Abstract
Human dental pulp stem cells (DPSCs), unique mesenchymal stem cells (MSCs) type, exhibit the characteristics of self-renewal and multi-lineage differentiation capacity. Oct4 and Nanog are pluripotent genes. The aim of this study was to determine the physiological functions of Oct4 and Nanog expression in DPSCs. Herein, we determined the critical role of an Oct4/Nanog axis modulating MSCs properties of DPSCs by lentiviral-mediated co-overexpression or co-knockdown of Oct4/Nanog in DPSCs. MSCs properties including osteogenic/chondrogenic/adipogenic induction differentiation was assayed for expression of osteogenic/chondrogenic/adipogenic markers by quantitative real-time RT-PCR analysis. Initially, we observed that the expression profile of Oct4 and Nanog in dental pulp cells, which exerted properties of MSCs, was significantly up-regulated compared to that of STRO-1−CD146− dental pulp cells. Down-regulation of Oct4 and Nanog co-expression significantly reduced the cell proliferation, osteogenic differentiation capability, STRO-1, CD146, and Alkaline phosphatase (ALP) activity of DPSCs. In contrast, co-overexpression of Oct4 and Nanog enhanced the expression level of STRO-1 and CD146, proliferation rate and osteogenic/chondrogenic/adipogenic induction differentiation capability, and expression of osteogenic/chondrogenic/adipogenic induction differentiation markers. Our results suggest that Oct4-Nanog signaling is a regulatory switch to maintain properties in DPSCs.
1. Introduction
Dental pulp stem cells (DPSCs) are a recently developed technology that holds promise for stem cell biology and regenerative medicine. DPSCs are well known to be multi-potent cells capable of differentiation along multiple lineages [1]. DPSCs have the remarkable potential for multi-lineage differentiation capacity including osteoblast [2], cartilage [3], adipocyte [4], muscle [5], hepatocyte [6], and neurons [7]. Therefore, an improved comprehension of the cellular and molecular mechanisms, which modulate self-renewal and differentiation properties of DPSCs, could be pursued to bring forth future progress in regenerative medicine.
Oct4 along with Nanog is part of the key set of transcription factors that are involved in the maintenance of pluripotency and self-renewal in undifferentiated embryonic stem cells (ESCs) [8]. Hyslop and colleagues reported that down-regulation of Nanog in human ESCs induces pro-extraembryonic lineage differentiation, evidenced by the up-regulated endoderm- and trophectoderm-associated genes, suggesting that Nanog acts as a gatekeeper of pluri-potency in human embryonic development [9]. The leukemia inhibitory factor (LIF) has been utilized to maintain the symmetrical self-renewal of mouse ESCs [10]. Constitutively activated Oct4 from an exogenous promoter in ESCs still required LIF for inducing self-renewal in ESCs [11]. Nanog overexpression relieves ESCs self-renewal from dependence on the activity of the leukemia inhibitory factor-signal transducer and activator of transcription 3 (LIF-STAT3) pathway. Moreover, Chambers’ report showed that Nanog is expressed in Oct4-deficient embryos, and Nanog overexpression does not revert the differentiation program of ESCs triggered by Oct4 down-regulation [12]. These results suggest that Nanog is not just a downstream version of Oct4 and, Nanog and Oct4 work in concert to support stem cell potency and self-renewal. Oct4 and Nanog, are shown to reprogram human somatic fibroblasts into embryonic stem cell-like pluripotent cells, termed inducible pluripotent stem cells [13]. Nevertheless, Oct4/Nanog mediated molecular mechanisms in regulating DPSCs are still unclear.
The detailed molecular mechanisms involved in the regulatory links between Oct4/Nanog and DPSCs properties are still poorly understood. Herein, we demonstrate a critical role of Oct4/Nanog overexpression in the enhancement of proliferation rate and promoting osteogenic/chondrogenic/adipogenic induction differentiation of DPCs. Additionally, down-regulation of Oct4/Nanog lessens MSCs properties of DPSCs. Ultimately, we demonstrated the functional roles of Oct4/Nanog co-expression in DPSCs.
2. Results
2.1. Increased Expression of Oct4 and Nanog Expression in STRO-1+CD146+ DPSCs (Dental Pulp Stem Cells)
The STRO-1+ and CD146+ dental pulp cells (DPCs) have been shown to exhibit MSCs properties and these markers have been used to identify dental pulp stem cells (DPSCs) [14]. We isolated STRO-1+CD146+ primary DPSCs from human dental pulp human tissues by using a Flow-activated cell sorting (FACS) cell sorter (Figure 1A). We next performed a colony-forming assay to evaluate the colony-forming efficiency of STRO-1+CD146+ and STRO-1−CD146− DPCs, respectively. Apparently, the colony-forming efficiency of STRO-1+CD146+ cells was significantly higher than that of the STRO-1−CD146− cells (Figure 1B). By using quantitative real-time RT-PCR, we observed increased expression of ESCs-related stemness genes, especially Oct4 and Nanog, in STRO-1+CD146+ cells (Figure 1C). As shown in Figure 1D, Oct4 and Nanog protein expression was readily detectable in Strol+CD146+ but was low or undetectable in STRO-1−CD146− cells. Together, we hypothesized that up-regulation of Oct4 and Nanog might be crucial for modulating MSCs characteristics of DPCs.
Figure 1.
Enriched Oct4 and Nanog expression in STRO-1+CD146+ DPSCs (Dental Pulp Stem Cells). (A) The expression of STRO-1 and CD146 in dental pulp cells was analyzed by flow cytometry; (B) To elucidate the capabilities of colony formation of STRO-1−CD146− and STRO-1+CD146+ dental pulp cells, single-cell suspensions of dental pulp cells were plated and analyzed as described in the experimental section; Oct4, Nanog, and Sox2 mRNA expression in STRO-1+CD146+ and STRO-1−CD146− dental pulp cells were examined by real-time RT-PCR analysis (C) and western blotting analysis (D). The amount of GAPDH protein of different crude cell extracts was referred to as a loading control. Error bars correspond to SD. Data shown here are the mean ± SD of three independent experiments. (* p < 0.05; ** p < 0.01; *** p < 0.001).
Figure 1.
