives of clinical immunologists from China. Clin. Immunol. 2020, 214, 108393. [Google Scholar] [CrossRef]
- Zhou, F.; Yu, T.; Du, R.; Fan, G.; Liu, Y.; Liu, Z.; Xiang, J.; Wang, Y.; Song, B.; Gu, X.; et al. Clinical course and risk factors for mortality of adult inpatients with COVID-19 in Wuhan, China: A retrospective cohort study. Lancet 2020, 395, 1054–1062. [Google Scholar] [CrossRef]
- Peter, A.E.; Sandeep, B.V.; Rao, B.G.; Kalpana, V.L. Calming the Storm: Natural Immunosuppressants as Adjuvants to Target the Cytokine Storm in COVID-19. Front. Pharmacol. 2021, 11, 583777. [Google Scholar] [CrossRef]
- Ferrucci, V.; Kong, D.-Y.; Asadzadeh, F.; Marrone, L.; Boccia, A.; Siciliano, R.; Criscuolo, G.; Anastasio, C.; Quarantelli, F.; Comegna, M.; et al. Long-chain polyphosphates impair SARS-CoV-2 infection and replication. Sci. Signal. 2021, 14, eabe5040. [Google Scholar] [CrossRef]
- Zuo, T.; Zhang, F.; Lui, G.C.Y.; Yeoh, Y.K.; Li, A.Y.L.; Zhan, H.; Wan, Y.; Chung, A.C.K.; Cheung, C.P.; Chen, N.; et al. Alterations in Gut Microbiota of Patients with COVID-19 during Time of Hospitalization. Gastroenterology 2020, 159, 944–955.e8. [Google Scholar] [CrossRef]
- Gu, S.; Chen, Y.; Wu, Z.; Chen, Y.; Gao, H.; Lv, L.; Guo, F.; Zhang, X.; Luo, R.; Huang, C.; et al. Alterations of the Gut Microbiota in Patients With Coronavirus Disease 2019 or H1N1 Influenza. Clin. Infect. Dis. 2020, 71, 2669–2678. [Google Scholar] [CrossRef]
- Yeoh, Y.K.; Zuo, T.; Lui, G.C.-Y.; Zhang, F.; Liu, Q.; Li, A.Y.; Chung, A.C.; Cheung, C.P.; Tso, E.Y.; Fung, K.S.; et al. Gut microbiota composition reflects disease severity and dysfunctional immune responses in patients with COVID-19. Gut 2021, 70, 698–706. [Google Scholar] [CrossRef]
- Zheng, D.; Liwinski, T.; Elinav, E. Interaction between microbiota and immunity in health and disease. Cell Res. 2020, 30, 492–506. [Google Scholar] [CrossRef]
- Schuijt, T.J.; Lankelma, J.M.; Scicluna, B.P.; Melo, F.D.S.E.; Roelofs, J.J.T.H.; de Boer, J.D.; Hoogendijk, A.J.; de Beer, R.; de Vos, A.; Belzer, C.; et al. The gut microbiota plays a protective role in the host defence against pneumococcal pneumonia. Gut 2016, 65, 575–583. [Google Scholar] [CrossRef] [Green Version]
- Haak, B.W.; Littmann, E.R.; Chaubard, J.-L.; Pickard, A.; Fontana, E.; Adhi, F.; Gyaltshen, Y.; Ling, L.; Morjaria, S.M.; Peled, J.; et al. Impact of gut colonization with butyrate producing microbiota on respiratory viral infection following allo-HCT. Blood 2018, 131, 2978–2986. [Google Scholar] [CrossRef] [Green Version]
- Coppola, S.; Avagliano, C.; Calignano, A.; Canani, R.B. The Protective Role of Butyrate against Obesity and Obesity-Related Diseases. Molecules 2021, 26, 682. [Google Scholar] [CrossRef]
- Berni Canani, R.; Di Costanzo, M.; Leone, L.; Pedata, M.; Meli, R.; Calignano, A. Potential beneficial effects of butyrate in intestinal and extraintestinal diseases. World J. Gastroenterol. 2011, 17, 1519–1528. [Google Scholar] [CrossRef]
