Concurrent Expression of Oct4 and Nanog Maintains Mesenchymal Stem-Like Property of Human Dental Pulp Cells
Abstract
:1. Introduction
2. Results
2.1. Increased Expression of Oct4 and Nanog Expression in STRO-1+CD146+ DPSCs (Dental Pulp Stem Cells)
2.2. Silencing Oct4 or Nanog Expression Did not Affect the Proliferation Rate and ALP (Alkaline Phosphatase) Activity in STRO-1+CD146+ DPSCs
2.3. Down-Regulation of Oct4 and Nanog co-Expression Reduces the Proliferation Rate and Odontogenic/Osteogenic Properties in STRO-1+CD146+ DPSCs
2.4. Overexpression of Oct4/Nanog Enhanced Stemness and Proliferation Activity of DPCs
2.5. Overexpression of Oct4/Nanog Increased Osteogenic/Chondrogenic/Adipogenic Properties of DPCs
3. Discussion
4. Experimental Section
4.1. Cultivation of Primary Cells from Dental Pulps Tissues
4.2. Identification of Cell Phenotypic Markers by FACS
4.4. Stable Overexpression of Oct4 and Nanog in DPC Cells (DPCs)
4.5. Quantitative Real-Time Reverse-Transcriptase (RT)-PCR
Gene (Accession No.) | Primer Sequence (5' to 3') | Product Size (bp) | Tm (°C) |
---|---|---|---|
Oct4 (NM_002701) | F: GTGGAGAGCAACTCCGATG | 86 | 60 |
R: TGCTCCAGCTTCTCCTTCTC | |||
Nanog (NM_024865) | F: ATTCAGGACAGCCCTGATTCTTC | 76 | 60 |
R: TTTTTGCGACACTCTTCTCTGC | |||
Sox2 (NM_003106) | F: GACTTCACATGTCCCAGCACTA | 156 | 60 |
R: CTCTTTTGCACCCCTCCCATT | |||
ALP (NM_000478) | F: CCACGTCTTCACATTTGGTG | 99 | 60 |
R: ATGGCAGTGAAGGGCTTCTT | |||
DSPP (NM_014208) | F: TCACAAGGGAGAAGGGAATG | 187 | 60 |
R: CTGGATGCCATTTGCTGTGA | |||
OCN (NM_199173) | F: GGCAGCGAGGTAGTGAAGAG | 160 | 60 |
R: GCCGATAGGCCTCCTGAAAG | |||
BSP (NM_004967) | F: AAAGTGAGAACGGGGAACCT | 95 | 60 |
R: ACCATCATAGCCATCGTAGCC | |||
GAPDH (NM_002046) | F: CATCATCCCTGCCTCTACTG | 180 | 60 |
R: GCCTGCTTCACCACCTTC |
4.6. Western Blot Assay
4.7. Assays for Cell Proliferation
4.8. Alkaline Phosphatase Activity (ALP)
4.9. In Vitro Osteogenic Differentiation
4.10. In Vitro Chondrogenic Differentiation
4.11. In Vitro Adipogenic Differentiation
4.12. Statistical Analysis
5. Conclusions
Supplementary Materials
Supplementary Files
Supplementary File 1Acknowledgments
Author Contributions
Conflicts of Interest
References
- Gronthos, S.; Brahim, J.; Li, W.; Fisher, L.W.; Cherman, N.; Boyde, A.; DenBesten, P.; Robey, P.G.; Shi, S. Stem cell properties of human dental pulp stem cells. J. Dent. Res. 2002, 81, 531–535. [Google Scholar] [CrossRef] [PubMed]
- Gronthos, S.; Mankani, M.; Brahim, J.; Robey, P.G.; Shi, S. Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc. Natl. Acad. Sci. USA 2000, 97, 13625–13630. [Google Scholar] [CrossRef]
- Yu, J.; He, H.; Tang, C.; Zhang, G.; Li, Y.; Wang, R.; Shi, J.; Jin, Y. Differentiation potential of STRO-1+ dental pulp stem cells changes during cell passaging. BMC Cell Biol. 2010, 11, 32. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.M.; Shin, S.Y.; Jue, S.S.; Kwon, I.K.; Cho, E.H.; Cho, E.S.; Park, S.H.; Kim, E.C. The role of PIN1 on odontogenic and adipogenic differentiation in human dental pulp stem cells. Stem Cells Dev. 2014, 23, 618–630. [Google Scholar] [CrossRef] [PubMed]