Enriched Oct4 and Nanog expression in STRO-1+CD146+ DPSCs (Dental Pulp Stem Cells). (A) The expression of STRO-1 and CD146 in dental pulp cells was analyzed by flow cytometry; (B) To elucidate the capabilities of colony formation of STRO-1−CD146− and STRO-1+CD146+ dental pulp cells, single-cell suspensions of dental pulp cells were plated and analyzed as described in the experimental section; Oct4, Nanog, and Sox2 mRNA expression in STRO-1+CD146+ and STRO-1−CD146− dental pulp cells were examined by real-time RT-PCR analysis (C) and western blotting analysis (D). The amount of GAPDH protein of different crude cell extracts was referred to as a loading control. Error bars correspond to SD. Data shown here are the mean ± SD of three independent experiments. (* p < 0.05; ** p < 0.01; *** p < 0.001).

2.2. Silencing Oct4 or Nanog Expression Did not Affect the Proliferation Rate and ALP (Alkaline Phosphatase) Activity in STRO-1+CD146+ DPSCs
To investigate whether Oct4 or Nanog plays a role in maintaining MSCs properties of STRO-1+CD146+ DPSCs, the approach of loss-of-function of Oct4 or Nanog expression was first conducted. Down-regulation of Oct4 or Nanog expression in DPSCs was achieved by viral transduction with lentiviral vector expressing small hairpin RNA (shRNA) targeting Oct4 and Nanog and lentiviral vector expressing shRNA against luciferase (sh-Luc) used as a control. Immunoblotting analyses confirmed that lentivirus expressing sh-Oct4 or sh-Nanog markedly reduced the expression level of Oct4 (Figure 2A) or Nanog (Figure 2B) protein in transduced STRO-1+CD146+ DPSCs. However, single silencing Oct4 (Figure 2C) or Nanog (Figure 2D) expression did not affect the proliferation rate of STRO-1+CD146+ DPSCs. DPSCs infected with sh-Oct4 or sh-Nanog expressing lentivirus did not change the expression level of STRO-1 and CD146 in DPSCs (Figure 2E). The ALP activity in DPSCs did not change in sh-Oct4 or sh-Nanog knockdown DPSCs (Figure 2F).
Figure 2.
Depletion of Oct4 or Nanog expression did not affect proliferation rate and ALP activity in STRO-1+CD146+ DPSCs. The silencing effect of Oct4 (A) or Nanog (B) shRNA in DPSCs was validated translationally by western blotting. Immunoblotting against anti-Oct4, anti-Nanog, or anti-GAPDH antibodies was performed as indicated; The amount of GAPDH protein of different crude cell extracts was referred to as loading control and for further quantification; The proliferation rate of sh-Oct4 (C) or sh-Nanog (D) in STRO-1+CD146+ DPSCs was analyzed by a 3-(4,5-dimethylthiazol-2-yl) 2,5-diphenyl tetrazolium bromide (MTT) assay; (E) The expression of STRO-1 and CD146 of Oct4 or Nanog-knockdown DPSCs was analyzed by flow cytometry analysis; (F) ALP activity of Oct4 or Nanog knockdown DPSCs was analyzed. Data shown here are the mean ± SD of three independent experiments.
Figure 2.
Depletion of Oct4 or Nanog expression did not affect proliferation rate and ALP activity in STRO-1+CD146+ DPSCs. The silencing effect of Oct4 (A) or Nanog (B) shRNA in DPSCs was validated translationally by western blotting. Immunoblotting against anti-Oct4, anti-Nanog, or anti-GAPDH antibodies was performed as indicated; The amount of GAPDH protein of different crude cell extracts was referred to as loading control and for further quantification; The proliferation rate of sh-Oct4 (C) or sh-Nanog (D) in STRO-1+CD146+ DPSCs was analyzed by a 3-(4,5-dimethylthiazol-2-yl) 2,5-diphenyl tetrazolium bromide (MTT) assay; (E) The expression of STRO-1 and CD146 of Oct4 or Nanog-knockdown DPSCs was analyzed by flow cytometry analysis; (F) ALP activity of Oct4 or Nanog knockdown DPSCs was analyzed. Data shown here are the mean ± SD of three independent experiments.

2.3. Down-Regulation of Oct4 and Nanog co-Expression Reduces the Proliferation Rate and Odontogenic/Osteogenic Properties in STRO-1+CD146+ DPSCs
To further study the effect of Oct4 and Nanog on MSC properties, we stably co-knocked down Oct4 and Nanog expression in DPSCs. Immunoblotting analyses confirmed that lentivirus expressing both sh-Oct4 and sh-Nanog markedly reduced the co-expression level of Oct4 and Nanog protein in transduced STRO-1+CD146+ DPSCs (Figure 3A). The cell proliferation rate was also decreased in sh-Oct4/sh-Nanog infected DPSCs cultured in regular medium by MTT analysis (Figure 3B). Co-knockdown of Oct4 and Nanog effectively inhibited the expression level of STRO-1 and CD146 in DPSCs (Figure 3C–E). DPSCs have been shown to exhibit the osteogenesis differentiation capacity [2]. Importantly, DPSCs infected with sh-Oct4/sh-Nanog expressing lentivirus significantly decreased the percentage of mineralized nodule formation and osteogenic differentiation potential when cultured with osteogenic medium (Figure 3F). Alkaline phosphatase is a well-known marker for for osteogenesis [2]. Co-targeting endogenous Oct4 and Nanog expression dramatically decreased ALP activity in DPSCs (Figure 3G) when cultured with osteogenic medium. However, co-knockdown of Oct4/Nanog did not change osteogenic differentiation in DPSCs without osteoinduction media (data not shown). Together, Oct4 and Nanog cooperatively modulated cell proliferation rate as well as MSCs properties of DPSCs.
Figure 3.
Depletion of Oct4/Nanog impairs proliferation rate and osteogenic properties in STRO-1+CD146+ DPSCs (A) Single cell suspensions of STRO-1+CD146+ DPSCs were transduced with sh-Luc or sh-Oct4 + sh-Nanog lentivirus; Total proteins prepared from infected cells were prepared and analyzed. The silencing effect of Oct4/Nanog shRNA in DPSCs was validated translationally by western blotting; Immunoblotting against anti-Oct4, anti-Nanog, or anti-GAPDH antibodies was performed as indicated; The amount of GAPDH protein of different crude cell extracts was referred to as loading control and for further quantification; (B) The proliferation rate of sh-Luc or sh-Oct4/sh-Nanog STRO-1+CD146+ DPSCs was analyzed by a MTT assay; The expression of (C) STRO-1 and (D) CD146 of Oct4/Nanog co-knockdown DPSCs was analyzed by flow cytometry analysis; (E) The expression of STRO-1 and CD146 of Oct4/Nanog co-knockdown DPSCs was calculated and presented in the chart; (F) The osteogenic differentiation of DPSCs cultivated with osteogenic medium infected with sh-Luc or Oct4/Nanog-shRNA lentivirus was examined. Yellow arrow indicates mineralized nodule formation in DPSCs; (G) ALP activity of Oct4/Nanog co-knockdown DPSCs was analyzed. Data shown here are the mean ± SD of three independent experiments. (* p < 0.05; ** p < 0.01).
