WC-1 and the Proximal GATA Sequence Mediate a Cis-/Trans-Acting Repressive Regulation of Light-Dependent Gene Transcription in the Dark
Abstract
:Simple Summary
Abstract
1. Introduction
2. Results
2.1. WC-1 is Essential for the Proper Assembly of White Collar Complex (WCC) on Light-Regulated Promoters (LRPs)
2.2. Proximal GATA Sequence in Light Responsive Elements (LREs) is Involved in a Repressive Mechanism of Regulation
2.3. Neurospora Strains Lacking the WC-1 Zinc Finger Domain Show Light-Related Phenotypes Already in the Dark
2.4. Constitutive Gene Transcription and Chromatin Acetylation in the Dark in Myc WC-1 Zinc Finger Deleted Domain
3. Discussion
4. Materials and Methods
4.1. Neurospora Strains and Growth Conditions
4.1.1. Neurospora Strains Used in the Paper
4.1.2. Medium and Growth
4.1.3. Preparation of Dark-Grown Samples and Light Stimulation
4.2. Conidia Count and Carotenoid Content
4.3. Immunoprecipitation Assay
4.4. Chromatin Immunoprecipitation Assay (ChIP)
Promoter region of al-3 | (5′-AGA TAG ATC TCT TGG CCT TG-3′) FW |
(5′-CGA TTA TTG GAA ACC CGT CGG TA-3′) RW | |
Promoter region of actin | (5′-CCT CTC TCA GCC AAA GCA TC-3′) FW |
(5′-GAA AGC TTA CCC CAT TGT CG-3′) RW |
4.5. Nuclei Isolation
4.6. Northern Blot Analysis
4.7. Gel Mobility Shift Assay
al-3 promoter, 41 bp | GCGGTATTATCGTCATAGCGTGCGGGTATCGAATATTGCCC |
20 bp GATA distal | GCGGTATTATCGTCATAGCG |
21 bp GATA proximal | TGCGGGTATCGAATATTGCCC |
GATA distal mutated | GCGGTATGAGAGTCATAGCGTGCGGGTATCGAATATTGCCC |
GATA proximal mutated | GCGGTATTATCGTCATAGCGTGCGGGGAGAGAATATTGCCC |
GATA mutated | GCGGTATGAGAGTCATAGCGTGCGGGGAGAGAATATTGCCC |
4.8. Real-Time qPCR
AL3 F | 5’-CTGTTCCGCTTGGGAATCAA-3’ |
AL3 R | 5’-CGATATGGAAGATAAGTCCGAT-3’ |
WC-1 F | 5’-TTGAAAGCCACGGAACATTGT-3’ |
WC-1 R | 5’-CTGTGTAGAGCAAAAACGGGG |
4.9. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Dodd, A.N.; Salathia, N.; Hall, A.; Kevei, E.; Toth, R.; Nagy, F.; Hibberd, J.M.; Millar, A.J.; Webb, A.A. Plant circadian clocks increase photosynthesis, growth, survival, and competitive advantage. Science 2005, 309, 630–633. [Google Scholar] [CrossRef] [PubMed]
- Michael, T.P.; Salome, P.A.; McClung, C.R. Two Arabidopsis circadian oscillators can be distinguished by differential temperature sensitivity. Proc. Natl. Acad. Sci. USA 2003, 100, 6878–6883. [Google Scholar] [CrossRef] [PubMed]
- Woelfle, M.A.; Ouyang, Y.; Phanvijhitsiri, K.; Johnson, C.H. The adaptive value of circadian clocks: An experimental assessment in cyanobacteria. Curr. Biol. 2004, 14, 1481–1486. [Google Scholar] [CrossRef] [PubMed]
- Corrochano, L.M. Fungal photoreceptors: Sensory molecules for fungal development and behaviour. Photochem. Photobiol. Sci. 2007, 6, 725–736. [Google Scholar] [CrossRef]
- Chen, C.H.; Loros, J.J. Neurospora sees the light: Light signaling components in a model system. Commun. Integr. Biol. 2009, 2, 448–451. [Google Scholar] [CrossRef]
- Linden, H.; Ballario, P.; Macino, G. Blue light regulation in Neurospora crassa. Fungal. Genet. Biol. 1997, 22, 141–150. [Google Scholar] [CrossRef]
- Bahn, Y.S.; Xue, C.; Idnurm, A.; Rutherford, J.C.; Heitman, J.; Cardenas, M.E. Sensing the environment: Lessons from fungi. Nat. Rev. Microbiol. 2007, 5, 57–69. [Google Scholar] [CrossRef]
- Herrera-Estrella, A.; Horwitz, B.A. Looking through the eyes of fungi: Molecular genetics of photoreception. Mol. Microbiol. 2007, 64, 5–15. [Google Scholar] [CrossRef]
- Idnurm, A.; Heitman, J. Light controls growth and development via a conserved pathway in the fungal kingdom. PLoS Biol. 2005, 3, e95. [Google Scholar] [CrossRef]
- Chen, C.H.; Ringelberg, C.S.; Gross, R.H.; Dunlap, J.C.; Loros, J.J. Genome-wide analysis of light-inducible responses reveals hierarchical light signalling in Neurospora. EMBO J. 2009, 28, 1029–1042. [Google Scholar] [CrossRef] [Green Version]