- Russo, R.; Santarcangelo, C.; Badolati, N.; Sommella, E.; De Filippis, A.; Dacrema, M.; Campiglia, P.; Stornaiuolo, M.; Daglia, M. In vivo bioavailability and in vitro toxicological evaluation of the new butyric acid releaser N-(1-carbamoyl-2-phenyl-ethyl) butyramide. Biomed. Pharmacother. 2021, 137, 111385. [Google Scholar] [CrossRef]
- Wei, J.; Alfajaro, M.M.; Hanna, R.E.; DeWeirdt, P.C.; Strine, M.S.; Lu-Culligan, W.J.; Zhang, S.-M.; Graziano, V.R.; Schmitz, C.O.; Chen, J.S.; et al. Genome-wide CRISPR screen reveals host genes that regulate SARS-CoV-2 infection. bioRxiv 2020. [Google Scholar] [CrossRef]
- Stoy, N. Involvement of Interleukin-1 Receptor-Associated Kinase 4 and Interferon Regulatory Factor 5 in the Immunopathogenesis of SARS-CoV-2 Infection: Implications for the Treatment of COVID-19. Front. Immunol. 2021, 12, 638446. [Google Scholar] [CrossRef]
- Martin, T.R.; Wurfel, M.M.; Zanoni, I.; Ulevitch, R. Targeting innate immunity by blocking CD14: Novel approach to control inflammation and organ dysfunction in COVID-19 illness. EBioMedicine 2020, 57, 102836. [Google Scholar] [CrossRef]
- Conte, C. Possible Link between SARS-CoV-2 Infection and Parkinson’s Disease: The Role of Toll-Like Receptor 4. Int. J. Mol. Sci. 2021, 22, 7135. [Google Scholar] [CrossRef]
- Neurath, M.F.; Becker, C.; Barbulescu, K. Role of NF-κB in immune and inflammatory responses in the gut. Gut 1998, 43, 856–860. [Google Scholar] [CrossRef]
- Palau, V.; Riera, M.; Soler, M.J. ADAM17 inhibition may exert a protective effect on COVID-19. Nephrol. Dial. Transpl. 2020, 35, 1071–1072. [Google Scholar] [CrossRef] [PubMed]
- Liu, N.; Tang, B.; Wei, P.; Sun, W.; Wang, S.; Peng, Q. TRAF6-mediated degradation of DOK3 is required for production of IL-6 and TNFα in TLR9 signaling. Mol. Immunol. 2015, 68, 699–705. [Google Scholar] [CrossRef] [PubMed]
- Blanco-Melo, D.; Nilsson-Payant, B.E.; Liu, W.-C.; Uhl, S.; Hoagland, D.; Møller, R.; Jordan, T.X.; Oishi, K.; Panis, M.; Sachs, D.; et al. Imbalanced Host Response to SARS-CoV-2 Drives Development of COVID-19. Cell 2020, 181, 1036–1045.e9. [Google Scholar] [CrossRef] [PubMed]
- Coperchini, F.; Chiovato, L.; Croce, L.; Magri, F.; Rotondi, M. The cytokine storm in COVID-19: An overview of the involvement of the chemokine/chemokine-receptor system. Cytokine Growth Factor Rev. 2020, 53, 25–32. [Google Scholar] [CrossRef] [PubMed]
- Fung, T.S.; Liao, Y.; Liu, D.X. Regulation of Stress Responses and Translational Control by Coronavirus. Viruses 2016, 8, 184. [Google Scholar] [CrossRef] [PubMed]
- Yu, M.; Li, H.; Liu, Q.; Liu, F.; Tang, L.; Li, C.; Yuan, Y.; Zhan, Y.; Xu, W.; Li, W.; et al. Nuclear factor p65 interacts with Keap1 to repress the Nrf2-ARE pathway. Cell. Signal. 2011, 23, 883–892. [Google Scholar] [CrossRef] [PubMed]
- Neufeldt, C.J.; Cerikan, B.; Cortese, M.; Frankish, J.; Lee, J.Y.; Plociennikowska, A.; Heigwer, F.; Joecks, S.; Burkart, S.S.; Zander, D.Y.; et al. SARS-CoV-2 infection induces a pro-inflammatory cytokine response through cGAS-STING and NF-κB. bioRxiv 2020. [Google Scholar] [CrossRef] [PubMed]