Figure 3.
Depletion of Oct4/Nanog impairs proliferation rate and osteogenic properties in STRO-1+CD146+ DPSCs (A) Single cell suspensions of STRO-1+CD146+ DPSCs were transduced with sh-Luc or sh-Oct4 + sh-Nanog lentivirus; Total proteins prepared from infected cells were prepared and analyzed. The silencing effect of Oct4/Nanog shRNA in DPSCs was validated translationally by western blotting; Immunoblotting against anti-Oct4, anti-Nanog, or anti-GAPDH antibodies was performed as indicated; The amount of GAPDH protein of different crude cell extracts was referred to as loading control and for further quantification; (B) The proliferation rate of sh-Luc or sh-Oct4/sh-Nanog STRO-1+CD146+ DPSCs was analyzed by a MTT assay; The expression of (C) STRO-1 and (D) CD146 of Oct4/Nanog co-knockdown DPSCs was analyzed by flow cytometry analysis; (E) The expression of STRO-1 and CD146 of Oct4/Nanog co-knockdown DPSCs was calculated and presented in the chart; (F) The osteogenic differentiation of DPSCs cultivated with osteogenic medium infected with sh-Luc or Oct4/Nanog-shRNA lentivirus was examined. Yellow arrow indicates mineralized nodule formation in DPSCs; (G) ALP activity of Oct4/Nanog co-knockdown DPSCs was analyzed. Data shown here are the mean ± SD of three independent experiments. (* p < 0.05; ** p < 0.01).

2.4. Overexpression of Oct4/Nanog Enhanced Stemness and Proliferation Activity of DPCs
To investigate the effect of Oct4 or Nanog up-regulation on biological properties of DPCs, we stably overexpressed Oct4 or Nanog expression in DPCs through lentiviral-mediated transduction. Immunoblotting analyses confirmed that over-expression Oct4 or Nanog markedly increased the expression level of Oct4 (Figure S1A) or Nanog (Figure S1B) protein in transduced DPCs. Consistent with knockdown experiments, single overexpression of Oct4 (Figure S1C) or Nanog (Figure S1D) expression did not affect the proliferation rate of DPCs. The expression of STRO-1 and CD146 in DPCs did not change in Oct4 or Nanog-overexpressing DPCs (Figure S1D). Single over-expression of Oct4 or Nanog was not capable of changing ALP activity (Figure S1E) in DPCs.
To further evaluate the functional roles of Oct4/Nanog co-expression in DPCs, we co-overexpressed Oct4 and Nanog expression in DPCs. As expected, overexpression of Oct4 and Nanog increased the transcripts (Figure 4A) and protein levels (Figure 4B) in Oct4/Nanog-overexpressing DPCs. Notably, the endogenous STRO-1 (Figure 4C) and CD146 (Figure 4D) was enhanced by co-overexpressed Oct4/Nanog in DPCs (Figure 4E). Meanwhile, Oct4/Nanog-overexpressing DPCs cultivated with regular medium also showed significantly elevated proliferation rates in comparison to control DPCs by MTT analyses (Figure 4F). However, Oct4/Nanog-overexpressing DPCs also regulate the phenotypes comparison with wild type cells (data not shown).
Figure 4.
Overexpression of Oct4/Nanog in DPCs enhances STRO-1 expression and proliferation rate. Expression of Oct4/Nanog transcript (A) or protein (B) in DPCs infected with either Oct4/Nanog-overexpressing or control GFP lentiviruse were examined by real-time RT-PCR analysis (A) and western blot (B); The amount of GAPDH protein was referred to as the loading control; (C) STRO-1 and (D) CD146 expression in Oct4/Nanog-overexpressing or control-GFP DPCs was analyzed by flow cytometry; (E) STRO-1 and CD146 expression of Oct4/Nanog co-overexpressing DPCs were calculated and presented in the chart; (F) The proliferation rate of control-GFP and Oct4/Nanog overexpressing DPCs was analyzed by MTT assay. Data shown here are the mean ± SD of three independent experiments. (* p < 0.05; ** p < 0.01; *** p < 0.001).
Figure 4.
Overexpression of Oct4/Nanog in DPCs enhances STRO-1 expression and proliferation rate. Expression of Oct4/Nanog transcript (A) or protein (B) in DPCs infected with either Oct4/Nanog-overexpressing or control GFP lentiviruse were examined by real-time RT-PCR analysis (A) and western blot (B); The amount of GAPDH protein was referred to as the loading control; (C) STRO-1 and (D) CD146 expression in Oct4/Nanog-overexpressing or control-GFP DPCs was analyzed by flow cytometry; (E) STRO-1 and CD146 expression of Oct4/Nanog co-overexpressing DPCs were calculated and presented in the chart; (F) The proliferation rate of control-GFP and Oct4/Nanog overexpressing DPCs was analyzed by MTT assay. Data shown here are the mean ± SD of three independent experiments. (* p < 0.05; ** p < 0.01; *** p < 0.001).