- Nakatsuka, R.; Nozaki, T.; Uemura, Y.; Matsuoka, Y.; Sasaki, Y.; Shinohara, M.; Ohura, K.; Sonoda, Y. 5-Aza-2'-deoxycytidine treatment induces skeletal myogenic differentiation of mouse dental pulp stem cells. Arch. Oral Biol. 2010, 55, 350–357. [Google Scholar] [CrossRef] [PubMed]
- Ishkitiev, N.; Yaegaki, K.; Imai, T.; Tanaka, T.; Nakahara, T.; Ishikawa, H.; Mitev, V.; Haapasalo, M. High-purity hepatic lineage differentiated from dental pulp stem cells in serum-free medium. J. Endod. 2012, 38, 475–480. [Google Scholar] [CrossRef] [PubMed]
- Arthur, A.; Rychkov, G.; Shi, S.; Koblar, S.A.; Gronthos, S. Adult human dental pulp stem cells differentiate toward functionally active neurons under appropriate environmental cues. Stem Cells 2008, 26, 1787–1795. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Rao, S.; Chu, J.; Shen, X.; Levasseur, D.N.; Theunissen, T.W.; Orkin, S.H. A protein interaction network for pluripotency of embryonic stem cells. Nature 2006, 444, 364–368. [Google Scholar] [CrossRef] [PubMed]
- Korkola, J.E.; Houldsworth, J.; Chadalavada, R.S.; Olshen, A.B.; Dobrzynski, D.; Reuter, V.E.; Bosl, G.J.; Chaganti, R.S. Down-regulation of stem cell genes, including those in a 200-kb gene cluster at 12p13.31, is associated with in vivo differentiation of human male germ cell tumors. Cancer Res. 2006, 66, 820–827. [Google Scholar] [CrossRef] [PubMed]
- Williams, R.L.; Hilton, D.J.; Pease, S.; Willson, T.A.; Stewart, C.L.; Gearing, D.P.; Wagner, E.F.; Metcalf, D.; Nicola, N.A.; Gough, N.M. Myeloid leukaemia inhibitory factor maintains the developmental potential of embryonic stem cells. Nature 1988, 336, 684–687. [Google Scholar] [CrossRef] [PubMed]
- Niwa, H.; Miyazaki, J.; Smith, A.G. Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat. Genet. 2000, 24, 372–376. [Google Scholar] [CrossRef] [PubMed]
- Chambers, I.; Colby, D.; Robertson, M.; Nichols, J.; Lee, S.; Tweedie, S.; Smith, A. Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell 2003, 113, 643–655. [Google Scholar] [CrossRef] [PubMed]
- Park, I.H.; Zhao, R.; West, J.A.; Yabuuchi, A.; Huo, H.; Ince, T.A.; Lerou, P.H.; Lensch, M.W.; Daley, G.Q. Reprogramming of human somatic cells to pluripotency with defined factors. Nature 2008, 451, 141–146. [Google Scholar] [CrossRef] [PubMed]
- Huang, G.T.; Gronthos, S.; Shi, S. Mesenchymal stem cells derived from dental tissues vs. those from other sources: Their biology and role in regenerative medicine. J. Dent. Res. 2009, 88, 792–806. [Google Scholar] [CrossRef] [PubMed]
- Coutts, M.; Keirstead, H.S. Stem cells for the treatment of spinal cord injury. Exp. Neurol. 2008, 209, 368–377. [Google Scholar] [CrossRef] [PubMed]
- Waddington, R.J.; Youde, S.J.; Lee, C.P.; Sloan, A.J. Isolation of distinct progenitor stem cell populations from dental pulp. Cells Tissues Organs 2009, 189, 268–274. [Google Scholar] [CrossRef] [PubMed]
- Suchanek, J.; Soukup, T.; Ivancakova, R.; Karbanova, J.; Hubkova, V.; Pytlik, R.; Kucerova, L. Human Dental Pulp Stem Cells—Isolation and Long Term Cultivation. Acta Medica 2007, 50, 195–201. [Google Scholar] [PubMed]