- Cholankeril, G.; Podboy, A.; Aivaliotis, V.I.; Tarlow, B.; Pham, E.A.; Spencer, S.P.; Kim, D.; Hsing, A.; Ahmed, A. High Prevalence of Concurrent Gastrointestinal Manifestations in Patients With Severe Acute Respiratory Syndrome Coronavirus 2: Early Experience From California. Gastroenterology 2020, 159, 775–777. [Google Scholar] [CrossRef] [PubMed]
- Trompette, A.; Gollwitzer, E.S.; Pattaroni, C.; Lopez-Mejia, I.C.; Riva, E.; Pernot, J.; Ubags, N.; Fajas, L.; Nicod, L.P.; Marsland, B.J. Dietary fiber confers protection against flu by shaping Ly6c–patrolling monocyte hema topoiesis and CD8+ T cell metabolism. Immunity 2018, 48, 992–1005. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lu, W.; Fang, Z.; Liu, X.; Li, L.; Zhang, P.; Zhao, J.; Zhang, H.; Chen, W. The Potential Role of Probiotics in Protection against Influenza a Virus Infection in Mice. Foods 2021, 10, 902. [Google Scholar] [CrossRef]
- Raso, G.M.; Simeoli, R.; Russo, R.; Iacono, A.; Santoro, A.; Paciello, O.; Ferrante, M.C.; Canani, R.B.; Calignano, A.; Meli, R. Effects of Sodium Butyrate and Its Synthetic Amide Derivative on Liver Inflammation and Glucose Tolerance in an Animal Model of Steatosis Induced by High Fat Diet. PLoS ONE 2013, 8, e68626. [Google Scholar] [CrossRef] [Green Version]
- SSimeoli, R.; Raso, G.M.; Pirozzi, C.; Lama, A.; Santoro, A.; Russo, R.; Montero-Melendez, T.; Canani, R.B.; Calignano, A.; Perretti, M.; et al. An orally administered butyrate-releasing derivative reduces neutrophil recruitment and inflammation in dextran sulphate sodium-induced murine colitis. J. Cereb. Blood Flow Metab. 2017, 174, 1484–1496. [Google Scholar] [CrossRef] [Green Version]
- Li, J.; Richards, E.M.; Handberg, E.M.; Pepine, C.J.; Raizada, M.K. Butyrate Regulates COVID-19–Relevant Genes in Gut Epithelial Organoids from Normotensive Rats. Hypertension 2021, 77, e13–e16. [Google Scholar] [CrossRef]
- Elce, A.; Amato, F.; Zarrilli, F.; Calignano, A.; Troncone, R.; Castaldo, G.; Canani, R.B. Butyrate modulating effects on pro-inflammatory pathways in human intestinal epithelial cells. Benef. Microbes. 2017, 8, 841–847. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Huang, Y.; Yang, C.; Xu, X.-F.; Xu, W.; Liu, S.-W. Structural and functional properties of SARS-CoV-2 spike protein: Potential antivirus drug development for COVID-19. Acta Pharmacol. Sin. 2020, 41, 1141–1149. [Google Scholar] [CrossRef] [PubMed]
- Archer, D.L.; Kramer, D.C. The Use of Microbial Accessible and Fermentable Carbohydrates and/or Butyrate as Supportive Treatment for Patients with Coronavirus SARS-CoV-2 Infection. Front. Med. 2020, 7, 292. [Google Scholar] [CrossRef] [PubMed]
- Qian, G.; Zhang, Y.; Xu, Y.; Hu, W.; Hall, I.P.; Yue, J.; Lu, H.; Ruan, L.; Ye, M.; Mei, J. Reduced inflammatory responses to SARS-CoV-2 infection in children presenting to hospital with COVID-19 in China. EClinicalMedicine 2021, 34, 100831. [Google Scholar] [CrossRef]
- Jørgensen, M.J.; Holter, J.C.; Christensen, E.E.; Schjalm, C.; Tonby, K.; Pischke, S.E.; Jenum, S.; Skeie, L.G.; Nur, S.; Lind, A.; et al. Increased interleukin-6 and macrophage chemoattractant protein-1 are associated with respiratory failure in COVID-19. Sci. Rep. 2020, 10, 21697. [Google Scholar] [CrossRef]