2.5. Overexpression of Oct4/Nanog Increased Osteogenic/Chondrogenic/Adipogenic Properties of DPCs
The co-overexpression of Oct4/Nanog in DPCs induces an increase of the STRO-1 and CD146 expression potential and in consequence an increase in cell proliferation rate and an increase of the DPCs pluripotency. These data suggested that the crucial role of Oct4/Nanog co-expression in the maintenance of MSCs characteristics of DPCs. We then evaluated Oct4/Nanog overexpression in DPCs under osteogenic and chondrogenic and adipogenic induction differentiation states. The proper differentiation of different lineages was induced by specific induction differentiation protocols described in the Materials and Methods section. Two weeks after the osteogenic induction, Oct4/Nanog overexpression significantly enhanced the osteogenic efficiency in DPCs cultured with osteogenic induction medium (Figure 5A). DPCs with Oct4/Nanog overexpression also showed an increase in chondrogenic induction differentiation (Figure 5B) and adipogenic induction differentiation (Figure 5C) potentials in DPCs when cultured with chondrogenic or adipogenic induction medium. Meanwhile, this Oct4/Nanog co-overexpression significantly increased the colony-forming efficiency in DPCs cultivated with regular medium (Figure 5D). The discovery of the association between expression of Oct4/Nanog and DPSCs suggests the possibility that Oct4/Nanog may regulate the osteogenic/chondrogenic/adipogenic differentiation markers. Quantitative RT-PCR showed up-regulation of osteogenic markers (ALP, DSPP, BSP, and OCN) and chondrogenic markers (Sox9) and adipogenic markers (PPARγ2) in Oct4/Nanog-overexpressing DPCs cultivated with specific induction differentiation medium (Figure 5E). Accordingly, the western blotting data showed that the proteins levels of BSP, OCN, Sox9, and PPARγ2 were also up-regulated in Oct4/Nanog-overexpressing DPCs cultivated with specific induction differentiation medium (Figure 5F). However, these differentiation markers did not change in Oct4/Nanog-overexpressing DPCs cultivated with regular medium (data not shown). Taken together, these data indicate that the overexpression of Oct4/Nanog caused DPC cells to enhance colony-forming efficiency and to promote the osteogenic/chondrogenic/adipogenic induction differentiation capability but not spontaneous differentiation.
Figure 5.
Overexpression of Oct4/Nanog enhanced osteogenic/chondrogenic/adipogenic induction differentiation properties in DPCs. Representative images of osteogenesis (A) and chondrogenesis (B) and adipogenesis (C) capability of control-GFP or Oct4/Nanog-overexpressing DPCs when cultured with osteogenic or chondrogenic or adipogenic induction differentiation medium; The representative image of triplicate samples from one representative experiment (D) Colony formation ability of control-GFP and Oct4/Nanog-overexpressing DPCs cultivated with regular medium was analyzed; (E) Transcript levels of osteogenic markers (ALP, DSPP, OCN, and BSP) and chondrogenic marker (Sox9) and adipogenic marker (PPARγ2) in control-GFP or Oct4/Nanog-overexpressing DPCs were analyzed by real-time RT-PCR analysis; (F) Protein levels of osteogenic markers (OCN and BSP) and chondrogenic marker (Sox9) and adipogenic marker (PPARγ2) in control-GFP or Oct4/Nanog-overexpressing DPCs were analyzed by western blotting analysis. Data shown here are the mean ± SD of three independent experiments. (* p < 0.05; ** p < 0.01; *** p < 0.001).
Figure 5.
Overexpression of Oct4/Nanog enhanced osteogenic/chondrogenic/adipogenic induction differentiation properties in DPCs. Representative images of osteogenesis (A) and chondrogenesis (B) and adipogenesis (C) capability of control-GFP or Oct4/Nanog-overexpressing DPCs when cultured with osteogenic or chondrogenic or adipogenic induction differentiation medium; The representative image of triplicate samples from one representative experiment (D) Colony formation ability of control-GFP and Oct4/Nanog-overexpressing DPCs cultivated with regular medium was analyzed; (E) Transcript levels of osteogenic markers (ALP, DSPP, OCN, and BSP) and chondrogenic marker (Sox9) and adipogenic marker (PPARγ2) in control-GFP or Oct4/Nanog-overexpressing DPCs were analyzed by real-time RT-PCR analysis; (F) Protein levels of osteogenic markers (OCN and BSP) and chondrogenic marker (Sox9) and adipogenic marker (PPARγ2) in control-GFP or Oct4/Nanog-overexpressing DPCs were analyzed by western blotting analysis. Data shown here are the mean ± SD of three independent experiments. (* p < 0.05; ** p < 0.01; *** p < 0.001).

3. Discussion
Dental pulp stem cells (DPSCs), which possess multipotent-differentiation capability, are a candidate for regenerative medicine [14]. They described the identification of DPSCs by virtue of their clonogenic abilities, rapid proliferative rates, and capacity to form mineralized tissues both in vitro and in vivo. Compared with other stem cells such as MSCs from the bone marrow and NSCs from cadavers, DPSC are more easily isolated [15]. However, preliminary studies have identified that the stem cell or potential progenitor cell population in dental pulp comprises less than 1% of the total cells [1,16]. Therefore, an improved comprehension of the cellular and molecular mechanisms that elevate stemness properties of DPSCs could be pursued to bring forth future progress in regenerative medicine.
Self-renewal and pluripotency are the central features in the definition of ESCs, in which Oct4 and Nanog play a key role on maintenance of the process [8]. However, Oct4/Nanog mediated molecular mechanisms in DPSCs still remain to be elucidated. Herein, we evaluated the role of Oct4/Nanog in the maintenance of MSCs characteristics of DPCs by lentiviral-mediated co-knockdown or co-overexpression of Oct4 and Nanog. Depletion of Oct4/Nanog decreased proliferation and osteogenic properties of DPSCs (Figure 2). Co-overexpression of Oct4/Nanog enhanced the proliferation rate and osteogenesis/chondrogeneisis/adipogenesis properties of DPCs (Figure 5). Collectively, our data first demonstrated the crucial role of Oct4/Nanog co-expression in the MSCs properties enhancement of dental pulp cells.
Oct4 and Nanog are also the key transcription factors that could reprogram a human somatic fibroblast into an embryonic stem cell-like pluripotent cell, termed inducible pluripotent stem cell (iPSC) [13]. The dental pulp tissue can be isolated from human exfoliated deciduous and permanent teeth which are usually regarded as medical waste [17]. Previous studies have shown that the DPCs including DPSCs express elevated levels of pluripotent factors, resulting in significantly more efficient and accelerated generation of induced pluripotent stem cells compared with conventional somatic cells. The c-Myc oncogene may contribute to tumorigenesis by over stimulating cell growth and metabolism and/or by causing genomic instability. Deregulated expression of c-Myc occurs in a wide range of human cancers and is often associated with poor prognosis, indicating a key role played by this oncogene in tumor progression. Previous studies have successfully generated iPSCs from mouse and human fibroblasts using only three transcription factors: Oct-4/Sox2/Klf4 (without c-Myc), and mice derived from these iPSCs without c-Myc did not develop tumors during the study period [18,19]. In the present study, co-overexpression of Oct4/Nanog enhanced the proliferation rate and MSCs properties of DPCs (Figure 4). Further research on reprogramming human DPCs using Oct4/Nanog without c-Myc from exfoliated deciduous and permanent teeth into iPSCs for personalized therapies for human disease is needed.
