Erythropoietin Modulates Autophagy Signaling in the Developing Rat Brain in an In Vivo Model of Oxygen-Toxicity
Abstract
:1. Introduction
2. Results and Discussion
2.1. Results
2.1.1. Erythropoietin Ameliorates Hyperoxia-Induced Changes of Beclin-1
2.1.2. Intervention with rhEpo Modifies Oxygen Triggered Alterations of Autophagy-Related Components
2.1.3. Erythropoietin Restores Hyperoxia-Mediated Changes of LC3A-II and LC3B-II in the Developing Brain
2.2. Discussion
3. Experimental Section
3.1. Animals and Experimental Procedure
3.1.1. Exposure to Hyperoxia
3.1.2. Treatment Protocols
3.2. Tissue Sampling
3.3. Semiquantitative Real-Time PCR
3.4. Immunoblotting
3.5. Statistical Analysis
4. Conclusions
Acknowledgments
References
- West, R.J.; Sweeney, S.T. Oxidative stress and autophagy: Mediators of synapse growth? Autophagy 2012, 8, 284–285. [Google Scholar]
- Eskelinen, E.L.; Saftig, P. Autophagy: A lysosomal degradation pathway with a central role in health and disease. Biochim. Biophys. Acta 2009, 1793, 664–673. [Google Scholar]
- He, C.; Klionsky, D.J. Regulation mechanisms and signaling pathways of autophagy. Annu. Rev. Genet 2009, 43, 67–93. [Google Scholar]
- Mizushima, N.; Levine, B.; Cuervo, A.M.; Klionsky, D.J. Autophagy fights disease through cellular self-digestion. Nature 2008, 451, 1069–1075. [Google Scholar]
- Chen, Y.; Klionsky, D.J. The regulation of autophagy—Unanswered questions. J. Cell Sci 2011, 124, 161–170. [Google Scholar]
- Lee, J.; Giordano, S.; Zhang, J. Autophagy, mitochondria and oxidative stress: Cross-talk and redox signalling. Biochem. J 2012, 441, 523–540. [Google Scholar]
- Baek, K.H.; Park, J.; Shin, I. Autophagy-regulating small molecules and their therapeutic applications. Chem. Soc. Rev 2012, 41, 3245–3263. [Google Scholar]
- Oberstein, A.; Jeffrey, P.D.; Shi, Y. Crystal structure of the Bcl-XL-Beclin 1 peptide complex: Beclin 1 is a novel BH3-only protein. J. Biol. Chem 2007, 282, 13123–13132. [Google Scholar]
- Kang, R.; Zeh, H.J.; Lotze, M.T.; Tang, D. The Beclin 1 network regulates autophagy and apoptosis. Cell Death Differ 2011, 18, 571–580. [Google Scholar]
- Li, B.X.; Li, C.Y.; Peng, R.Q.; Wu, X.J.; Wang, H.Y.; Wan, D.S.; Zhu, X.F.; Zhang, X.S. The expression of beclin 1 is associated with favorable prognosis in stage IIIB colon cancers. Autophagy 2009, 5, 303–306. [Google Scholar]
- He, C.; Levine, B. The Beclin 1 interactome. Curr. Opin. Cell Biol 2010, 22, 140–149. [Google Scholar]
- Itakura, E.; Mizushima, N. Characterization of autophagosome formation site by a hierarchical analysis of mammalian Atg proteins. Autophagy 2010, 6, 764–776. [Google Scholar]
- Hara, T.; Nakamura, K.; Matsui, M.; Yamamoto, A.; Nakahara, Y.; Suzuki-Migishima, R.; Yokoyama, M.; Mishima, K.; Saito, I.; Okano, H.; et al. Suppression of basal autophagy in neural cells causes neurodegenerative disease in mice. Nature 2006, 441, 885–889. [Google Scholar]
- Komatsu, M.; Waguri, S.; Chiba, T.; Murata, S.; Iwata, J.; Tanida, I.; Ueno, T.; Koike, M.; Uchiyama, Y.; Kominami, E.; et al. Loss of autophagy in the central nervous system causes neurodegeneration in mice. Nature 2006, 441, 880–884. [Google Scholar]
- Komatsu, M.; Waguri, S.; Koike, M.; Sou, Y.S.; Ueno, T.; Hara, T.; Mizushima, N.; Iwata, J.; Ezaki, J.; Murata, S.; et al. Homeostatic levels of p62 control cytoplasmic inclusion body formation in autophagy-deficient mice. Cell 2007, 131, 1149–1163. [Google Scholar]
