RTN3 Regulates the Expression Level of Chemokine Receptor CXCR4 and is Required for Migration of Primordial Germ Cells
Abstract
:1. Introduction
2. Results
2.1. CXCR4 Can Interact with the C-Terminal RTN Homolog Domain of RTN3
2.2. RTN3 Regulates the CXCR4 Expression Level in HEK293 Cells
2.3. Subcellular Localization of CXCR4 is Altered by RTN3 in HeLa Cells
2.4. Enhanced Signaling of RTN3 Results in PGC (Primordial Germ Cell) Migration Defects Similar to Those Caused by CXCR4b Overexpression in Zebrafish Embryos
3. Discussion
4. Experimental Section
4.1. Plasmid Construction
4.2. siRNA Design
4.3. Cell Culture and Transfection
4.4. Yeast Two-Hybrid Screening
4.5. Co-Immunoprecipitation and Immunoblotting
4.6. Quantitative Real-Time PCR
4.7. mRNA Synthesis and Microinjection
4.8. Zebrafish and Transgenic Line
4.9. Immunofluorescence and Microscopy
4.10. Statistical Analysis
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Raz, E. Primordial germ-cell development: The zebrafish perspective. Nat. Rev. Genet. 2003, 4, 690–700. [Google Scholar] [CrossRef] [PubMed]
- Molyneaux, K.; Wylie, C. Primordial germ cell migration. Int. J. Dev. Biol. 2004, 48, 537–544. [Google Scholar] [CrossRef] [PubMed]
- Busillo, J.M.; Benovic, J.L. Regulation of CXCR4 signaling. Biochim. Biophys. Acta 2007, 1768, 952–963. [Google Scholar] [CrossRef] [PubMed]
- Knaut, H.; Werz, C.; Geisler, R.; Nusslein-Volhard, C.; Consortium, T.S. A zebrafish homologue of the chemokine receptor CXCR4 is a germ-cell guidance receptor. Nature 2003, 421, 279–282. [Google Scholar] [CrossRef] [PubMed]
- Murdoch, C. CXCR4: Chemokine receptor extraordinaire. Immunol. Rev. 2000, 177, 175–184. [Google Scholar] [CrossRef] [PubMed]
- Burger, J.A.; Kipps, T.J. CXCR4: A key receptor in the crosstalk between tumor cells and their microenvironment. Blood 2006, 107, 1761–1767. [Google Scholar] [CrossRef] [PubMed]
- Guo, S.; Xiao, D.; Liu, H.; Zheng, X.; Liu, L.; Liu, S. Interfering with CXCR4 expression inhibits proliferation, adhesion and migration of breast cancer MDA-MB-231 cells. Oncol. Lett. 2014, 8, 1557–1562. [Google Scholar] [CrossRef] [PubMed]
- Gilbert, D.; Chandler, I.; McIntyre, A.; Goddard, N.; Gabe, R.; Huddart, R.; Shipley, J. Clinical and biological significance of CXCL12 and CXCR4 expression in adult testes and germ cell tumours of adults and adolescents. J. Pathol. 2009, 217, 94–102. [Google Scholar] [CrossRef] [PubMed]
- Gilbert, D.; Rapley, E.; Shipley, J. Testicular germ cell tumours: Predisposition genes and the male germ cell niche. Nat. Rev. Cancer 2011, 11, 278–288. [Google Scholar] [CrossRef] [PubMed]
- McIver, S.; Loveland, K.; Roman, S.; Nixon, B.; Kitazawa, R.; McLaughlin, E. The chemokine CXCL12 and its receptor CXCR4 are implicated in human seminoma metastasis. Andrology 2013, 1, 517–529. [Google Scholar] [CrossRef] [PubMed]
- Doitsidou, M.; Reichman-Fried, M.; Stebler, J.; Koprunner, M.; Dorries, J.; Meyer, D.; Esguerra, C.V.; Leung, T.; Raz, E. Guidance of primordial germ cell migration by the chemokine SDF-1. Cell 2002, 111, 647–659. [Google Scholar] [CrossRef]
- Minina, S.; Reichman-Fried, M.; Raz, E. Control of receptor internalization, signaling level, and precise arrival at the target in guided cell migration. Curr. Biol. 2007, 17, 1164–1172. [Google Scholar] [CrossRef] [PubMed]
- Van de Velde, H.J.; Roebroek, A.J.; Senden, N.H.; Ramaekers, F.C.; Van de Ven, W.J. NSP-encoded reticulons, neuroendocrine proteins of a novel gene family associated with membranes of the endoplasmic reticulum. J. Cell Sci. 1994, 107, 12403–12416. [Google Scholar] [PubMed]
