Molecular Cloning and 3D Structure Modeling of APEX1, DNA Base Excision Repair Enzyme from the Camel, Camelus dromedarius
Abstract
:1. Introduction
2. Results
2.1. Cloning and Characterization of Full Coding Region of cAPEX1 cDNA from C. dromedarius Liver
2.2. Amino Acid Composition of cAPEX1
2.3. Multiple Sequence Alignment and Phylogenetic Analysis
2.4. Secondary and 3D Structure Modeling of cAPEX1
2.5. Comparison between Structure of Camel and Human APEX1
2.6. Expression of cAPEX1 Gene by Real Time PCR
3. Discussion
4. Experimental Section
4.1. Samples and Materials
4.2. Oligonucleotide Design
4.3. RNA Extraction, cDNA Synthesis and Reverse Transcription PCR
4.4. Polymerase Chain Reaction and Cloning
4.5. Studying Gene Expression by qPCR
4.6. DNA Sequencing and Prediction of Amino Acid Sequence
4.7. Multiple Sequence Alignment and Analysis of Phylogenetic Relationship
4.8. Secondary and Prediction of the 3D Structure of cAPEX1
5. Conclusions
Acknowledgments
References
- Marnett, L.J. Oxyradicals and DNA damage. Carcinogenesis 2000, 21, 361–370. [Google Scholar]
- Nebert, D.W.; Dalton, T.P. The role of cytochrome P450 enzymes in endogenous signalling pathways and environmental carcinogenesis. Nat. Rev. Cancer 2006, 6, 947–960. [Google Scholar]
- Doetsch, P.W.; Cunningham, R.P. The enzymology of apurinic/apyrimidinic endonucleases. Mutat. Res 1990, 236, 173–201. [Google Scholar]
- Mullart, E.; Lohman, P.H.M.; Berends, F.; Vijg, J. DNA damage metabolism and aging. Mutat. Res 1990, 237, 189–210. [Google Scholar]
- Lindahl, T. Instability and decay of the primary structure of DNA. Nature 1993, 362, 709–715. [Google Scholar]
- Marnett, L.J.; Burcham, P.C. Endogenous DNA adducts: Potential and paradox. Chem. Res. Toxicol 1993, 6, 771–785. [Google Scholar]
- Barnes, D.E.; Lindahl, T. Repair and genetic consequences of endogenous DNA base damage in mammalian cells. Annu. Rev. Genet 2004, 38, 445–476. [Google Scholar]
- Damia, G.; D’Incalci, M. Targeting DNA repair as a promising approach in cancer therapy. Eur. J. Cancer 2007, 43, 1791–1801. [Google Scholar]
- Hazra, T.K.; Das, A.; Das, S.; Choudhury, S.; Kow, Y.W.; Roy, R. Oxidative DNA damage repair in mammalian cells: A new perspective. DNA Repair 2007, 6, 470–480. [Google Scholar]
- Tell, G.; Quadrifoglio, F.; Tiribelli, C.; Kelley, M.R. The many functions of APE1/Ref-1: Not only a DNA repair enzyme. Antioxid. Redox Signal 2009, 11, 601–620. [Google Scholar]
- He, T.; Weintraub, N.L.; Goswami, P.C.; Chatterjee, P.; Flaherty, D.M.; Domann, F.E.; Oberley, L.W. Redox factor-1 contributes to the regulation of progression from G0/G1 to S by PDGF in vascular smooth muscle cells. Am. J. Physiol. Heart Circ. Physiol 2003, 285, 804–812. [Google Scholar]
