Involvement of CmWRKY10 in Drought Tolerance of Chrysanthemum through the ABA-Signaling Pathway
Abstract
:1. Introduction
2. Results
2.1. CmWRKY10 Belongs to WRKY Group IIe Family
2.2. CmWRKY10 Possess Transcriptional Activity in Yeast Cells
2.3. CmWRKY10 Localized in the Nucleus
2.4. CmWRKY10 Overexpression Increased Tolerance against Drought in Chrysanthemums
2.5. CmWRKY10 Confers Drought Tolerance in Chrysanthemums through Abscisic Acid (ABA) Pathway
2.6. Overexpression of CmWRKY10 Reduces Recactive Oxygen Species (ROS) Accumulation due to the Enhanced Activity of Superoxide Dismutase (SOD), Peroxide Dismutase (POD) and Catalase (CAT) under Drought Stress
3. Discussion
4. Materials and Methods
4.1. Plant Material and Growth Conditions
4.2. Sequence Analysis of CmWRKY10
4.3. Transcriptional Activation Analysis in Yeast Cell
4.4. Subcellular Localization
4.5. Chrysanthemum Transformation and Generation of Transgenic Lines
4.6. Drought Stress Tolerance Assay for Transgenic Lines
4.7. Expression Profiling of Drought Stress-Related Genes in Overexpressed (OE) Lines of CmWRKY10
4.8. Measurements of Physiological–Biochemical Parameters
4.9. Statistical Analysis
Acknowledgments
Author contributions
Conflict of interest
References
- Shao, H.B.; Chu, L.Y.; Jaleel, C.A.; Manivannan, P.; Panneerselvam, R.; Shao, M.A. Understanding water deficit stress-induced changes in the basic metabolism of higher plants-biotechnologically and sustainably improving agriculture and the ecoenvironment in arid regions of the globe. Crit. Rev. Biotechnol. 2009, 29, 131–151. [Google Scholar] [CrossRef] [PubMed]
- Tripathi, P.; Rabara, R.C.; Rushton, P.J. A systems biology perspective on the role of WRKY transcription factors in drought responses in plants. Planta 2014, 239, 255–266. [Google Scholar] [CrossRef] [PubMed]
- Mittler, R. Abiotic stress, the field environment and stress combination. Trends Plant Sci. 2006, 11, 15–19. [Google Scholar] [CrossRef] [PubMed]
- Sun, J.; Hu, W.; Zhou, R.; Wang, L.; Wang, X.; Wang, Q.; Feng, Z.; Li, Y.; Qiu, D.; He, G. The Brachypodium distachyon BdWRKY36 gene confers tolerance to drought stress in transgenic tobacco plants. Plant Cell Rep. 2015, 34, 23–35. [Google Scholar] [CrossRef] [PubMed]
- Tang, L.; Cai, H.; Zhai, H.; Luo, X.; Wang, Z.; Cui, L.; Bai, X. Overexpression of Glycinesoja WRKY20 enhances both drought and salt tolerance in transgenic alfalfa (Medicago sativa L.). Plant Cell Tissue Organ Cult. (PCTOC) 2014, 118, 77–86. [Google Scholar] [CrossRef]
- Jiang, S.C.; Mei, C.; Liang, S.; Yu, Y.T.; Lu, K.; Wu, Z.; Wang, X.F.; Zhang, D.P. Crucial roles of the pentatricopeptide repeat protein SOAR1 in Arabidopsis response to drought, salt and cold stresses. Plant Mol. Biol. 2015, 88, 369–385. [Google Scholar] [CrossRef] [PubMed]
- Jakab, G.; Ton, J.; Flors, V.; Zimmerli, L.; Métraux, J.P.; Mauch-Mani, B. Enhancing Arabidopsis salt and drought stress tolerance by chemical priming for its abscisic acid responses. Plant Physiol. 2005, 139, 267–274. [Google Scholar] [CrossRef] [PubMed]