- Geng, J.; Klionsky, D.J. The Atg8 and Atg12 ubiquitin-like conjugation systems in macroautophagy. ‘Protein modifications: Beyond the usual suspects’ review series. EMBO Rep 2008, 9, 859–864. [Google Scholar]
- Kabeya, Y.; Mizushima, N.; Ueno, T.; Yamamoto, A.; Kirisako, T.; Noda, T.; Kominami, E.; Ohsumi, Y.; Yoshimori, T. LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. EMBO J 2000, 19, 5720–5728. [Google Scholar]
- Tanida, I.; Ueno, T.; Kominami, E. LC3 conjugation system in mammalian autophagy. Int. J. Biochem. Cell Biol 2004, 36, 2503–2518. [Google Scholar]
- Azad, M.B.; Chen, Y.; Gibson, S.B. Regulation of autophagy by reactive oxygen species (ROS): Implications for cancer progression and treatment. Antioxid. Redox Signal 2009, 11, 777–790. [Google Scholar]
- Scherz-Shouval, R.; Shvets, E.; Fass, E.; Shorer, H.; Gil, L.; Elazar, Z. Reactive oxygen species are essential for autophagy and specifically regulate the activity of Atg4. EMBO J 2007, 26, 1749–1760. [Google Scholar]
- Metcalf, D.J.; Garcia-Arencibia, M.; Hochfeld, W.E.; Rubinsztein, D.C. Autophagy and misfolded proteins in neurodegeneration. Exp. Neurol 2012, 238, 222–228. [Google Scholar]
- Rubinsztein, D.C.; DiFiglia, M.; Heintz, N.; Nixon, R.A.; Qin, Z.H.; Ravikumar, B.; Stefanis, L.; Tolkovsky, A. Autophagy and its possible roles in nervous system diseases, damage and repair. Autophagy 2005, 1, 11–22. [Google Scholar]
- Schaeffer, V.; Lavenir, I.; Ozcelik, S.; Tolnay, M.; Winkler, D.T.; Goedert, M. Stimulation of autophagy reduces neurodegeneration in a mouse model of human tauopathy. Brain 2012, 135, 2169–2177. [Google Scholar]
- Clarke, P.G. Developmental cell death: Morphological diversity and multiple mechanisms. Anat. Embryol. (Berl.) 1990, 181, 195–213. [Google Scholar]
- Platini, F.; Perez-Tomas, R.; Ambrosio, S.; Tessitore, L. Understanding autophagy in cell death control. Curr. Pharm. Des 2010, 16, 101–113. [Google Scholar]
- Wen, Y.D.; Sheng, R.; Zhang, L.S.; Han, R.; Zhang, X.; Zhang, X.D.; Han, F.; Fukunaga, K.; Qin, Z.H. Neuronal injury in rat model of permanent focal cerebral ischemia is associated with activation of autophagic and lysosomal pathways. Autophagy 2008, 4, 762–769. [Google Scholar]
- Boya, P.; Gonzalez-Polo, R.A.; Casares, N.; Perfettini, J.L.; Dessen, P.; Larochette, N.; Metivier, D.; Meley, D.; Souquere, S.; Yoshimori, T.; et al. Inhibition of macroautophagy triggers apoptosis. Mol. Cell Biol 2005, 25, 1025–1040. [Google Scholar]
- Maiuri, M.C.; Zalckvar, E.; Kimchi, A.; Kroemer, G. Self-eating and self-killing: Crosstalk between autophagy and apoptosis. Nat. Rev. Mol. Cell Biol 2007, 8, 741–752. [Google Scholar]
- Dzietko, M.; Boos, V.; Sifringer, M.; Polley, O.; Gerstner, B.; Genz, K.; Endesfelder, S.; Borner, C.; Jacotot, E.; Chauvier, D.; et al. A critical role for Fas/CD-95 dependent signaling pathways in the pathogenesis of hyperoxia-induced brain injury. Ann. Neurol 2008, 64, 664–673. [Google Scholar]
- Felderhoff-Mueser, U.; Bittigau, P.; Sifringer, M.; Jarosz, B.; Korobowicz, E.; Mahler, L.; Piening, T.; Moysich, A.; Grune, T.; Thor, F.; et al. Oxygen causes cell death in the developing brain. Neurobiol. Dis 2004, 17, 273–282. [Google Scholar]
- Kaindl, A.M.; Sifringer, M.; Koppelstaetter, A.; Genz, K.; Loeber, R.; Boerner, C.; Stuwe, J.; Klose, J.; Felderhoff-Mueser, U. Erythropoietin protects the developing brain from hyperoxia-induced cell death and proteome changes. Ann. Neurol 2008, 64, 523–534. [Google Scholar]