Dnmt1, a major DNA methyltransferase, is responsible for maintenance of the DNA methylation pattern during DNA replication [20]. DNA methylation is crucial for embryo development or ESCs differentiation [21]. Tsai et al reported that Oct4 and Nanog cooperatively modulate the proliferative and undifferentiated states of bone marrow stem cells (BMSCs) by directly binding to the promoter region of Dnmt1 [22]. BMSCs treated with an inhibitor of DNA methylation or transfected Dnmt1 siRNA attenuated proliferation rate and differentiation potential [22]. Epithelial-mesenchymal transition (EMT), a transdifferentiation program that converts epithelial state into mesenchymal state, is critical for development and disease [23]. Intensive studies revealed that transcriptional factors, such as Snail, Slug, and Twist regulate the EMT process [24]. Slug, the best-characterized member of the Snail superfamily, regulate chondrogenic phenotypes in MSCs [25]. In lung cancer cells, co-overexpression of Oct4 and Nanog enhanced the tumor-initiating capability through activation of Slug expression [26]. Therefore, it would be interesting to know whether the regulation of Dnmt1 or EMT by Oct4 and Nanog is also found in DPSCs.
In cancer cells, aberrant expression of Oct4 or Nanog has been linked to an increased proliferation rate in vitro and in vivo [27,28]. Knockdown of Nanog alone in breast cancer cells presented suppressed clonogenic growth and proliferation [29]. A global gene expression profile screening in Nanog small interfering RNA (siRNA)-transfected embryonal carcinoma cells suggested the involvement of Nanog in a cell cycle-signaling pathway [30]. This group reported that along with Nanog knockdown, several cell cycle-related genes as well as a p53-related signaling pathway were downregulated, suggesting a role of Nanog in cell cycle regulation and survival [30]. In breast cancer cells, Han and colleagues found that knockdown of Nanog resulted in inhibited cell proliferation, G0/G1 arrest of the cell cycle, and suppressed expression of cyclin D1 and oncogene c-Myc [29]. They further demonstrated that Nanog directly binds to the minimal promoter region of cyclin D1, transcriptionally regulates its expression, and thus drives the cell cycle moving forward and accelerates cell proliferation [29]. However, the existence of the regulation, as well as its physiological effects, in DPSCs is still elusive. Further exploration of the mechanisms through which Oct4/Nanog regulates cell proliferation is still needed to shed light on the role of Oct4/Nanog in MSCs properties.
In ESCs, Nanog is involved in a complicated stemness regulatory network in cooperation with other key transcriptional factors, such as Oct, Sox2, and Lin 28, to precisely balance between pluripotency and differentiation tendency [31,32]. Kalmar and colleagues reported that Nanog presents a transcriptional fluctuation between low and high expression level in ES cells [33]. They proposed that the dynamic distribution of Nanog is crucial for ESCs to maintain the undifferentiated state and yet possess the potential to be differentiated without marking definitive commitment if proper differentiation signaling strikes the cells [33]. The tightly regulated Nanog seems to be a key switch that determines the fate of ESCs [34]. Accumulating reports have recently placed interests on identifying stemness-related signaling pathways, and miRNAs, in hope of identifying targets for potential regenerative medicine. Through targeting the core stemness factors such as Oct4, Nanog, and Sox2, the up- and down-regulation of miRNAs including miR134, miR296, and miR470, plays roles in modulating the self-renewal, pluripotency, and differentiation of ESCs [35]. miR-134 was first found directly targeting Nanog in mouse ESCs, through which it promotes mouse ES cell differentiation toward ectodermal lineages [36]. Further research effort on elucidating the mechanisms by which Oct4/Nanog factors regulated by miRNAs in DPSCs is needed.
4. Experimental Section
4.1. Cultivation of Primary Cells from Dental Pulps Tissues
Dental pulp tissues were freshly derived from a caries-free intact premolar that was extracted for orthodontic treatment purpose. All of the clinical samples in this study were collected after obtaining written informed consent and this study was reviewed and approved by the Institutional Review Board in Chung Shan Medical University Hospital (CSMUH No.: CSI13108). Dental pulp tissue was immersed in phosphate buffered saline (Caisson, North Logan, UT, USA) solution and enzymatically dissociated into single cells. These cells were grown in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% FBS, 2 mM l-glutamine, 100 U/mL penicillin-G and 100 μg/mL streptomycin. (GIBCO BRL, Grand Island, NY, USA).
4.2. Identification of Cell Phenotypic Markers by FACS
Dental pulp cells were used for phenotypic marker identification by flow cytometry. 105 cells were resuspended in 100 μL PBS and incubated with primary STRO-1 and CD146 antibodies at 4 °C for 1 h with 1:100 dilutions. The labeled cells were suspended in 100 μL PBS with 1 μL goat anti-mouse IgG conjugated with FITC (Chemicon Inc., Temicula, CA, USA) at 4 °C for 1 h, then examined with a FACSCalibur apparatus (Becton Dickinson, La Jolla, CA, USA)
4.4. Stable Overexpression of Oct4 and Nanog in DPC Cells (DPCs)
Human Oct4 and Nanog cDNA template were cloned into pCDH1-MCS1-EF1-copGFP (System Biosciences, Cat. No.: CD511A-1; Mountain View, CA, USA). Lentivirus production was performed as above. Stable Oct4/Nanog-overexpressing DPC cells were further purified by cell sorting with GFP positive cells. The pCDH1-MCS1-EF1-copGFP empty vector alone was utilized for the experimental control.
4.5. Quantitative Real-Time Reverse-Transcriptase (RT)-PCR
Briefly, total RNA (1 μg) of each sample was reverse-transcribed in a 20-μL reaction using 0.5 μg oligo(dT) and 200 U Superscript II RT (Invitrogen, Carlsbad, CA, USA). The amplification was carried out in a total volume of 20 μL containing 0.5 μM of each primer, 4 mM MgCl2, 2 ΜL LightCycler™–FastStart DNA Master SYBR green I (Roche Molecular Systems, Alameda, CA, USA) and 2 μL of 1:10 diluted cDNA. PCR reactions were prepared in duplicate and heated to 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 10 s, annealing at 55 °C for 5 s, and extension at 72 °C for 20 s. Standard curves (cycle threshold values versus template concentration) were prepared for each target gene and for the endogenous reference (GAPDH) in each sample. Quantification of unknown samples was performed using LightCycler Relative Quantification Software version 3.3 (Roche Molecular Systems). Primer sequences are listed in Table 1.