- Ren, X.; Chen, Z.; Liu, Y.; Zhang, H.; Zhang, M.; Liu, Q.; Hong, X.; Zhu, J.K.; Gong, Z. ABO3, a WRKY transcription factor, mediates plant responses to abscisic acid and drought tolerance in Arabidopsis. Plant J. 2010, 63, 417–429. [Google Scholar] [CrossRef] [PubMed]
- Agarwal, P.K.; Agarwal, P.; Reddy, M.; Sopory, S.K. Role of DREB transcription factors in abiotic and biotic stress tolerance in plants. Plant Cell Rep. 2006, 25, 1263–1274. [Google Scholar] [CrossRef] [PubMed]
- Shinozaki, K.; Yamaguchi-Shinozaki, K.; Seki, M. Regulatory network of gene expression in the drought and cold stress responses. Curr. Opin. Plant Biol. 2003, 6, 410–417. [Google Scholar] [CrossRef]
- Eulgem, T.; Rushton, P.J.; Robatzek, S.; Somssich, I.E. The WRKY superfamily of plant transcription factors. Trends Plant Sci. 2000, 5, 199–206. [Google Scholar] [CrossRef]
- Rushton, D.L.; Tripathi, P.; Rabara, R.C.; Lin, J.; Ringler, P.; Boken, A.K.; Langum, T.J.; Smidt, L.; Boomsma, D.D.; Emme, N.J. WRKY transcription factors: Key components in abscisic acid signalling. Plant Biotechnol. J. 2012, 10, 2–11. [Google Scholar] [CrossRef] [PubMed]
- Li, H.L.; Zhang, L.B.; Guo, D.; Li, C.Z.; Peng, S.Q. Identification and expression profiles of the WRKY transcription factor family in Ricinus communis. Gene 2012, 503, 248–253. [Google Scholar] [CrossRef] [PubMed]
- Wei, K.F.; Chen, J.; Chen, Y.F.; Wu, L.J.; Xie, D.X. Molecular phylogenetic and expression analysis of the complete WRKY transcription factor family in maize. DNA Res. 2012, 19, 153–164. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Chen, Y.; Jiang, J.; Chen, S.; Chen, F.; Guan, Z.; Fang, W. The constitutive expression of Chrysanthemum dichrum ICE1 in Chrysanthemum grandiflorum improves the level of low temperature, salinity and drought tolerance. Plant Cell Rep. 2012, 31, 1747–1758. [Google Scholar] [CrossRef] [PubMed]
- Li, J.B.; Luan, Y.S.; Jin, H. The tomato SlWRKY gene plays an important role in the regulation of defense responses in tobacco. Biochem. Biophys. Res. Commun. 2012, 427, 671–676. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Y.; Deyholos, M.K. Functional characterization of Arabidopsis NaCl-inducible WRKY25 and WRKY33 transcription factors in abiotic stresses. Plant Mol. Biol. 2009, 69, 91–105. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Fu, Q.; Huang, W.; Yu, D. Functional analysis of an Arabidopsis transcription factor WRKY25 in heat stress. Plant Cell Rep. 2009, 28, 683–693. [Google Scholar] [CrossRef] [PubMed]
- Cui, X.L.; Chen, F.D.; Chen, S.M. Establishment of regeneration and transformation system of ground-cover chrysanthemum Yuhuaxunzhang. J. Nanjing Agric. Univ. 2009, 32, 40–46. [Google Scholar]