- Fung, H.; Demple, B. A vital role for Ape1/Ref1 protein in repairing spontaneous DNA damage in human cells. Mol. Cell 2005, 17, 463–470. [Google Scholar]
- Izumi, T.; Brown, D.B.; Naidu, C.V.; Bhakat, K.K.; Macinnes, M.A.; Saito, H.; Chen, D.J.; Mitra, S. Two essential but distinct functions of the mammalian abasic endonuclease. Proc. Natl. Acad. Sci. USA 2005, 102, 5739–5743. [Google Scholar]
- Vascotto, C.; Cesaratto, L.; Zeef, L.A.; Deganuto, M.; D’Ambrosio, C.; Scaloni, A.; Romanello, M.; Damante, G.; Taglialatela, G.; Delneri, D.; et al. Genome-wide analysis and proteomic studies reveal APE1/Ref-1 multifunctional role in mammalian cells. Proteomics 2009, 9, 1058–1074. [Google Scholar]
- Chattopadhyay, R.; Wiederhold, L.; Szczesny, B.; Boldogh, I.; Hazra, T.K.; Izumi, T.; Mitra, S. Identification and characterization of mitochondrial abasic (AP)-endonuclease in mammalian cells. Nucleic Acids Res 2006, 34, 2067–2076. [Google Scholar]
- Qu, J.; Liu, G.H.; Huang, B.; Chen, C. Nitric oxide controls nuclear export of APE1/Ref-1 through S-nitrosation of cysteines 93 and 310. Nucleic Acids Res 2007, 35, 2522–2532. [Google Scholar]
- Mitra, S.; Izumi, T.; Boldogh, I.; Bhakat, K.K.; Chattopadhyay, R.; Szczesny, B. Intracellular trafficking and regulation of mammalian AP-endonuclease 1 (APE1), an essential DNA repair protein. DNA Repair 2007, 6, 461–469. [Google Scholar]
- Fan, J.; Wilson, D.M., III. Protein-protein interactions and posttranslational modifications in mammalian base excision repair. Free Radic. Biol. Med 2005, 38, 1121–1138. [Google Scholar]
- Wilson, S.H. Mammalian base excision repair and DNA polymerase beta. Mutat. Res 1998, 407, 203–215. [Google Scholar]
- Parsons, J.L.; Dianova, I.I.; Dianov, G.L. Ape1 is the major 30-phosphoglycolate activity in human cell extracts. Nucleic Acids Res 2004, 32, 3531–3536. [Google Scholar]
- Abate, C.; Patel, L.; Rauscher, F.J., III; Curran, T. Redox regulation of fos and jun DNA-binding activity in vitro. Science 1990, 249, 1157–1161. [Google Scholar]
- Xanthoudakis, S.; Miao, G.; Wang, F.; Pan, Y.C.; Curran, T. Redox activation of Fos-Jun DNA binding activity is mediated by a DNA repair enzyme. EMBO J 1992, 11, 3323–3335. [Google Scholar]
- Hall, J.L.; Wang, X.; van Adamson Zhao, Y.; Gibbons, G.H. Overexpression of Ref-1 inhibits hypoxia and tumor necrosis factor-induced endothelial cell apoptosis through nuclear factor-κB-independent and -dependent pathways. Circ. Res 2001, 88, 1247–1253. [Google Scholar]
- Huang, R.P.; Adamson, E.D. Characterization of the DNA-binding properties of the early growth response-1 (Egr-1) transcription factor: Evidence for modulation by a redox mechanism. DNA Cell Biol 1993, 12, 265–273. [Google Scholar]
- Bhakat, K.K.; Mantha, A.K.; Mitra, S. Transcriptional regulatory functions of mammalian AP-endonuclease (APE1/Ref-1), an essential multifunctional protein. Antioxid. Redox Signal 2009, 11, 621–638. [Google Scholar]