- Tay, M.Z.; Poh, C.M.; Rénia, L.; Macary, P.A.; Ng, L.F.P. The trinity of COVID-19: Immunity, inflammation and intervention. Nat. Rev. Immunol. 2020, 20, 363–374. [Google Scholar] [CrossRef]
- Del Valle, D.M.; Kim-Schulze, S.; Huang, H.-H.; Beckmann, N.D.; Nirenberg, S.; Wang, B.; Lavin, Y.; Swartz, T.H.; Madduri, D.; Stock, A.; et al. An inflammatory cytokine signature predicts COVID-19 severity and survival. Nat. Med. 2020, 26, 1636–1643. [Google Scholar] [CrossRef]
- Mahil, S.K.; Dand, N.; Mason, K.J.; Yiu, Z.Z.; Tsakok, T.; Meynell, F.; Coker, B.; McAteer, H.; Moorhead, L.; Mackenzie, T.; et al. Factors associated with adverse COVID-19 outcomes in patients with psoriasis—Insights from a global registry–based study. J. Allergy Clin. Immunol. 2021, 147, 60–71. [Google Scholar] [CrossRef]
- Feldmann, M.; Maini, R.N.; Woody, J.N.; Holgate, S.T.; Winter, G.; Rowland, M.; Richards, D.; Hussell, T. Trials of anti-tumour necrosis factor therapy for COVID-19 are urgently needed. Lancet 2020, 395, 1407–1409. [Google Scholar] [CrossRef]
- Brenner, E.J.; Ungaro, R.C.; Gearry, R.B.; Kaplan, G.G.; Kissous-Hunt, M.; Lewis, J.D.; Ng, S.C.; Rahier, J.-F.; Reinisch, W.; Ruemmele, F.M.; et al. Corticosteroids, But Not TNF Antagonists, Are Associated With Adverse COVID-19 Outcomes in Patients With Inflammatory Bowel Diseases: Results From an International Registry. Gastroenterology 2020, 159, 481–491.e3. [Google Scholar] [CrossRef]
- Kircheis, R.; Haasbach, E.; Lueftenegger, D.; Heyken, W.T.; Ocker, M.; Planz, O. NF-κB Pathway as a Potential Target for Treatment of Critical Stage COVID-19 Patients. Front. Immunol. 2020, 11, 598444. [Google Scholar] [CrossRef] [PubMed]
- Wardyn, J.D.; Ponsford, A.H.; Sanderson, C.M. Dissecting molecular cross-talk between Nrf2 and NF-κB response pathways. Biochem. Soc. Trans. 2015, 43, 621–626. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Soares, M.P.; Ribeiro, A.M. Nrf2 as a master regulator of tissue damage control and disease tolerance to infection. Biochem. Soc. Trans. 2015, 43, 663–668. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cuadrado, A.; Martín-Moldes, Z.; Ye, J.; Lastres-Becker, I. Transcription Factors NRF2 and NF-κB Are Coordinated Effectors of the Rho Family, GTP-binding Protein RAC1 during Inflammation. J. Biol. Chem. 2014, 289, 15244–15258. [Google Scholar] [CrossRef] [Green Version]
- Olagnier, D.; Farahani, E.; Thyrsted, J.; Blay-Cadanet, J.; Herengt, A.; Idorn, M.; Hait, A.; Hernaez, B.; Knudsen, A.; Iversen, M.B.; et al. SARS-CoV2-mediated suppression of NRF2-signaling reveals potent antiviral and anti-inflammatory activity of 4-octyl-itaconate and dimethyl fumarate. Nat. Commun. 2020, 11, 4938. [Google Scholar] [CrossRef]
- Yan, M.; Dong, Y.; Bo, X.; Cheng, Y.; Cheng, J. Large Screening Identifies ACE2 Positively Correlates With NF-κB Signaling Activity and Targeting NF-κB Signaling Drugs Suppress ACE2 Levels. Front. Pharmacol. 2021, 12, 771555. [Google Scholar] [CrossRef]