- Cheng, P.; Yang, Y.; Wang, L.; He, Q.; Liu, Y. WHITE COLLAR-1, a multifunctional neurospora protein involved in the circadian feedback loops, light sensing, and transcription repression of wc-2. J. Biol. Chem. 2003, 278, 3801–3808. [Google Scholar] [CrossRef] [PubMed]
- Froehlich, A.C.; Liu, Y.; Loros, J.J.; Dunlap, J.C. White Collar-1, a circadian blue light photoreceptor, binding to the frequency promoter. Science 2002, 297, 815–819. [Google Scholar] [CrossRef] [PubMed]
- He, Q.; Liu, Y. Degradation of the Neurospora circadian clock protein FREQUENCY through the ubiquitin-proteasome pathway. Biochem. Soc. Trans. 2005, 33, 953–956. [Google Scholar] [CrossRef] [PubMed]
- Olmedo, M.; Ruger-Herreros, C.; Luque, E.M.; Corrochano, L.M. A complex photoreceptor system mediates the regulation by light of the conidiation genes con-10 and con-6 in Neurospora crassa. Fungal. Genet. Biol. 2010, 47, 352–363. [Google Scholar] [CrossRef] [PubMed]
- Sommer, T.; Chambers, J.A.; Eberle, J.; Lauter, F.R.; Russo, V.E. Fast light-regulated genes of Neurospora crassa. Nucleic. Acids. Res. 1989, 17, 5713–5723. [Google Scholar] [CrossRef] [PubMed]
- Ballario, P.; Vittorioso, P.; Magrelli, A.; Talora, C.; Cabibbo, A.; Macino, G. White collar-1, a central regulator of blue light responses in Neurospora, is a zinc finger protein. EMBO J. 1996, 15, 1650–1657. [Google Scholar] [CrossRef] [PubMed]
- Linden, H.; Macino, G. White collar 2, a partner in blue-light signal transduction, controlling expression of light-regulated genes in Neurospora crassa. EMBO J. 1997, 16, 98–109. [Google Scholar] [CrossRef] [PubMed]
- Ballario, P.; Talora, C.; Galli, D.; Linden, H.; Macino, G. Roles in dimerization and blue light photoresponse of the PAS and LOV domains of Neurospora crassa white collar proteins. Mol. Microbiol. 1998, 29, 719–729. [Google Scholar] [CrossRef] [PubMed]
- Talora, C.; Franchi, L.; Linden, H.; Ballario, P.; Macino, G. Role of a white collar-1-white collar-2 complex in blue-light signal transduction. EMBO J. 1999, 18, 4961–4968. [Google Scholar] [CrossRef] [PubMed]
- He, Q.; Cheng, P.; Yang, Y.; Wang, L.; Gardner, K.H.; Liu, Y. White collar-1, a DNA binding transcription factor and a light sensor. Science 2002, 297, 840–843. [Google Scholar] [CrossRef] [PubMed]
- Smith, K.M.; Sancar, G.; Dekhang, R.; Sullivan, C.M.; Li, S.; Tag, A.G.; Sancar, C.; Bredeweg, E.L.; Priest, H.D.; McCormick, R.F.; et al. Transcription factors in light and circadian clock signaling networks revealed by genomewide mapping of direct targets for neurospora white collar complex. Eukaryot. Cell 2010, 9, 1549–1556. [Google Scholar] [CrossRef] [PubMed]
- Grimaldi, B.; Coiro, P.; Filetici, P.; Berge, E.; Dobosy, J.R.; Freitag, M.; Selker, E.U.; Ballario, P. The Neurospora crassa White Collar-1 dependent blue light response requires acetylation of histone H3 lysine 14 by NGF-1. Mol. Biol. Cell 2006, 17, 4576–4583. [Google Scholar] [CrossRef]
- Brenna, A.; Grimaldi, B.; Filetici, P.; Ballario, P. Physical association of the WC-1 photoreceptor and the histone acetyltransferase NGF-1 is required for blue light signal transduction in Neurospora crassa. Mol. Biol. Cell 2012, 23, 3863–3872. [Google Scholar] [CrossRef] [PubMed]
- Savkur, R.S.; Burris, T.P. The coactivator LXXLL nuclear receptor recognition motif. J. Pept. Res. 2004, 63, 207–212. [Google Scholar] [CrossRef] [PubMed]
- Froehlich, A.C.; Loros, J.J.; Dunlap, J.C. Rhythmic binding of a WHITE COLLAR-containing complex to the frequency promoter is inhibited by FREQUENCY. Proc. Natl. Acad. Sci. USA 2003, 100, 5914–5919. [Google Scholar] [CrossRef] [PubMed]
- He, Q.; Liu, Y. Molecular mechanism of light responses in Neurospora: From light-induced transcription to photoadaptation. Genes Dev. 2005, 19, 2888–2899. [Google Scholar] [CrossRef] [PubMed]