- Li, H.Y.; Chien, Y.; Chen, Y.J.; Chen, S.F.; Chang, Y.L.; Chiang, C.H.; Jeng, S.Y.; Chang, C.M.; Wang, M.L.; Chen, L.K.; et al. Reprogramming induced pluripotent stem cells in the absence of c-Myc for differentiation into hepatocyte-like cells. Biomaterials 2011, 32, 5994–6005. [Google Scholar] [PubMed]
- Nakagawa, M.; Koyanagi, M.; Tanabe, K.; Takahashi, K.; Ichisaka, T.; Aoi, T.; Okita, K.; Mochiduki, Y.; Takizawa, N.; Yamanaka, S. Generation of induced pluripotent stem cells without Myc from mouse and human fibroblasts. Nat. Biotechnol. 2008, 26, 101–106. [Google Scholar] [CrossRef] [PubMed]
- Biniszkiewicz, D.; Gribnau, J.; Ramsahoye, B.; Gaudet, F.; Eggan, K.; Humpherys, D.; Mastrangelo, M.A.; Jun, Z.; Walter, J.; Jaenisch, R. Dnmt1 overexpression causes genomic hypermethylation, loss of imprinting, and embryonic lethality. Mol. Cell. Biol. 2002, 22, 2124–2135. [Google Scholar] [CrossRef] [PubMed]
- Mohan, K.N.; Chaillet, J.R. Cell and molecular biology of DNA methyltransferase 1. Int. Rev. Cell Mol. Biol. 2013, 306, 1–42. [Google Scholar] [PubMed]
- Tsai, C.C.; Su, P.F.; Huang, Y.F.; Yew, T.L.; Hung, S.C. Oct4 and Nanog directly regulate Dnmt1 to maintain self-renewal and undifferentiated state in mesenchymal stem cells. Mol. Cell 2012, 47, 169–182. [Google Scholar] [CrossRef] [PubMed]
- Lamouille, S.; Xu, J.; Derynck, R. Molecular mechanisms of epithelial-mesenchymal transition. Nat. Rev. Mol. Cell Biol. 2014, 15, 178–196. [Google Scholar] [CrossRef] [PubMed]
- Thiery, J.P.; Acloque, H.; Huang, R.Y.J.; Nieto, M.A. Epithelial-mesenchymal transitions in development and disease. Cell 2009, 139, 871–890. [Google Scholar] [CrossRef] [PubMed]
- Lolli, A.; Lambertini, E.; Penolazzi, L.; Angelozzi, M.; Morganti, C.; Franceschetti, T.; Pelucchi, S.; Gambari, R.; Piva, R. Pro-chondrogenic effect of miR-221 and slug depletion in human MSCs. Stem Cell Rev. 2014, 1–15. [Google Scholar]
- Chiou, S.H.; Wang, M.L.; Chou, Y.T.; Chen, C.J.; Hong, C.F.; Hsieh, W.J.; Chang, H.T.; Chen, Y.S.; Lin, T.W.; Hsu, H.S.; et al. Coexpression of Oct4 and Nanog enhances malignancy in lung adenocarcinoma by inducing cancer stem cell-like properties and epithelial-mesenchymal transdifferentiation. Cancer Res. 2010, 70, 10433–10444. [Google Scholar] [CrossRef] [PubMed]
- Tsai, L.L.; Hu, F.W.; Lee, S.S.; Yu, C.H.; Yu, C.C.; Chang, Y.C. Oct4 mediates tumor initiating properties in oral squamous cell carcinomas through the regulation of epithelial-mesenchymal transition. PLoS One 2014, 9, e87207. [Google Scholar] [CrossRef] [PubMed]
- Lu, Y.; Zhu, H.; Shan, H.; Lu, J.; Chang, X.; Li, X.; Fan, X.; Zhu, S.; Wang, Y.; Guo, Q.; et al. Knockdown of Oct4 and Nanog expression inhibits the stemness of pancreatic cancer cells. Cancer Lett. 2013, 340, 113–123. [Google Scholar] [CrossRef] [PubMed]
- Han, J.; Zhang, F.; Yu, M.; Zhao, P.; Ji, W.; Zhang, H.; Wu, B.; Wang, Y.; Niu, R. RNA interference-mediated silencing of NANOG reduces cell proliferation and induces G0/G1 cell cycle arrest in breast cancer cells. Cancer Lett. 2012, 321, 80–88. [Google Scholar] [CrossRef]