- Sifringer, M.; Bendix, I.; Borner, C.; Endesfelder, S.; von Haefen, C.; Kalb, A.; Holifanjaniaina, S.; Prager, S.; Schlager, G.W.; Keller, M.; et al. Prevention of neonatal oxygen-induced brain damage by reduction of intrinsic apoptosis. Cell Death Dis 2012, 3, e250. [Google Scholar]
- Dzietko, M.; Felderhoff-Mueser, U.; Sifringer, M.; Krutz, B.; Bittigau, P.; Thor, F.; Heumann, R.; Buhrer, C.; Ikonomidou, C.; Hansen, H.H. Erythropoietin protects the developing brain against N-methyl-D-aspartate receptor antagonist neurotoxicity. Neurobiol. Dis 2004, 15, 177–187. [Google Scholar]
- Liu, W.; Shen, Y.; Plane, J.M.; Pleasure, D.E.; Deng, W. Neuroprotective potential of erythropoietin and its derivative carbamylated erythropoietin in periventricular leukomalacia. Exp. Neurol 2011, 230, 227–239. [Google Scholar]
- Zacharias, R.; Schmidt, M.; Kny, J.; Sifringer, M.; Bercker, S.; Bittigau, P.; Buhrer, C.; Felderhoff-Muser, U.; Kerner, T. Dose-dependent effects of erythropoietin in propofol anesthetized neonatal rats. Brain Res 2010, 1343, 14–19. [Google Scholar]
- Zhao, J.; Li, G.; Zhang, Y.; Su, X.; Hang, C. The potential role of JAK2/STAT3 pathway on the anti-apoptotic effect of recombinant human erythropoietin (rhEPO) after experimental traumatic brain injury of rats. Cytokine 2011, 56, 343–350. [Google Scholar]
- Sifringer, M.; Brait, D.; Weichelt, U.; Zimmerman, G.; Endesfelder, S.; Brehmer, F.; von Haefen, C.; Friedman, A.; Soreq, H.; Bendix, I.; et al. Erythropoietin attenuates hyperoxia-induced oxidative stress in the developing rat brain. Brain Behav. Immun 2010, 24, 792–799. [Google Scholar]
- Sifringer, M.; Genz, K.; Brait, D.; Brehmer, F.; Lober, R.; Weichelt, U.; Kaindl, A.M.; Gerstner, B.; Felderhoff-Mueser, U. Erythropoietin attenuates hyperoxia-induced cell death by modulation of inflammatory mediators and matrix metalloproteinases. Dev. Neurosci 2009, 31, 394–402. [Google Scholar]
- Wyrsch, P.; Blenn, C.; Bader, J.; Althaus, F.R. Cell death and autophagy under oxidative stress: Roles of poly(ADP-ribose)polymerases and Ca2+. Mol. Cell Biol 2012, 32, 3541–3553. [Google Scholar]
- Lee, J.A. Neuronal autophagy: A housekeeper or a fighter in neuronal cell survival? Exp. Neurobiol 2012, 21, 1–8. [Google Scholar]
- Higgins, G.C.; Devenish, R.J.; Beart, P.M.; Nagley, P. Autophagic activity in cortical neurons under acute oxidative stress directly contributes to cell death. Cell. Mol. Life Sci 2011, 68, 3725–3740. [Google Scholar]
- Rodriguez-Blanco, J.; Martin, V.; Garcia-Santos, G.; Herrera, F.; Casado-Zapico, S.; Antolin, I.; Rodriguez, C. Cooperative action of JNK and AKT/mTOR in 1-methyl-4-phenylpyridinium-induced autophagy of neuronal PC12 cells. J. Neurosci. Res 2012, 90, 1850–1860. [Google Scholar]
- Zhang, H.; Kong, X.; Kang, J.; Su, J.; Li, Y.; Zhong, J.; Sun, L. Oxidative stress induces parallel autophagy and mitochondria dysfunction in human glioma U251 cells. Toxicol. Sci 2009, 110, 376–388. [Google Scholar]
- Mitroulis, I.; Kourtzelis, I.; Kambas, K.; Rafail, S.; Chrysanthopoulou, A.; Speletas, M.; Ritis, K. Regulation of the autophagic machinery in human neutrophils. Eur. J. Immunol 2010, 40, 1461–1472. [Google Scholar]
- Tiwari, M.; Lopez-Cruzan, M.; Morgan, W.W.; Herman, B. Loss of caspase-2-dependent apoptosis induces autophagy after mitochondrial oxidative stress in primary cultures of young adult cortical neurons. J. Biol. Chem 2011, 286, 8493–8506. [Google Scholar]