- Chen, H.; Lai, Z.; Shi, J.; Xiao, Y.; Chen, Z.; Xu, X. Roles of Arabidopsis WRKY18, WRKY40 and WRKY60 transcription factors in plant responses to abscisic acid and abiotic stress. BMC Plant Biol. 2010, 10, 281. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Besseau, S.; Törönen, P.; Sipari, N.; Kollist, H.; Holm, L.; Palva, E.T. Defense-related transcription factors WRKY70 and WRKY54 modulate osmotic stress tolerance by regulating stomatal aperture in Arabidopsis. New Phytol. 2013, 200, 457–472. [Google Scholar] [CrossRef] [PubMed]
- Shen, H.; Liu, C.; Zhang, Y.; Meng, X.; Zhou, X.; Chu, C.; Wang, X. OsWRKY30 is activated by MAP kinases to confer drought tolerance in rice. Plant Mol. Biol. 2012, 80, 241–253. [Google Scholar] [CrossRef] [PubMed]
- Qiu, Y.; Yu, D. Over-expression of the stress-induced OsWRKY45 enhances disease resistance and drought tolerance in Arabidopsis. Environ. Exp. Bot. 2009, 65, 35–47. [Google Scholar] [CrossRef]
- Wu, X.; Shiroto, Y.; Kishitani, S.; Ito, Y.; Toriyama, K. Enhanced heat and drought tolerance in transgenic rice seedlings overexpressing OsWRKY11 under the control of HSP101 promoter. Plant Cell Rep. 2009, 28, 21–30. [Google Scholar] [CrossRef] [PubMed]
- Li, P.; Song, A.; Gao, C.; Jiang, J.; Chen, S.; Fang, W.; Zhang, F.; Chen, F. The over-expression of a chrysanthemum WRKY transcription factor enhances aphid resistance. Plant Physiol. Biochem. 2015, 95, 26–34. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Deng, P.; Chen, L.; Wang, X.; Ma, H.; Hu, W.; Yao, N.; Feng, Y.; Chai, R.; Yang, G. A wheat WRKY transcription factor TaWRKY10 confers tolerance to multiple abiotic stresses in transgenic tobacco. PLoS ONE 2013, 8, e65120. [Google Scholar] [CrossRef] [PubMed]
- Mare, C.; Mazzucotelli, E.; Crosatti, C.; Francia, E.; Cattivelli, L. HvWRKY38: A new transcription factor involved in cold-and drought-response in barley. Plant Mol. Biol. 2004, 55, 399–416. [Google Scholar] [CrossRef] [PubMed]
- Da Silva, J.A.T. Chrysanthemum: Advances in tissue culture, cryopreservation, postharvest technology, genetics and transgenic biotechnology. Biotechnol. Adv. 2003, 21, 715–766. [Google Scholar] [CrossRef]
- Song, A.; An, J.; Guan, Z.; Jiang, J.; Chen, F.; Lou, W.; Fang, W.; Liu, Z.; Chen, S. The constitutive expression of a two transgene construct enhances the abiotic stress tolerance of chrysanthemum. Plant Physiol. Biochem. 2014, 80, 114–120. [Google Scholar] [CrossRef] [PubMed]
- Li, P.; Song, A.; Gao, C.; Wang, L.; Wang, Y.; Sun, J.; Jiang, J.; Chen, F.; Chen, S. Chrysanthemum WRKY gene CmWRKY17 negatively regulates salt stress tolerance in transgenic chrysanthemum and Arabidopsis plants. Plant Cell Rep. 2015, 34, 1365–1378. [Google Scholar] [CrossRef] [PubMed]
- Song, A.; Li, P.; Jiang, J.; Chen, S.; Li, H.; Zeng, J.; Shao, Y.; Zhu, L.; Zhang, Z.; Chen, F. Phylogenetic and transcription analysis of chrysanthemum WRKY transcription factors. Int. J. Mol. Sci. 2014, 15, 14442–14455. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Song, Y.; Li, S.; Zhang, L.; Zou, C.; Yu, D. The role of WRKY transcription factors in plant abiotic stresses. BBA-Gene Regul. Mech. 2012, 1819, 120–128. [Google Scholar] [CrossRef] [PubMed]