- De Craene, J.O.; Coleman, J.; Estrada de Martin, P.; Pypaert, M.; Anderson, S.; Yates, J.R., 3rd; Ferro-Novick, S.; Novick, P. Rtn1p is involved in structuring the cortical endoplasmic reticulum. Mol. Biol. Cell 2006, 17, 3009–3020. [Google Scholar] [CrossRef] [PubMed]
- Nziengui, H.; Schoefs, B. Functions of reticulons in plants: What we can learn from animals and yeasts. Cell. Mol. Life Sci. 2009, 66, 584–595. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.S.; Strittmatter, S.M. The reticulons: A family of proteins with diverse functions. Genome Biol. 2007, 8, 234. [Google Scholar] [CrossRef] [PubMed]
- Di Sano, F.; Bernardoni, P.; Piacentini, M. The reticulons: Guardians of the structure and function of the endoplasmic reticulum. Exp. Cell Res. 2012, 318, 1201–1207. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Diekmann, H.; Klinger, M.; Oertle, T.; Heinz, D.; Pogoda, H.M.; Schwab, M.E.; Stuermer, C.A.O. Analysis of the reticulon gene family demonstrates the absence of the neurite growth inhibitor Nogo-A in fish. Mol. Biol. Evol. 2005, 22, 1635–1648. [Google Scholar] [CrossRef] [PubMed]
- Oertle, T.; Klinger, M.; Stuermer, C.A.; Schwab, M.E. A reticular rhapsody: Phylogenic evolution and nomenclature of the RTN/Nogo gene family. FASEB J. 2003, 17, 1238–1247. [Google Scholar] [CrossRef] [PubMed]
- Kume, H.; Konishi, Y.; Murayama, K.S.; Kametani, F.; Araki, W. Expression of reticulon 3 in Alzheimer’s disease brain. Neuropathol. Appl. Neurobiol. 2009, 35, 178–188. [Google Scholar] [CrossRef] [PubMed]
- Cai, Y.; Saiyin, H.; Lin, Q.; Zhang, P.; Tang, L.; Pan, X.; Yu, L. Identification of a new RTN3 transcript, RTN3-A1, and its distribution in adult mouse brain. Mol. Brain Res. 2005, 138, 236–243. [Google Scholar] [CrossRef] [PubMed]
- Moreira, E.F.; Jaworski, C.J.; Rodriguez, I.R. Cloning of a novel member of the reticulon gene family (RTN3): Gene structure and chromosomal localization to 11q13. Genomics 1999, 58, 73–81. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Xiang, R.; Zhao, S. The potential role of RTN3 in monocyte recruitment and atherosclerosis. Mol. Cell. Biochem. 2012, 361, 67–70. [Google Scholar] [CrossRef] [PubMed]
- Chiurchiu, V.; Maccarrone, M.; Orlacchio, A. The role of reticulons in neurodegenerative diseases. NeuroMol. Med. 2014, 16, 3–15. [Google Scholar] [CrossRef] [PubMed]
- Zhu, L.; Xiang, R.; Dong, W.; Liu, Y.; Qi, Y. Anti-apoptotic activity of Bcl-2 is enhanced by its interaction with RTN3. Cell Biol. Int. 2007, 31, 825–830. [Google Scholar] [CrossRef] [PubMed]
- Xiang, R.; Zhao, S. RTN3 inducing apoptosis is modulated by an adhesion protein CRELD1. Mol. Cell. Biochem. 2009, 331, 225–230. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Zhao, S.; Xiang, R. RTN3 and RTN4: Candidate modulators in vascular cell apoptosis and atherosclerosis. J. Cell. Biochem. 2010, 111, 797–800. [Google Scholar] [CrossRef] [PubMed]
- Wan, Q.; Kuang, E.; Dong, W.; Zhou, S.; Xu, H.; Qi, Y.; Liu, Y. Reticulon 3 mediates Bcl-2 accumulation in mitochondria in response to endoplasmic reticulum stress. Apoptosis 2006, 12, 319–328. [Google Scholar] [CrossRef] [PubMed]
- Nazarenko, S.A.; Timoshevsky, V.A.; Sukhanova, N.N. High frequency of tissue-specific mosaicism in turner syndrome patients. Clin. Genet. 1999, 56, 59–65. [Google Scholar] [CrossRef] [PubMed]
- Di Scala, F.; Dupuis, L.; Gaiddon, C.; De Tapia, M.; Jokic, N.; Gonzalez de Aguilar, J.L.; Raul, J.S.; Ludes, B.; Loeffler, J.P. Tissue specificity and regulation of the n-terminal diversity of reticulon 3. Biochem. J. 2005, 385, 125–134. [Google Scholar] [CrossRef] [PubMed]
- Dumstrei, K.; Mennecke, R.; Raz, E. Signaling pathways controlling primordial germ cell migration in zebrafish. J. Cell Sci. 2004, 117, 4787–4795. [Google Scholar] [CrossRef] [PubMed]