- Schmitz, T.; Endesfelder, S.; Reinert, M.C.; Klinker, F.; Muller, S.; Buhrer, C.; Liebetanz, D. Adolescent hyperactivity and impaired coordination after neonatal hyperoxia. Exp. Neurol 2012, 235, 374–379. [Google Scholar]
- Chipuk, J.E.; Moldoveanu, T.; Llambi, F.; Parsons, M.J.; Green, D.R. The BCL-2 family reunion. Mol. Cell 2010, 37, 299–310. [Google Scholar]
- Wirawan, E.; Vande Walle, L.; Kersse, K.; Cornelis, S.; Claerhout, S.; Vanoverberghe, I.; Roelandt, R.; de Rycke, R.; Verspurten, J.; Declercq, W.; et al. Caspase-mediated cleavage of Beclin-1 inactivates Beclin-1-induced autophagy and enhances apoptosis by promoting the release of proapoptotic factors from mitochondria. Cell Death Dis 2010, 1, e18. [Google Scholar]
- Pickford, F.; Masliah, E.; Britschgi, M.; Lucin, K.; Narasimhan, R.; Jaeger, P.A.; Small, S.; Spencer, B.; Rockenstein, E.; Levine, B.; et al. The autophagy-related protein beclin 1 shows reduced expression in early Alzheimer disease and regulates amyloid beta accumulation in mice. J. Clin. Invest 2008, 118, 2190–2199. [Google Scholar]
- Pattingre, S.; Tassa, A.; Qu, X.; Garuti, R.; Liang, X.H.; Mizushima, N.; Packer, M.; Schneider, M.D.; Levine, B. Bcl-2 antiapoptotic proteins inhibit Beclin 1-dependent autophagy. Cell 2005, 122, 927–939. [Google Scholar]
- Zhu, Y.; Zhao, L.; Liu, L.; Gao, P.; Tian, W.; Wang, X.; Jin, H.; Xu, H.; Chen, Q. Beclin 1 cleavage by caspase-3 inactivates autophagy and promotes apoptosis. Protein Cell 2010, 1, 468–477. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar]
Gene | Oligonucleotide sequences 5′-3′ | ||
---|---|---|---|
Atg3 | forward | TGCGACAGTCTCTCCGTGC | NM_0134394 |
reverse | GGCCACTTCCAGAGCCTTTC | ||
probe | TGCTCCGGTCCCAGGATGCAGA | ||
Atg5 | forward | ACATCAGCATTGTGCCCCA | NM_001014250 |
reverse | TGTCATGCTTCGGTGTCCTG | ||
probe | CAGACTGAAGGCCGTGTCCTGCTCA | ||
Atg12 | forward | TCTGCCTAGCCTGGAACTCAG | NM_001038495 |
reverse | TAGCCCTGTGTGCTCTGCTTT | ||
probe | CCTGTCCGTGAAGCTCACCCAGC | ||
Beclin-1 | forward | GCAGCACCATGCAGGTGAG | NM_053739 |
reverse | TGGTCACTCGGTCCAGGATC | ||
probe | TCGTGTGCCAGCGCTGTAGCCA | ||
HPRT | forward | GGAAAGAACGTCTTGATTGTTGAA | NM_012583 |
reverse | CCAACACTTCGAGAGGTCCTTTT | ||
probe | CTTTCCTTGGTCAAGCAGTACAGCCCC |
© 2012 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Bendix, I.; Schulze, C.; Haefen, C.v.; Gellhaus, A.; Endesfelder, S.; Heumann, R.; Felderhoff-Mueser, U.; Sifringer, M. Erythropoietin Modulates Autophagy Signaling in the Developing Rat Brain in an In Vivo Model of Oxygen-Toxicity. Int. J. Mol. Sci. 2012, 13, 12939-12951. https://doi.org/10.3390/ijms131012939
Bendix I, Schulze C, Haefen Cv, Gellhaus A, Endesfelder S, Heumann R, Felderhoff-Mueser U, Sifringer M. Erythropoietin Modulates Autophagy Signaling in the Developing Rat Brain in an In Vivo Model of Oxygen-Toxicity. International Journal of Molecular Sciences. 2012; 13(10):12939-12951. https://doi.org/10.3390/ijms131012939
Chicago/Turabian StyleBendix, Ivo, Corina Schulze, Clarissa von Haefen, Alexandra Gellhaus, Stefanie Endesfelder, Rolf Heumann, Ursula Felderhoff-Mueser, and Marco Sifringer. 2012. "Erythropoietin Modulates Autophagy Signaling in the Developing Rat Brain in an In Vivo Model of Oxygen-Toxicity" International Journal of Molecular Sciences 13, no. 10: 12939-12951. https://doi.org/10.3390/ijms131012939