Table 1.
The sequences of the primers for quantitative RT-PCR.
| Gene (Accession No.) | Primer Sequence (5' to 3') | Product Size (bp) | Tm (°C) |
|---|---|---|---|
| Oct4 (NM_002701) | F: GTGGAGAGCAACTCCGATG | 86 | 60 |
| R: TGCTCCAGCTTCTCCTTCTC | |||
| Nanog (NM_024865) | F: ATTCAGGACAGCCCTGATTCTTC | 76 | 60 |
| R: TTTTTGCGACACTCTTCTCTGC | |||
| Sox2 (NM_003106) | F: GACTTCACATGTCCCAGCACTA | 156 | 60 |
| R: CTCTTTTGCACCCCTCCCATT | |||
| ALP (NM_000478) | F: CCACGTCTTCACATTTGGTG | 99 | 60 |
| R: ATGGCAGTGAAGGGCTTCTT | |||
| DSPP (NM_014208) | F: TCACAAGGGAGAAGGGAATG | 187 | 60 |
| R: CTGGATGCCATTTGCTGTGA | |||
| OCN (NM_199173) | F: GGCAGCGAGGTAGTGAAGAG | 160 | 60 |
| R: GCCGATAGGCCTCCTGAAAG | |||
| BSP (NM_004967) | F: AAAGTGAGAACGGGGAACCT | 95 | 60 |
| R: ACCATCATAGCCATCGTAGCC | |||
| GAPDH (NM_002046) | F: CATCATCCCTGCCTCTACTG | 180 | 60 |
| R: GCCTGCTTCACCACCTTC |
4.6. Western Blot Assay
The extraction of proteins from cells and immunoblotting analysis were performed. Fifteen microliters of sample was boiled at 95 °C for 5 min and separated on 10% acrylamide gels for SDS-PAGE. The proteins were transferred to Hybond-ECL nitrocellulose paper or PVDF membrane (Amersham, Arlington Heights, IL, USA) by a wet-transfer system. The reactive protein bands were detected by the ECL detection system (Amersham).
4.7. Assays for Cell Proliferation
An MTT assay kit (Sigma-Aldrich, Oakville, ON, Canada) was used to analyze the cell proliferation. Specifically, 1 × 103 cells were seeded in each well of a 24-well plate, and then 10 μL of MTT solution was added to the cells which were then incubated at 37 °C for 3 h. The supernatant was removed, and 200 μL of DMSO were added directly to the cells. The MTT color reaction was analyzed using a microplate reader set at A560 nm.
4.8. Alkaline Phosphatase Activity (ALP)
For detecting the ALP activity of cells on original plates, cells were fixed with 80% alcohol, and then fixed cells were stained using the Vector Blue Alkaline Phosphatase Substrate Kit III (Vector Laboratories Inc., Burlingame, CA, USA) according to the manufacturer’s instructions.
4.9. In Vitro Osteogenic Differentiation
Cells were cultured in DMEM-LG (Invitrogen) supplemented with 15% FBS, 50 μg/mL ascorbate-2-phosphate, 10 nmol/L dexamethasone, and 10 mmol/L β-glycerophosphate (Sigma, St. Louis, MO, USA) for 2 weeks. At the end of osteogenic induction, cells were washed twice with PBS, fixed for 10 min at room temperature with 3.7% paraformaldehyde, and stained with Alizarin red to assess osteogenic differentiation.
4.10. In Vitro Chondrogenic Differentiation
Cells were cultured in DMEM High Glucose supplemented with ITS + Premix: 6.25 μg/mL insulin, 6.25 μg/mL transferrin, 5.33 μg/mL linoleic acid, 1.25 μg/mL bovine serum albumin, 10−7 M dexamethasone, 50 μg/mL ascorbate-2 phosphate, 1 μM sodium pyruvate, 100 μg/mL penicillin and 10 μg/mL streptomycin) (Sigma) in the presence of TGF-β1 (10 ng/mL) (Mylteny, Bergisch, Gladbach, Germany) for 2 weeks. At the end of chondrogenic induction, cells were washed twice with PBS, fixed for 10 min at room temperature with 3.7% paraformaldehyde, and stained with Alcian Blue to assess chondrogenic differentiation.
4.11. In Vitro Adipogenic Differentiation
Cells were cultured in α-MEM supplemented with 16.6% FBS, 50 μg/mL ascorbate-2 phosphate, 10−7 M dexamethasone, 50 μM indomethacin, 0.45 mM 3-isobutyl-1-methyl-xanthine and 10 μg/mL insulin for 2 weeks. At the end of adipogenic induction, cells were washed twice with PBS, fixed for 10 min at room temperature with 3.7% paraformaldehyde, and stained with Oil Red O to assess adipogenic differentiation.
4.12. Statistical Analysis
The statistical package of Social Sciences software (version 13.0) (SPSS, Inc., Chicago, IL, USA) was used for statistical analysis. Student’s t test was used to determine the statistical significance of differences between experimental groups; p values less than 0.05 were considered statistically significant.
5. Conclusions
Oct4 and Nanog may act as the major regulators in the maintenance of MSCs properties in DPSCs. After receiving proper differentiation induction, these Oct4/Nanog overexpressing DPCs increase osteogenic/chondrogenic/adipogenic properties that highly expressed various osteogenic/chondrogenic/adipogenic differentiation markers. Our findings may provide an alternative cell source and strategy for personalized therapies for human dental disease. Further studies to identify the cellular functions and molecular mechanisms of Oct4 and Nanog in DPSCs are critical to have a better insight into their potential contribution to regenerative medicine.
Supplementary Materials
Supplementary figure can be found at http://www.mdpi.com/1422-0067/15/10/18623/s1.
Supplementary Files
Supplementary File 1Acknowledgments
This study is supported by a research grant from Ministry of Science and Technology (NSC102-2314-B-040-012) in Taiwan, ROC.