- Vascotto, C.; Fantini, D.; Romanello, M.; Cesaratto, L.; Deganuto, M.; Leonardi, A.; Radicella, J.P.; Kelley, M.R.; D’Ambrosio, C.; Scaloni, A.; et al. APE1/Ref-1 interacts with NPM1 within nucleoli and plays a role in the rRNA quality control process. Mol. Cell. Biol 2009, 29, 1834–1854. [Google Scholar]
- Barnes, T.; Kim, W.C.; Mantha, A.K.; Kim, S.E.; Izumi, T.; Mitra, S.; Lee, C.H. Identification of Apurinic/apyrimidinic endonuclease 1 (APE1) as the endoribonuclease that cleaves c-myc mRNA. Nucleic Acids Res 2009, 37, 3946–3958. [Google Scholar]
- Nguyen, L.H.; Barsky, D.; Erzberger, J.P.; Wilson, D.M., III. Mapping the protein-DNA interface and the metal-binding site of the major human apurinic/apyrimidinic endonuclease. J. Mol. Biol 2000, 298, 447–459. [Google Scholar]
- Fantini, D.; Vascotto, C.; Marasco, D.; D’Ambrosio, C.; Romanello, M.; Vitagliano, L.; Pedone, C.; Poletto, M.; Cesaratto, L.; Quadrifoglio, F.; et al. Critical lysine residues within the overlooked N-terminal domain of human APE1 regulate its biological functions. Nucleic Acids Res 2010, 38, 8239–8256. [Google Scholar]
- Loeb, L.A.; Preston, B.D. Mutagenesis by apurinic/apyrimidinic sites. Annu. Rev. Genet 1986, 20, 201–230. [Google Scholar]
- Fishel, M.L.; Kelley, M.R. The DNA base excision repair protein Ape1/Ref-1 as a therapeutic and chemopreventive target. Mol. Asp. Med 2007, 28, 375–395. [Google Scholar]
- Ataya, F.S.; Alanazi, M.; Fouad, D.; Saeed, H.M.; Bazzi, M.D. Molecular cloning and characterization of a putative OGG_N domain from the camel, Camelus dromedarius. Afr. J. Biotechnol 2011, 11, 7803–7811. [Google Scholar]
- Ataya, F.S.; Fouad, D.; Al-Olayan, E.; Malik, A. Molecular cloning, characterization and predicted structure of a putative copper-zinc SOD1 from the camel, Camelus dromedarius. Int. J. Mol. Sci 2012, 13, 879–900. [Google Scholar]
- Alanazi, M.S.; Saeed, H.M.; Ataya, F.S.; Bazzi, M.D. Molecular Characterization of the Camelus dromedarius Putative Cytochrome P450s Genes. Protein J 2010, 29, 306–313. [Google Scholar]
- Seqman, version 5.07; DNASTAR, Inc; Madison, WI, USA, 2003.
- PROTEAN, version 5.07; DNASTAR, Inc.: Madison, WI, USA, 2003.
- MAFFT, version 6.864; Computational Biology Research Center (CBRC): Tokyo, Japan, 2011.
- Jalview, version 2.3; University of Dundee: Scotland, UK, 2011.
- Arnold, K.; Bordoli, L.; Kopp, J.; Schwede, T. The SWISS-MODEL Workspace: A web-based environment for protein structure homology modelling. Bioinformatics 2006, 22, 195–201. [Google Scholar]
- PyMOL, version 0.99; Schrödinger: New York, NY, USA, 2006.
- PDBeFold (Structure Similarity); EMBL-EBI. website. Available online: http://www.ebi.ac.uk/msd-srv/ssm/cgi-bin/ssmserver accessed on 15 February 2012.