- Sloane, A.J.; Raso, V.; Dimitrov, D.S.; Xiao, X.; Deo, S.; Muljadi, N.; Restuccia, D.; Turville, S.; Kearney, C.; Broder, C.C.; et al. Marked structural and functional heterogeneity in CXCR4: Separation of HIV-1 and SDF-1α responses. Immunol. Cell Biol. 2005, 83, 129–143. [Google Scholar] [CrossRef] [PubMed]
- Duquenne, C.; Psomas, C.; Gimenez, S.; Guigues, A.; Carles, M.J.; Barbuat, C.; Lavigne, J.P.; Sotto, A.; Reynes, J.; Guglielmi, P.; et al. The two human CXCR4 isoforms display different HIV receptor activities: Consequences for the emergence of X4 strains. J. Immunol. 2014, 193, 4188–4194. [Google Scholar] [CrossRef] [PubMed]
- Blaser, H.; Reichman-Fried, M.; Castanon, I.; Dumstrei, K.; Marlow, F.L.; Kawakami, K.; Solnica-Krezel, L.; Heisenberg, C.P.; Raz, E. Migration of zebrafish primordial germ cells: A role for myosin contraction and cytoplasmic flow. Dev. Cell 2006, 11, 613–627. [Google Scholar] [CrossRef] [PubMed]
- Tada, H.; Mochii, M.; Orii, H.; Watanabe, K. Ectopic formation of primordial germ cells by transplantation of the germ plasm: Direct evidence for germ cell determinant in Xenopus. Dev. Biol. 2012, 371, 86–93. [Google Scholar] [CrossRef] [PubMed]
- Saito, T.; Goto-Kazeto, R.; Kawakami, Y.; Nomura, K.; Tanaka, H.; Adachi, S.; Arai, K.; Yamaha, E. The mechanism for primordial germ-cell migration is conserved between japanese eel and zebrafish. PLoS ONE 2011, 6, e24460. [Google Scholar] [CrossRef] [PubMed]
- Mur, P.; Pineda, M.; Romero, A.; Del Valle, J.; Borras, E.; Canal, A.; Navarro, M.; Brunet, J.; Rueda, D.; Ramon, Y.C.T.; et al. Identification of a founder epcam deletion in spanish lynch syndrome families. Clin. Genet. 2014, 85, 260–266. [Google Scholar] [CrossRef] [PubMed]
- Shapiro, S.D. Retraction: Stromal-derived factor-1α/CXCL12-CXCR 4 axis is involved in the dissemination of NSCLC cells into pleural space. Am. J. Respir. Cell Mol. Biol. 2008, 39, 380. [Google Scholar] [CrossRef] [PubMed]
- Oonakahara, K.; Matsuyama, W.; Higashimoto, I.; Kawabata, M.; Arimura, K.; Osame, M. Stromal-derived factor-1α/CXCL12-CXCR 4 axis is involved in the dissemination of NSCLC cells into pleural space. Am. J. Respir. Cell Mol. Biol. 2004, 30, 671–677. [Google Scholar] [CrossRef] [PubMed]
Name | Sequence (5′ to 3′) |
---|---|
hCXCR4-F | ATGGAGGGGATCAGTATATA |
hCXCR4-R | TTAGCTGGAGTGAAAACTTG |
hRTN3-F | ATGGCGGAGCCGTCGGCGGC |
hRTN3-R | TTATTCTGCCTTTTTTTTGG |
hRTN2-F | ATGGGGAGTAAAGTGGCGGA |
hRTN2-R | TCATTCGGCTTTGGCTTTGG |
zCXCR4-F | ATGGAATTTTACGATAGCA |
zCXCR4-R | ACTCGTCAGTGCACTGGAC |
zRTN3-F | ATGGCAGACCCAATGACCC |
zRTN3-R | TCATTCTGCTTTACAACGCT |
hRTN3-RT-F | CCATCCATTCAAAGCCTACCTG |
hRTN3-RT-R | CACCAACATAGGTCATCAGCC |
hRTN3-RHD-F | GTGCACGATCTGATTTTCTG |
© 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons by Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, H.; Liang, R.; Lu, Y.; Wang, M.; Li, Z. RTN3 Regulates the Expression Level of Chemokine Receptor CXCR4 and is Required for Migration of Primordial Germ Cells. Int. J. Mol. Sci. 2016, 17, 382. https://doi.org/10.3390/ijms17040382
Li H, Liang R, Lu Y, Wang M, Li Z. RTN3 Regulates the Expression Level of Chemokine Receptor CXCR4 and is Required for Migration of Primordial Germ Cells. International Journal of Molecular Sciences. 2016; 17(4):382. https://doi.org/10.3390/ijms17040382
Chicago/Turabian StyleLi, Haitao, Rong Liang, Yanan Lu, Mengxia Wang, and Zandong Li. 2016. "RTN3 Regulates the Expression Level of Chemokine Receptor CXCR4 and is Required for Migration of Primordial Germ Cells" International Journal of Molecular Sciences 17, no. 4: 382. https://doi.org/10.3390/ijms17040382