- Choi, S.C.; Choi, J.H.; Park, C.Y.; Ahn, C.M.; Hong, S.J.; Lim, D.S. Nanog regulates molecules involved in stemness and cell cycle-signaling pathway for maintenance of pluripotency of P19 embryonal carcinoma stem cells. J. Cell. Physiol. 2012, 227, 3678–3692. [Google Scholar] [CrossRef] [PubMed]
- Kuroda, T.; Tada, M.; Kubota, H.; Kimura, H.; Hatano, S.Y.; Suemori, H.; Nakatsuji, N.; Tada, T. Octamer and Sox elements are required for transcriptional cis regulation of Nanog gene expression. Mol. Cell. Biol. 2005, 25, 2475–2485. [Google Scholar] [CrossRef] [PubMed]
- Do, H.J.; Lee, W.Y.; Lim, H.Y.; Oh, J.H.; Kim, D.K.; Kim, J.H.; Kim, T. Two potent transactivation domains in the C-terminal region of human NANOG mediate transcriptional activation in human embryonic carcinoma cells. J. Cell. Biochem. 2009, 106, 1079–1089. [Google Scholar] [CrossRef] [PubMed]
- Kalmar, T.; Lim, C.; Hayward, P.; Munoz-Descalzo, S.; Nichols, J.; Garcia-Ojalvo, J.; Martinez Arias, A. Regulated fluctuations in Nanog expression mediate cell fate decisions in embryonic stem cells. PLoS Biol. 2009, 7, e1000149. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- MacArthur, B.D.; Sevilla, A.; Lenz, M.; Muller, F.J.; Schuldt, B.M.; Schuppert, A.A.; Ridden, S.J.; Stumpf, P.S.; Fidalgo, M.; Ma’ayan, A.; et al. Nanog-dependent feedback loops regulate murine embryonic stem cell heterogeneity. Nat. Cell Biol. 2012, 14, 1139–1147. [Google Scholar] [PubMed]
- Tay, Y.; Zhang, J.; Thomson, A.M.; Lim, B.; Rigoutsos, I. MicroRNAs to Nanog, Oct4 and Sox2 coding regions modulate embryonic stem cell differentiation. Nature 2008, 455, 1124–1128. [Google Scholar] [CrossRef] [PubMed]
- Tay, Y.M.; Tam, W.L.; Ang, Y.S.; Gaughwin, P.M.; Yang, H.; Wang, W.; Liu, R.; George, J.; Ng, H.H.; Perera, R.J.; et al. MicroRNA-134 modulates the differentiation of mouse embryonic stem cells, where it causes post-transcriptional attenuation of Nanog and LRH1. Stem Cells 2008, 26, 17–29. [Google Scholar] [CrossRef] [PubMed]
© 2014 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, C.-E.; Hu, F.-W.; Yu, C.-H.; Tsai, L.-L.; Lee, T.-H.; Chou, M.-Y.; Yu, C.-C. Concurrent Expression of Oct4 and Nanog Maintains Mesenchymal Stem-Like Property of Human Dental Pulp Cells. Int. J. Mol. Sci. 2014, 15, 18623-18639. https://doi.org/10.3390/ijms151018623
Huang C-E, Hu F-W, Yu C-H, Tsai L-L, Lee T-H, Chou M-Y, Yu C-C. Concurrent Expression of Oct4 and Nanog Maintains Mesenchymal Stem-Like Property of Human Dental Pulp Cells. International Journal of Molecular Sciences. 2014; 15(10):18623-18639. https://doi.org/10.3390/ijms151018623
Chicago/Turabian StyleHuang, Chuan-En, Fang-Wei Hu, Chuan-Hang Yu, Lo-Lin Tsai, Tzu-Hsin Lee, Ming-Yung Chou, and Cheng-Chia Yu. 2014. "Concurrent Expression of Oct4 and Nanog Maintains Mesenchymal Stem-Like Property of Human Dental Pulp Cells" International Journal of Molecular Sciences 15, no. 10: 18623-18639. https://doi.org/10.3390/ijms151018623