- Agrawal, R.P.; Jain, S.; Shah, S.; Chopra, A.; Agarwal, V. Effect of camel milk on glycemic control and insulin requirement in patients with type 1 diabetes: 2-years randomized controlled trial. Eur. J. Clin. Nutr 2011, 65, 1048–1052. [Google Scholar]
- Mohamad, R.H.; Zekry, Z.K.; Al-Mehdar, H.A.; Salama, O.; El-Shaieb, S.E.; El-Basmy, A.A.; Al-said, M.G.; Sharawy, S.M. Camel milk as an adjuvant therapy for the treatment of type 1 diabetes: Verification of a traditional ethnomedical practice. J. Med. Food 2009, 12, 461–465. [Google Scholar]
- Maghraby, A.S.; Mohamed, M.A.; Abdel-Salam, A.M. Anti-schistosomal activity of colostral and mature camel milk on Schistosoma mansoni infected mice. Asia Pac. J. Clin. Nutr 2005, 14, 432–438. [Google Scholar]
- Liao, Y.; El-Fakkarany, E.; Lönnerdal, B.; Redwan, E.M. Inhibitory effects of native and recombinant full-length camel lactoferrin and its N and C lobes on hepatitis C virus infection of Huh7.5 cells. J. Med. Microbiol 2012, 61, 375–383. [Google Scholar]
- Almahdy, O.; El-Fakharany, E.M.; El-Dabaa, E.; Ng, T.B.; Redwan, E.M. Examination of the Activity of Camel Milk Casein against Hepatitis C Virus (Genotype-4a) and Its Apoptotic Potential in Hepatoma and HeLa Cell Lines. Hepat. Mon 2011, 11, 724–730. [Google Scholar]
- Walker, L.J.; Robson, C.N.; Black, E.; Gillespie, D.; Hickson, I.D. Identification of residues in the human DNA repair enzyme HAP1 (Ref-1) that are essential for redox regulation of Jun DNA binding. Mol. Cell. Biol 1993, 13, 5370–5376. [Google Scholar]
- Georgiadis, M.M.; Luo, M.; Gaur, R.K.; Delaplane, S.; Li, X.; Kelley, M.R. Evolution of the redox function in mammalian apurinic/apyrimidinic endonuclease. Mutat. Res 2008, 643, 54–63. [Google Scholar]
- Gorman, M.A.; Morera, S.; Rothwell, D.G.; de La Fortelle, E.; Mol, C.D.; Tainer, J.A.; Hickson, I.D.; Freemont, P.S. The crystal structure of the human DNA repair endonuclease HAP1 suggests the recognition of extra-helical deoxyribose at DNA abasic sites. EMBO J 1997, 16, 6548–6558. [Google Scholar]
- Mol, C.D.; Izumi, T.; Mitra, S.; Tainer, J.A. DNA-bound structures and mutants reveal abasic DNA binding by APE1 and DNA repair coordination [corrected]. Nature 2000, 403, 451–456. [Google Scholar]
- Sambrook, J.; Fritsch, E.; Manaiatis, T. Molecular Cloning: A Laboratory Manual, 2nd ed; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 1989. [Google Scholar]
- Sanger, F.; Nicklen, S.; Coulson, A.R. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 1977, 74, 5463–5467. [Google Scholar]
- EditSeq, version 5.07; DNASTAR, Inc: Madison, WI, USA, 2003.
- Basic Local Alignment Search Tool. Available online: http://blast.ncbi.nlm.nih.gov/ accessed on 28 February 2012.
Amino acid | Number count | % by weight | % by frequency | Amino Acid | Number count | % by weight | % by frequency |
---|---|---|---|---|---|---|---|
Ala (A) | 27 | 5.41 | 8.49 | Met (M) | 3 | 1.11 | 0.94 |
Cys (C) | 7 | 2.03 | 2.20 | Asn (N) | 10 | 3.21 | 3.14 |
Asp (D) | 16 | 5.19 | 5.03 | Pro (P) | 20 | 5.47 | 6.29 |