- Shuai, H.; Chu, H.; Hou, Y.; Yang, D.; Wang, Y.; Hu, B.; Huang, X.; Zhang, X.; Chai, Y.; Cai, J.P.; et al. Differential immune activation profile of SARS-CoV-2 and SARS-CoV infection in human lung and intestinal cells: Implications for treatment with IFN-β and IFN inducer. J. Infect. 2020, 81, e1–e10. [Google Scholar] [CrossRef]
- Chu, H.; Chan, J.F.; Yuen, T.T.; Shuai, H.; Yuan, S.; Wang, Y.; Hu, B.; Yip, C.C.; Tsang, J.O.; Huang, X.; et al. Comparative tropism, replication kinetics, and cell damage profiling of SARS-CoV-2 and SARS-CoV with implications for clinical manifestations, transmissibility, and laboratory studies of COVID-19: An observational study. Lancet Microbe 2020, 1, e14–e23. [Google Scholar] [CrossRef]
- Vitale, S.; Strisciuglio, C.; Pisapia, L.; Miele, E.; Barba, P.; Vitale, A.; Cenni, S.; Bassi, V.; Maglio, M.; Del Pozzo, G.; et al. Cytokine production profile in intestinal mucosa of paediatric inflammatory bowel disease. PLoS ONE 2017, 12, e0182313. [Google Scholar] [CrossRef]
Gene | Primer | Primer Sequence |
---|---|---|
IL-6 | Forward | CTCGACGGCATCTCAGCC |
Reverse | GCCTCTTTGCTGCTTTCACAC | |
IL-15 | Forward | CAGTTGCAAAGTAACAGCAATGAA |
Reverse | GCATCTCCGGACTCAAGTGAA | |
IL-1β | Forward | CTTTGAAGCTGATGGCCCTAA |
Reverse | CGCCATCCAGAGGGCAG | |
VEGFβ | Forward | AGAAGGAGGAGGGCAGAATCA |
Reverse | GATGGCAGTAGCTGCGCTG | |
TNF-α | Forward | CTTCTGCCTGCTGCACTTTG |
Reverse | TGATTAGAGAGAGGTCCCTGGG | |
MCP1 | Forward | CTATAGAAGAATCACCAGCAGCAGCAAGT |
Reverse | TCTCCTTGGCCACAATGGTC | |
CXCL1 | Forward | GCGCCCAAACCGAAGTCATA |
Reverse | ATGGGGGATGCAGGATTGAG |
Sample ID | Analysis ID | Total Reads (M) | Read Length | Q20 (%) | Q30 (%) | Overall Mapping Rate (%) | Paired Mapping Rate (%) |
---|---|---|---|---|---|---|---|
NT1 | NT_0 | 86.24 | 150 | 97.6 | 93.5 | 92.5 | 88.0 |
NT2 | NT_1 | 85.33 | 150 | 97.7 | 93.7 | 92.6 | 88.1 |
NT3 | NT_2 | 90.58 | 150 | 97.5 | 93.4 | 92.5 | 88.1 |
FBA1_2 mM | FBA_1_0 | 90.10 | 150 | 97.7 | 93.7 | 92.5 | 87.9 |
FBA2_2 mM | FBA_1_1 | 79.95 | 150 | 97.7 | 93.8 | 92.3 | 87.7 |
FBA3_2 mM | FBA_1_2 | 82.92 | 150 | 97.8 | 93.9 | 92.7 | 88.2 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Paparo, L.; Maglio, M.A.; Cortese, M.; Bruno, C.; Capasso, M.; Punzo, E.; Ferrucci, V.; Lasorsa, V.A.; Viscardi, M.; Fusco, G.; et al. A New Butyrate Releaser Exerts a Protective Action against SARS-CoV-2 Infection in Human Intestine. Molecules 2022, 27, 862. https://doi.org/10.3390/molecules27030862
Paparo L, Maglio MA, Cortese M, Bruno C, Capasso M, Punzo E, Ferrucci V, Lasorsa VA, Viscardi M, Fusco G, et al. A New Butyrate Releaser Exerts a Protective Action against SARS-CoV-2 Infection in Human Intestine. Molecules. 2022; 27(3):862. https://doi.org/10.3390/molecules27030862
Chicago/Turabian StylePaparo, Lorella, Maria Antonia Maglio, Maddalena Cortese, Cristina Bruno, Mario Capasso, Erika Punzo, Veronica Ferrucci, Vito Alessandro Lasorsa, Maurizio Viscardi, Giovanna Fusco, and et al. 2022. "A New Butyrate Releaser Exerts a Protective Action against SARS-CoV-2 Infection in Human Intestine" Molecules 27, no. 3: 862. https://doi.org/10.3390/molecules27030862