- Rushton, P.J.; Somssich, I.E.; Ringler, P.; Shen, Q.J. WRKY transcription factors. Trends Plant. Sci. 2010, 15, 247–258. [Google Scholar] [CrossRef] [PubMed]
- Ishiguro, S.; Nakamura, K. Characterization of a cDNA encoding a novel DNA-binding protein, SPF1, that recognizes SP8 sequences in the 5′ upstream regions of genes coding for sporamin and β-amylase from sweet potato. Mol. Gen. Genet. 1994, 244, 563–571. [Google Scholar] [CrossRef] [PubMed]
- Liu, Q.L.; Zhong, M.; Li, S.; Pan, Y.Z.; Jiang, B.-B.; Jia, Y.; Zhang, H.Q. Overexpression of a chrysanthemum transcription factor gene DgWRKY3 in tobacco enhances tolerance to salt stress. Plant Physiol. Biochem. 2013, 69, 27–33. [Google Scholar] [CrossRef] [PubMed]
- Niu, C.F.; Wei, W.; Zhou, Q.Y.; Tian, A.G.; Hao, Y.J.; Zhang, W.K.; Ma, B.; Lin, Q.; Zhang, Z.B.; Zhang, J.S. Wheat WRKY genes TaWRKY2 and TaWRKY19 regulate abiotic stress tolerance in transgenic Arabidopsis plants. Plant Cell Environ. 2012, 35, 1156–1170. [Google Scholar] [CrossRef] [PubMed]
- Nakashima, K.; Yamaguchi-Shinozaki, K.; Shinozaki, K. The transcriptional regulatory network in the drought response and its crosstalk in abiotic stress responses including drought, cold, and heat. Front. Plant Sci. 2014, 5, 170. [Google Scholar] [CrossRef] [PubMed]
- Luo, X.; Bai, X.; Sun, X.; Zhu, D.; Liu, B.; Ji, W.; Cai, H.; Cao, L.; Wu, J.; Hu, M. Expression of wild soybean WRKY20 in Arabidopsis enhances drought tolerance and regulates ABA signalling. J. Exp. Bot. 2013, 64, 2155–2169. [Google Scholar] [CrossRef] [PubMed]
- Sazegari, S.; Niazi, A.; Ahmadi, F.S. A study on the regulatory network with promoter analysis for Arabidopsis DREB-genes. Bioinformation 2015, 11, 101. [Google Scholar] [CrossRef] [PubMed]
- Seki, M.; Kamei, A.; Yamaguchi-Shinozaki, K.; Shinozaki, K. Molecular responses to drought, salinity and frost: Common and different paths for plant protection. Curr. Opin. Biotechnol. 2003, 14, 194–199. [Google Scholar] [CrossRef]
- Jiang, M.; Zhang, J. Water stress-induced abscisic acid accumulation triggers the increased generation of reactive oxygen species and up-regulates the activities of antioxidant enzymes in maize leaves. J. Exp. Bot. 2002, 53, 2401–2410. [Google Scholar] [CrossRef] [PubMed]
- Cai, S.; Jiang, G.; Ye, N.; Chu, Z.; Xu, X.; Zhang, J.; Zhu, G. A key ABA catabolic gene, OsABA8ox3, is involved in drought stress resistance in rice. PLoS ONE 2015, 10, e0116646. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.-S.; Liu, J.H.; Chen, X.J. Overexpression of PtrABF gene, a bZIP transcription factor isolated from Poncirus trifoliata, enhances dehydration and drought tolerance in tobacco via scavenging ROS and modulating expression of stress-responsive genes. BMC Plant Biol. 2010, 10, 230. [Google Scholar] [CrossRef] [PubMed]