Glu (E) | 27 | 9.82 | 8.49 | Gln (Q) | 10 | 3.61 | 3.14 |
Phe (F) | 9 | 3.73 | 2.83 | Arg (R) | 10 | 3.61 | 3.14 |
Gly (G) | 26 | 4.18 | 8.18 | Ser (S) | 20 | 4.91 | 6.29 |
His (H) | 6 | 2.32 | 1.89 | Thr (T) | 12 | 3.42 | 3.77 |
Ile (I) | 9 | 2.87 | 2.83 | Val (V) | 16 | 4.47 | 5.03 |
Lys (K) | 30 | 10.83 | 9.43 | Trp (W) | 7 | 3.67 | 2.20 |
Leu (L) | 11.16 | 11.01 | 11.16 | Tyr (Y) | 12 | 5.52 | 3.77 |
Charged amino acids (RKHYCDE) | 114 | 42.74 | 35.85 | ||||
Acidic (DE) | 43 | 15.01 | 13.52 | ||||
Basic (KR) | 46 | 17.87 | 14.47 | ||||
Polar (NCQSTY) | 71 | 22.70 | 22.33 | ||||
Hydrophobic (AILFWV) | 103 | 31.30 | 32.39 |
APEX1 | (NCBI Ref. Seq) | Amino acid residues | Total score | Identity (%) | Positive (%) | Gap (%) | E-value | pI |
---|---|---|---|---|---|---|---|---|
Camelus dromedarius | ADJ96599 | 318 | 656 | 100 | 100 | 0 | 0.00E+00 | 8.32 |
Equus caballus | XP_001505181.1 | 318 | 635 | 97 | 97 | 0 | 0.00E+00 | 8.51 |
Sus scrofa | NP_001132943 | 318 | 622 | 97 | 98 | 0 | 0.00E+00 | 8.04 |
Bos taurus | NP_788782 | 318 | 613 | 96 | 97 | 0 | 1.00E−180 | 8.32 |
Canis lupus familiaris | NP_001138591.1 | 318 | 610 | 96 | 97 | 0 | 1.00E−179 | 8.33 |
Homo sapiens | NP_001632.2 | 318 | 606 | 95 | 97 | 0 | 3.00E−178 | 8.33 |
Pongo abelii | XP_002824554.1 | 318 | 605 | 95 | 97 | 0 | 6.00E−178 | 8.33 |
Pan troglodytes | NP_001074954.1 | 318 | 607 | 95 | 97 | 0 | 1.00E−178 | 8.33 |
Macaca mulatta | XP_001090240.1 | 318 | 622 | 95 | 96 | 0 | 0.00E+00 | 8.32 |
Mus musculus | NP_033817.1 | 317 | 619 | 95 | 96 | 0 | 0.00E+00 | 8.04 |
Cavia porcellus | XP_003474586 | 318 | 616 | 94 | 96 | 0 | 0.00E+00 | 8.32 |
Primer | Primer sequence | Primer couple | Product (bp) | Annealing temperature |
---|---|---|---|---|
APF1 | AGCAGGCAACGCGGTAAAA | APR1 APR3 | 548 041 | 58 58 |
APR1 | GCCTTCTTGATCATGTTCCTCCTC | APF1 | 540 | 58 |
APF2 | GGATCCATGCCGAAGCGTGGGAAAA | APR2 | 854 | 58 |
APR2 | AGTAATCAAGGCGCCAACCAACAT | APF2 | 854 | 58 |
APR3 | TTGGGGAAAGGTCACAGT | APF1 APF2 | 1041 954 | 55 52 |
AP1qF | GGTAAAGGAGGAAGCCCCAGATA | AP1qR | 194 | 56 |
AP1qR | TCACCAATGCCATAGGAGACTTT | AP1qF | 194 | 56 |
© 2012 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Ataya, F.S.; Fouad, D.; Malik, A.; Saeed, H.M. Molecular Cloning and 3D Structure Modeling of APEX1, DNA Base Excision Repair Enzyme from the Camel, Camelus dromedarius. Int. J. Mol. Sci. 2012, 13, 8578-8596. https://doi.org/10.3390/ijms13078578
Ataya FS, Fouad D, Malik A, Saeed HM. Molecular Cloning and 3D Structure Modeling of APEX1, DNA Base Excision Repair Enzyme from the Camel, Camelus dromedarius. International Journal of Molecular Sciences. 2012; 13(7):8578-8596. https://doi.org/10.3390/ijms13078578
Chicago/Turabian StyleAtaya, Farid Shokry, Dalia Fouad, Ajamaluddin Malik, and Hesham Mahmoud Saeed. 2012. "Molecular Cloning and 3D Structure Modeling of APEX1, DNA Base Excision Repair Enzyme from the Camel, Camelus dromedarius" International Journal of Molecular Sciences 13, no. 7: 8578-8596. https://doi.org/10.3390/ijms13078578