Author Contributions
Chuan-En Huang, Ming-Yung Chou, and Cheng-Chia Yu contributed to study concept and design, analysis and interpretation of data and drafting of the manuscript. Fang-Wei Hu, Lo-Lin Tsai, and Tzu-Hsin Lee contributed to acquisition of data, technical support and critically revised the manuscript for important intellectual content. Chuan-Hang Yu contributed to analysis and interpretation of data and revised the manuscript for important intellectual content.
Conflicts of Interest
The authors declare no conflict of interest.
References
- Gronthos, S.; Brahim, J.; Li, W.; Fisher, L.W.; Cherman, N.; Boyde, A.; DenBesten, P.; Robey, P.G.; Shi, S. Stem cell properties of human dental pulp stem cells. J. Dent. Res. 2002, 81, 531–535. [Google Scholar] [CrossRef] [PubMed]
- Gronthos, S.; Mankani, M.; Brahim, J.; Robey, P.G.; Shi, S. Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc. Natl. Acad. Sci. USA 2000, 97, 13625–13630. [Google Scholar] [CrossRef]
- Yu, J.; He, H.; Tang, C.; Zhang, G.; Li, Y.; Wang, R.; Shi, J.; Jin, Y. Differentiation potential of STRO-1+ dental pulp stem cells changes during cell passaging. BMC Cell Biol. 2010, 11, 32. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.M.; Shin, S.Y.; Jue, S.S.; Kwon, I.K.; Cho, E.H.; Cho, E.S.; Park, S.H.; Kim, E.C. The role of PIN1 on odontogenic and adipogenic differentiation in human dental pulp stem cells. Stem Cells Dev. 2014, 23, 618–630. [Google Scholar] [CrossRef] [PubMed]
- Nakatsuka, R.; Nozaki, T.; Uemura, Y.; Matsuoka, Y.; Sasaki, Y.; Shinohara, M.; Ohura, K.; Sonoda, Y. 5-Aza-2'-deoxycytidine treatment induces skeletal myogenic differentiation of mouse dental pulp stem cells. Arch. Oral Biol. 2010, 55, 350–357. [Google Scholar] [CrossRef] [PubMed]
- Ishkitiev, N.; Yaegaki, K.; Imai, T.; Tanaka, T.; Nakahara, T.; Ishikawa, H.; Mitev, V.; Haapasalo, M. High-purity hepatic lineage differentiated from dental pulp stem cells in serum-free medium. J. Endod. 2012, 38, 475–480. [Google Scholar] [CrossRef] [PubMed]
- Arthur, A.; Rychkov, G.; Shi, S.; Koblar, S.A.; Gronthos, S. Adult human dental pulp stem cells differentiate toward functionally active neurons under appropriate environmental cues. Stem Cells 2008, 26, 1787–1795. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Rao, S.; Chu, J.; Shen, X.; Levasseur, D.N.; Theunissen, T.W.; Orkin, S.H. A protein interaction network for pluripotency of embryonic stem cells. Nature 2006, 444, 364–368. [Google Scholar] [CrossRef] [PubMed]
- Korkola, J.E.; Houldsworth, J.; Chadalavada, R.S.; Olshen, A.B.; Dobrzynski, D.; Reuter, V.E.; Bosl, G.J.; Chaganti, R.S. Down-regulation of stem cell genes, including those in a 200-kb gene cluster at 12p13.31, is associated with in vivo differentiation of human male germ cell tumors. Cancer Res. 2006, 66, 820–827. [Google Scholar] [CrossRef] [PubMed]
- Williams, R.L.; Hilton, D.J.; Pease, S.; Willson, T.A.; Stewart, C.L.; Gearing, D.P.; Wagner, E.F.; Metcalf, D.; Nicola, N.A.; Gough, N.M. Myeloid leukaemia inhibitory factor maintains the developmental potential of embryonic stem cells. Nature 1988, 336, 684–687. [Google Scholar] [CrossRef] [PubMed]
- Niwa, H.; Miyazaki, J.; Smith, A.G. Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat. Genet. 2000, 24, 372–376. [Google Scholar] [CrossRef] [PubMed]
- Chambers, I.; Colby, D.; Robertson, M.; Nichols, J.; Lee, S.; Tweedie, S.; Smith, A. Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell 2003, 113, 643–655. [Google Scholar] [CrossRef] [PubMed]
- Park, I.H.; Zhao, R.; West, J.A.; Yabuuchi, A.; Huo, H.; Ince, T.A.; Lerou, P.H.; Lensch, M.W.; Daley, G.Q. Reprogramming of human somatic cells to pluripotency with defined factors. Nature 2008, 451, 141–146. [Google Scholar] [CrossRef] [PubMed]
- Huang, G.T.; Gronthos, S.; Shi, S. Mesenchymal stem cells derived from dental tissues vs. those from other sources: Their biology and role in regenerative medicine. J. Dent. Res. 2009, 88, 792–806. [Google Scholar] [CrossRef] [PubMed]
- Coutts, M.; Keirstead, H.S. Stem cells for the treatment of spinal cord injury. Exp. Neurol. 2008, 209, 368–377. [Google Scholar] [CrossRef] [PubMed]
- Waddington, R.J.; Youde, S.J.; Lee, C.P.; Sloan, A.J. Isolation of distinct progenitor stem cell populations from dental pulp. Cells Tissues Organs 2009, 189, 268–274. [Google Scholar] [CrossRef] [PubMed]
- Suchanek, J.; Soukup, T.; Ivancakova, R.; Karbanova, J.; Hubkova, V.; Pytlik, R.; Kucerova, L. Human Dental Pulp Stem Cells—Isolation and Long Term Cultivation. Acta Medica 2007, 50, 195–201. [Google Scholar] [PubMed]
- Li, H.Y.; Chien, Y.; Chen, Y.J.; Chen, S.F.; Chang, Y.L.; Chiang, C.H.; Jeng, S.Y.; Chang, C.M.; Wang, M.L.; Chen, L.K.; et al. Reprogramming induced pluripotent stem cells in the absence of c-Myc for differentiation into hepatocyte-like cells. Biomaterials 2011, 32, 5994–6005. [Google Scholar] [PubMed]
