Exogenous Glutathione Protects IPEC-J2 Cells against Oxidative Stress through a Mitochondrial Mechanism
Abstract
:1. Introduction
2. Methods
2.1. Cell Culture
2.2. Reagents
2.3. CCK-8 Cell Proliferation Assay
2.4. Cell Migration Assay
2.5. Measurement of Mitochondrial Membrane Potential (MMP)
2.6. RNA Isolation and Quantitative Real-Time PCR (qPCR)
2.7. DNA Extraction and Quantification of mtDNA Copy Number
2.8. Reactive Oxygen Species (ROS) Detection
2.9. Evaluation of Malondialdehyde (MDA) and Superoxide Dismutase (SOD) Levels
2.10. Cell Apoptosis Assay
2.11. Statistical Analysis
3. Results
3.1. Exogenous GSH Improves IPEC-J2 Viability after HO Exposure
3.2. Exogenous GSH Attenuated HO-Inhibited Migration of IPEC-J2 Cells
3.3. Exogenous GSH Rescues the HO-Impaired Mitochondrial Function
3.4. GSH Reduces HO-Induced ROS and Oxidative Stress
3.5. Exogenous GSH Reduces HO-Induced Cell Apoptosis
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Circu, M.L.; Aw, T.Y. Redox biology of the intestine. Free. Radic. Res. 2011, 45, 1245–1266. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lambert, G. Stress-induced gastrointestinal barrier dysfunction and its inflammatory effects. J. Anim. Sci. 2009, 87, E101–E108. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peterson, L.W.; Artis, D. Intestinal epithelial cells: Regulators of barrier function and immune homeostasis. Nat. Rev. Immunol. 2014, 14, 141–153. [Google Scholar] [CrossRef] [PubMed]
- Aviello, G.; Knaus, U. ROS in gastrointestinal inflammation: Rescue or sabotage? Br. J. Pharmacol. 2017, 174, 1704–1718. [Google Scholar] [CrossRef] [Green Version]
- Wellman, A.S.; Metukuri, M.R.; Kazgan, N.; Xu, X.; Xu, Q.; Ren, N.S.; Czopik, A.; Shanahan, M.T.; Kang, A.; Chen, W.; et al. Intestinal epithelial sirtuin 1 regulates intestinal inflammation during aging in mice by altering the intestinal microbiota. Gastroenterology 2017, 153, 772–786. [Google Scholar] [CrossRef]
- Oswald, I.P. Role of intestinal epithelial cells in the innate immune defence of the pig intestine. Vet. Res. 2006, 37, 359–368. [Google Scholar] [CrossRef] [Green Version]
- Bhattacharyya, A.; Chattopadhyay, R.; Mitra, S.; Crowe, S.E. Oxidative stress: An essential factor in the pathogenesis of gastrointestinal mucosal diseases. Physiol. Rev. 2014, 94, 329–354. [Google Scholar] [CrossRef] [Green Version]
- Rebelo, A.P.; Williams, S.L.; Moraes, C.T. In vivo methylation of mtDNA reveals the dynamics of protein-mtDNA interactions. Nucleic Acids Res. 2009, 37, 6701–6715. [Google Scholar] [CrossRef] [Green Version]
- West, A.P.; Shadel, G.S. Mitochondrial DNA in innate immune responses and inflammatory pathology. Nat. Rev. Immunol. 2017, 17, 363–375. [Google Scholar] [CrossRef]
- Iizuka, M.; Konno, S. Wound healing of intestinal epithelial cells. World J. Gastroenterol. WJG 2011, 17, 2161. [Google Scholar] [CrossRef]
- Rath, E.; Moschetta, A.; Haller, D. Mitochondrial function—Gatekeeper of intestinal epithelial cell homeostasis. Nat. Rev. Gastroenterol. Hepatol. 2018, 15, 497–516. [Google Scholar] [CrossRef]
- Suomalainen, A.; Battersby, B.J. Mitochondrial diseases: The contribution of organelle stress responses to pathology. Nat. Rev. Mol. Cell Biol. 2018, 19, 77–92. [Google Scholar] [CrossRef]
- Peluso, I.; Campolongo, P.; Valeri, P.; Romanelli, L.; Palmery, M. Intestinal motility disorder induced by free radicals: A new model mimicking oxidative stress in gut. Pharmacol. Res. 2002, 46, 533–538. [Google Scholar] [CrossRef]