- Heintzen, C.; Liu, Y. The Neurospora crassa circadian clock. Adv. Genet. 2007, 58, 25–66. [Google Scholar] [CrossRef] [PubMed]
- Hurley, J.; Loros, J.J.; Dunlap, J.C. Dissecting the mechanisms of the clock in Neurospora. Methods Enzymol. 2015, 551, 29–52. [Google Scholar] [CrossRef] [PubMed]
- Belden, W.J.; Loros, J.J.; Dunlap, J.C. Execution of the circadian negative feedback loop in Neurospora requires the ATP-dependent chromatin-remodeling enzyme CLOCKSWITCH. Mol. Cell 2007, 25, 587–600. [Google Scholar] [CrossRef]
- Wang, B.; Zhou, X.; Loros, J.J.; Dunlap, J.C. Alternative Use of DNA Binding Domains by the Neurospora White Collar Complex Dictates Circadian Regulation and Light Responses. Mol. Cell Biol. 2015, 36, 781–793. [Google Scholar] [CrossRef]
- Lewis, Z.A.; Correa, A.; Schwerdtfeger, C.; Link, K.L.; Xie, X.; Gomer, R.H.; Thomas, T.; Ebbole, D.J.; Bell-Pedersen, D. Overexpression of White Collar-1 (WC-1) activates circadian clock-associated genes, but is not sufficient to induce most light-regulated gene expression in Neurospora crassa. Mol. Microbiol. 2002, 45, 917–931. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; He, Q.; Cheng, P. Photoreception in Neurospora: A tale of two White Collar proteins. Cell Mol. Life Sci. 2003, 60, 2131–2138. [Google Scholar] [CrossRef] [PubMed]
- Belden, W.J.; Lewis, Z.A.; Selker, E.U.; Loros, J.J.; Dunlap, J.C. CHD1 remodels chromatin and influences transient DNA methylation at the clock gene frequency. PLoS Genet. 2011, 7, e1002166. [Google Scholar] [CrossRef] [PubMed]
- Crosthwaite, S.K.; Dunlap, J.C.; Loros, J.J. Neurospora wc-1 and wc-2: Transcription, photoresponses, and the origins of circadian rhythmicity. Science 1997, 276, 763–769. [Google Scholar] [CrossRef] [PubMed]
- Carattoli, A.; Cogoni, C.; Morelli, G.; Macino, G. Molecular characterization of upstream regulatory sequences controlling the photoinduced expression of the albino-3 gene of Neurospora crassa. Mol. Microbiol. 1994, 13, 787–795. [Google Scholar] [CrossRef]
- Ruger-Herreros, C.; Gil-Sanchez Mdel, M.; Sancar, G.; Brunner, M.; Corrochano, L.M. Alteration of light-dependent gene regulation by the absence of the RCO-1/RCM-1 repressor complex in the fungus Neurospora crassa. PLoS ONE 2014, 9, e95069. [Google Scholar] [CrossRef]
- Franchi, L.; Fulci, V.; Macino, G. Protein kinase C modulates light responses in Neurospora by regulating the blue light photoreceptor WC-1. Mol. Microbiol. 2005, 56, 334–345. [Google Scholar] [CrossRef]
- Cheng, P.; Yang, Y.; Liu, Y. Interlocked feedback loops contribute to the robustness of the Neurospora circadian clock. Proc. Natl. Acad. Sci. USA 2001, 98, 7408–7413. [Google Scholar] [CrossRef]
- Gerace, R.; Montanini, B.; Proietto, M.; Levati, E.; De Luca, C.; Brenna, A.; Filetici, P.; Kohler, A.; Ottonello, S.; Ballario, P. Photoreceptors in the dark: A functional white collar-like complex and other putative light-sensing components encoded by the genome of the subterranean fungus Tuber melanosporum. Fungal. Biol. 2017, 121, 253–263. [Google Scholar] [CrossRef]
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Brenna, A.; Talora, C. WC-1 and the Proximal GATA Sequence Mediate a Cis-/Trans-Acting Repressive Regulation of Light-Dependent Gene Transcription in the Dark. Int. J. Mol. Sci. 2019, 20, 2854. https://doi.org/10.3390/ijms20122854
Brenna A, Talora C. WC-1 and the Proximal GATA Sequence Mediate a Cis-/Trans-Acting Repressive Regulation of Light-Dependent Gene Transcription in the Dark. International Journal of Molecular Sciences. 2019; 20(12):2854. https://doi.org/10.3390/ijms20122854
Chicago/Turabian StyleBrenna, Andrea, and Claudio Talora. 2019. "WC-1 and the Proximal GATA Sequence Mediate a Cis-/Trans-Acting Repressive Regulation of Light-Dependent Gene Transcription in the Dark" International Journal of Molecular Sciences 20, no. 12: 2854. https://doi.org/10.3390/ijms20122854