- Miller, G.; Suzuki, N.; Ciftci, S.; Mittler, R. Reactive oxygen species homeostasis and signalling during drought and salinity stresses. Plant Cell Environ. 2010, 33, 453–467. [Google Scholar] [CrossRef] [PubMed]
- Foyer, C.H.; Shigeoka, S. Understanding oxidative stress and antioxidant functions to enhance photosynthesis. Plant Physiol. 2011, 155, 93–100. [Google Scholar] [CrossRef] [PubMed]
- Fan, Q.; Song, A.; Xin, J.; Chen, S.; Jiang, J.; Wang, Y.; Li, X.; Chen, F. CmWRKY15 facilitates Alternaria tenuissima infection of chrysanthemum. PLoS ONE 2015, 10, e0143349. [Google Scholar] [CrossRef] [PubMed]
- Zhao, M.; Song, A.; Li, P.; Chen, S.; Jiang, J.; Chen, F. A bHLH transcription factor regulates iron intake under Fe deficiency in chrysanthemum. Sci. Rep. 2014, 4, 6694. [Google Scholar] [CrossRef] [PubMed]
- Song, A.; Zhu, X.; Chen, F.; Gao, H.; Jiang, J.; Chen, S. A chrysanthemum heat shock protein confers tolerance to abiotic stress. Int. J. Mol. Sci. 2014, 15, 5063–5078. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Sequence (5′ to 3′) |
---|---|
CmHyg-F | CTTCTACACAGCCATCGGTCCAG |
CmHyg-R | CGGAAGTGCTTGACATTGGGGAG |
Oligo (dT) | AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTT |
dT-R | AAGCAGTGGTATCAACGCAGAGTAC |
CmEF1α-F | TTTTGGTATCTGGTCCTGGAG |
CmEF1α-R | CCATTCAAGCGACAGACTCA |
CmDREB1A-F | CGGTTTTGGCTATGAGGGGT |
CmDREB1A-R | TTCTTCTGCCAGCGTCACAT |
CmDREB2A-F | GATCGTGGCTGAGAGACTCG |
CmDREB2A-R | TACCCCACGTTCTTTGCCTC |
CmNCED3A-RT-F | AGTATGGTGGTGAGCCGTTGTATCTAC |
CmNCED3B-RT-F | CATACTTGGCGATTGCGGAACCAT |
CmNCED3A-RT-R | GCATTCACAATCTGGAGTTCGGACTTC |
CmNCED3B-RT-R | GGCTCACCACCATACCTCTCATCAC |
CmWRKY10-GATE-SAL-F | CGCGTCGACATGGTGGCTGCATCA |
CmWRKY10-GATE-NOT-R | TTTGCGGCCGCGAACATACTTTGA |
CmWRKY10-DL-F | TGCTCTTTCGCTCCAACCTG |
CmWRKY10-DL-R | TTGTTCAACCAAAACCTCGTCA |
CmCuZnSOD-RT-F | CCATTGTTGACAAGCAGATTCCACTCA |
CmCuZnSOD-RT-R | ATCATCAGGATCAGCATGGACGACTAC |
© 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jaffar, M.A.; Song, A.; Faheem, M.; Chen, S.; Jiang, J.; Liu, C.; Fan, Q.; Chen, F. Involvement of CmWRKY10 in Drought Tolerance of Chrysanthemum through the ABA-Signaling Pathway. Int. J. Mol. Sci. 2016, 17, 693. https://doi.org/10.3390/ijms17050693
Jaffar MA, Song A, Faheem M, Chen S, Jiang J, Liu C, Fan Q, Chen F. Involvement of CmWRKY10 in Drought Tolerance of Chrysanthemum through the ABA-Signaling Pathway. International Journal of Molecular Sciences. 2016; 17(5):693. https://doi.org/10.3390/ijms17050693
Chicago/Turabian StyleJaffar, Muhammad Abuzar, Aiping Song, Muhammad Faheem, Sumei Chen, Jiafu Jiang, Chen Liu, Qingqing Fan, and Fadi Chen. 2016. "Involvement of CmWRKY10 in Drought Tolerance of Chrysanthemum through the ABA-Signaling Pathway" International Journal of Molecular Sciences 17, no. 5: 693. https://doi.org/10.3390/ijms17050693