- Tsai, K.L.; Hung, C.H.; Chan, S.H.; Hsieh, P.L.; Ou, H.C.; Cheng, Y.H.; Chu, P.M. Chlorogenic acid protects against oxLDL-induced oxidative damage and mitochondrial dysfunction by modulating SIRT1 in endothelial cells. Mol. Nutr. Food Res. 2018, 62, 1700928. [Google Scholar] [CrossRef]
- Addabbo, F.; Montagnani, M.; Goligorsky, M.S. Mitochondria and reactive oxygen species. Hypertension 2009, 53, 885–892. [Google Scholar] [CrossRef] [Green Version]
- Oyewole, A.O.; Birch-Machin, M.A. Mitochondria-targeted antioxidants. FASEB J. 2015, 29, 4766–4771. [Google Scholar] [CrossRef] [Green Version]
- Annesley, S.J.; Fisher, P.R. Mitochondria in health and disease. Cells 2019, 8, 680. [Google Scholar] [CrossRef] [Green Version]
- Foote, K.; Reinhold, J.; Yu, E.P.; Figg, N.L.; Finigan, A.; Murphy, M.P.; Bennett, M.R. Restoring mitochondrial DNA copy number preserves mitochondrial function and delays vascular aging in mice. Aging Cell 2018, 17, e12773. [Google Scholar] [CrossRef]
- Kang, E.; Wang, X.; Tippner-Hedges, R.; Ma, H.; Folmes, C.D.; Gutierrez, N.M.; Lee, Y.; Van Dyken, C.; Ahmed, R.; Li, Y.; et al. Age-related accumulation of somatic mitochondrial DNA mutations in adult-derived human iPSCs. Cell Stem Cell 2016, 18, 625–636. [Google Scholar] [CrossRef]
- Bagul, P.K.; Katare, P.B.; Bugga, P.; Dinda, A.K.; Banerjee, S.K. SIRT-3 modulation by resveratrol improves mitochondrial oxidative phosphorylation in diabetic heart through deacetylation of TFAM. Cells 2018, 7, 235. [Google Scholar] [CrossRef] [Green Version]
- Lu, S.C. Regulation of glutathione synthesis. Mol. Asp. Med. 2009, 30, 42–59. [Google Scholar] [CrossRef] [Green Version]
- Traverso, N.; Ricciarelli, R.; Nitti, M.; Marengo, B.; Furfaro, A.L.; Pronzato, M.A.; Marinari, U.M.; Domenicotti, C. Role of glutathione in cancer progression and chemoresistance. Oxidative Med. Cell. Longev. 2013, 2013, 972913. [Google Scholar] [CrossRef] [Green Version]
- Godoy, J.R.; Funke, M.; Ackermann, W.; Haunhorst, P.; Oesteritz, S.; Capani, F.; Elsässer, H.P.; Lillig, C.H. Redox atlas of the mouse: Immunohistochemical detection of glutaredoxin-, peroxiredoxin-, and thioredoxin-family proteins in various tissues of the laboratory mouse. Biochim. Biophys. Acta-(BBA)-Gen. Subj. 2011, 1810, 2–92. [Google Scholar] [CrossRef]
- Hoensch, H.; Peters, W.; Roelofs, H.; Kirch, W. Expression of the glutathione enzyme system of human colon mucosa by localisation, gender and age. Curr. Med Res. Opin. 2006, 22, 1075–1083. [Google Scholar] [CrossRef]
- Quintana-Cabrera, R.; Bolaños, J.P. Glutathione and γ-glutamylcysteine in the antioxidant and survival functions of mitochondria. Biochem. Soc. Trans. 2013, 41, 106–110. [Google Scholar] [CrossRef] [Green Version]
- Reznik, E.; Miller, M.L.; Şenbabaoğlu, Y.; Riaz, N.; Sarungbam, J.; Tickoo, S.K.; Al-Ahmadie, H.A.; Lee, W.; Seshan, V.E.; Hakimi, A.A.; et al. Mitochondrial DNA copy number variation across human cancers. eLife 2016, 5, e10769. [Google Scholar] [CrossRef]
- Backos, D.S.; Franklin, C.C.; Reigan, P. The role of glutathione in brain tumor drug resistance. Biochem. Pharmacol. 2012, 83, 1005–1012. [Google Scholar] [CrossRef]
- Jiang, W.W.; Masayesva, B.; Zahurak, M.; Carvalho, A.L.; Rosenbaum, E.; Mambo, E.; Zhou, S.; Minhas, K.; Benoit, N.; Westra, W.H.; et al. Increased mitochondrial DNA content in saliva associated with head and neck cancer. Clin. Cancer Res. 2005, 11, 2486–2491. [Google Scholar] [CrossRef] [Green Version]
- Couto, N.; Wood, J.; Barber, J. The role of glutathione reductase and related enzymes on cellular redox homoeostasis network. Free Radic. Biol. Med. 2016, 95, 27–42. [Google Scholar] [CrossRef]