- Nakagawa, M.; Koyanagi, M.; Tanabe, K.; Takahashi, K.; Ichisaka, T.; Aoi, T.; Okita, K.; Mochiduki, Y.; Takizawa, N.; Yamanaka, S. Generation of induced pluripotent stem cells without Myc from mouse and human fibroblasts. Nat. Biotechnol. 2008, 26, 101–106. [Google Scholar] [CrossRef] [PubMed]
- Biniszkiewicz, D.; Gribnau, J.; Ramsahoye, B.; Gaudet, F.; Eggan, K.; Humpherys, D.; Mastrangelo, M.A.; Jun, Z.; Walter, J.; Jaenisch, R. Dnmt1 overexpression causes genomic hypermethylation, loss of imprinting, and embryonic lethality. Mol. Cell. Biol. 2002, 22, 2124–2135. [Google Scholar] [CrossRef] [PubMed]
- Mohan, K.N.; Chaillet, J.R. Cell and molecular biology of DNA methyltransferase 1. Int. Rev. Cell Mol. Biol. 2013, 306, 1–42. [Google Scholar] [PubMed]
- Tsai, C.C.; Su, P.F.; Huang, Y.F.; Yew, T.L.; Hung, S.C. Oct4 and Nanog directly regulate Dnmt1 to maintain self-renewal and undifferentiated state in mesenchymal stem cells. Mol. Cell 2012, 47, 169–182. [Google Scholar] [CrossRef] [PubMed]
- Lamouille, S.; Xu, J.; Derynck, R. Molecular mechanisms of epithelial-mesenchymal transition. Nat. Rev. Mol. Cell Biol. 2014, 15, 178–196. [Google Scholar] [CrossRef] [PubMed]
- Thiery, J.P.; Acloque, H.; Huang, R.Y.J.; Nieto, M.A. Epithelial-mesenchymal transitions in development and disease. Cell 2009, 139, 871–890. [Google Scholar] [CrossRef] [PubMed]
- Lolli, A.; Lambertini, E.; Penolazzi, L.; Angelozzi, M.; Morganti, C.; Franceschetti, T.; Pelucchi, S.; Gambari, R.; Piva, R. Pro-chondrogenic effect of miR-221 and slug depletion in human MSCs. Stem Cell Rev. 2014, 1–15. [Google Scholar]
- Chiou, S.H.; Wang, M.L.; Chou, Y.T.; Chen, C.J.; Hong, C.F.; Hsieh, W.J.; Chang, H.T.; Chen, Y.S.; Lin, T.W.; Hsu, H.S.; et al. Coexpression of Oct4 and Nanog enhances malignancy in lung adenocarcinoma by inducing cancer stem cell-like properties and epithelial-mesenchymal transdifferentiation. Cancer Res. 2010, 70, 10433–10444. [Google Scholar] [CrossRef] [PubMed]
- Tsai, L.L.; Hu, F.W.; Lee, S.S.; Yu, C.H.; Yu, C.C.; Chang, Y.C. Oct4 mediates tumor initiating properties in oral squamous cell carcinomas through the regulation of epithelial-mesenchymal transition. PLoS One 2014, 9, e87207. [Google Scholar] [CrossRef] [PubMed]
- Lu, Y.; Zhu, H.; Shan, H.; Lu, J.; Chang, X.; Li, X.; Fan, X.; Zhu, S.; Wang, Y.; Guo, Q.; et al. Knockdown of Oct4 and Nanog expression inhibits the stemness of pancreatic cancer cells. Cancer Lett. 2013, 340, 113–123. [Google Scholar] [CrossRef] [PubMed]
- Han, J.; Zhang, F.; Yu, M.; Zhao, P.; Ji, W.; Zhang, H.; Wu, B.; Wang, Y.; Niu, R. RNA interference-mediated silencing of NANOG reduces cell proliferation and induces G0/G1 cell cycle arrest in breast cancer cells. Cancer Lett. 2012, 321, 80–88. [Google Scholar] [CrossRef]
- Choi, S.C.; Choi, J.H.; Park, C.Y.; Ahn, C.M.; Hong, S.J.; Lim, D.S. Nanog regulates molecules involved in stemness and cell cycle-signaling pathway for maintenance of pluripotency of P19 embryonal carcinoma stem cells. J. Cell. Physiol. 2012, 227, 3678–3692. [Google Scholar] [CrossRef] [PubMed]
- Kuroda, T.; Tada, M.; Kubota, H.; Kimura, H.; Hatano, S.Y.; Suemori, H.; Nakatsuji, N.; Tada, T. Octamer and Sox elements are required for transcriptional cis regulation of Nanog gene expression. Mol. Cell. Biol. 2005, 25, 2475–2485. [Google Scholar] [CrossRef] [PubMed]
- Do, H.J.; Lee, W.Y.; Lim, H.Y.; Oh, J.H.; Kim, D.K.; Kim, J.H.; Kim, T. Two potent transactivation domains in the C-terminal region of human NANOG mediate transcriptional activation in human embryonic carcinoma cells. J. Cell. Biochem. 2009, 106, 1079–1089. [Google Scholar] [CrossRef] [PubMed]
- Kalmar, T.; Lim, C.; Hayward, P.; Munoz-Descalzo, S.; Nichols, J.; Garcia-Ojalvo, J.; Martinez Arias, A. Regulated fluctuations in Nanog expression mediate cell fate decisions in embryonic stem cells. PLoS Biol. 2009, 7, e1000149. [Google Scholar] [CrossRef] [PubMed]
- MacArthur, B.D.; Sevilla, A.; Lenz, M.; Muller, F.J.; Schuldt, B.M.; Schuppert, A.A.; Ridden, S.J.; Stumpf, P.S.; Fidalgo, M.; Ma’ayan, A.; et al. Nanog-dependent feedback loops regulate murine embryonic stem cell heterogeneity. Nat. Cell Biol. 2012, 14, 1139–1147. [Google Scholar] [PubMed]
- Tay, Y.; Zhang, J.; Thomson, A.M.; Lim, B.; Rigoutsos, I. MicroRNAs to Nanog, Oct4 and Sox2 coding regions modulate embryonic stem cell differentiation. Nature 2008, 455, 1124–1128. [Google Scholar] [CrossRef] [PubMed]
- Tay, Y.M.; Tam, W.L.; Ang, Y.S.; Gaughwin, P.M.; Yang, H.; Wang, W.; Liu, R.; George, J.; Ng, H.H.; Perera, R.J.; et al. MicroRNA-134 modulates the differentiation of mouse embryonic stem cells, where it causes post-transcriptional attenuation of Nanog and LRH1. Stem Cells 2008, 26, 17–29. [Google Scholar] [CrossRef] [PubMed]
© 2014 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).