- Liu, B.; Du, Q.; Chen, L.; Fu, G.; Li, S.; Fu, L.; Zhang, X.; Ma, C.; Bin, C. CpG methylation patterns of human mitochondrial DNA. Sci. Rep. 2016, 6, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Jiménez-Moreno, N.; Cimminelli, M.J.; Volpe, F.; Ansó, R.; Esparza, I.; Mármol, I.; Rodríguez-Yoldi, M.J.; Ancín-Azpilicueta, C. Phenolic composition of artichoke waste and its antioxidant capacity on differentiated Caco-2 cells. Nutrients 2019, 11, 1723. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, 1–12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xie, Y.; Jin, L.; Chen, X.; He, M.; Wang, Y.; Liu, R.; Li, M.; Li, X. Quantitative changes in mitochondrial DNA copy number in various tissues of pigs during growth. Genet. Mol. Res. 2015, 14, 1662–1670. [Google Scholar] [CrossRef] [PubMed]
- Sukhotnik, I.; Agam, M.; Shamir, R.; Shehadeh, N.; Lurie, M.; Coran, A.G.; Shiloni, E.; Mogilner, J. Oral glutamine prevents gut mucosal injury and improves mucosal recovery following lipopolysaccharide endotoxemia in a rat. J. Surg. Res. 2007, 143, 379–384. [Google Scholar] [CrossRef]
- Grada, A.; Otero-Vinas, M.; Prieto-Castrillo, F.; Obagi, Z.; Falanga, V. Research techniques made simple: Analysis of collective cell migration using the wound healing assay. J. Investig. Dermatol. 2017, 137, e11–e16. [Google Scholar] [CrossRef] [Green Version]
- Quan, Y.; Xin, Y.; Tian, G.; Zhou, J.; Liu, X. Mitochondrial ROS-modulated mtDNA: A potential target for cardiac aging. Oxidative Med. Cell. Longev. 2020, 2020, 9423593. [Google Scholar] [CrossRef] [Green Version]
- Gleyzer, N.; Vercauteren, K.; Scarpulla, R.C. Control of mitochondrial transcription specificity factors (TFB1M and TFB2M) by nuclear respiratory factors (NRF-1 and NRF-2) and PGC-1 family coactivators. Mol. Cell. Biol. 2005, 25, 1354–1366. [Google Scholar] [CrossRef] [Green Version]
- Schieber, M.; Chandel, N.S. ROS function in redox signaling and oxidative stress. Curr. Biol. 2014, 24, R453–R462. [Google Scholar] [CrossRef] [Green Version]
- Bao, D.; Wang, J.; Pang, X.; Liu, H. Protective effect of quercetin against oxidative stress-induced cytotoxicity in rat pheochromocytoma (PC-12) cells. Molecules 2017, 22, 1122. [Google Scholar] [CrossRef]
Gene | Sequence (5’ to -3’) |
---|---|
ND1 | GACTAAACCAAACCCAACT GGGATAGGGATAAAGTTGT |
GCG | GAATCAACACCATCGGTCAAAT CTCCACCCATAGAATGCCCAGT |
TFAM | GACTACTGCGTCTGCACCTT GCAACTCTTCAGACCTCGCT |
TFB1M | CCGTTGCCCACAATTCGAGA TCAACCACCAGAAGTTCAGCA |
TFB2M | TCCTGCATACGGAGCCTTG AATGGTCTACCAGCATGGCG |
B2M | TATCTGGGTTCCATCCG AACTATCTTGGGCTTATCG |
HPRT1 | ATCATTATGCCGAGGATTTGGA CCTCCCATCTCTTTCATCACATCT |
RPL4 | GCTCTATGGCACTTGGCGT GCGGAGGGCTCTTTGGAT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Q.; Yu, M.; Tian, Z.; Cui, Y.; Deng, D.; Rong, T.; Liu, Z.; Song, M.; Li, Z.; Ma, X.; et al. Exogenous Glutathione Protects IPEC-J2 Cells against Oxidative Stress through a Mitochondrial Mechanism. Molecules 2022, 27, 2416. https://doi.org/10.3390/molecules27082416
Chen Q, Yu M, Tian Z, Cui Y, Deng D, Rong T, Liu Z, Song M, Li Z, Ma X, et al. Exogenous Glutathione Protects IPEC-J2 Cells against Oxidative Stress through a Mitochondrial Mechanism. Molecules. 2022; 27(8):2416. https://doi.org/10.3390/molecules27082416
Chicago/Turabian StyleChen, Qiuyu, Miao Yu, Zhimei Tian, Yiyan Cui, Dun Deng, Ting Rong, Zhichang Liu, Min Song, Zhenming Li, Xianyong Ma, and et al. 2022. "Exogenous Glutathione Protects IPEC-J2 Cells against Oxidative Stress through a Mitochondrial Mechanism" Molecules 27, no. 8: 2416. https://doi.org/10.3390/molecules27082416