C2-Ceramide-Induced Rb-Dominant Senescence-Like Phenotype Leads to Human Breast Cancer MCF-7 Escape from p53-Dependent Cell Death
Abstract
:1. Introduction
2. Results
2.1. Discrepant Anti-Proliferation Effects of C2-Ceramide on Two Breast Cancer Cells
2.2. C2-ceramide Induced Senescence-Like Phenotype of MCF-7 Cells
2.3. C2-Ceramide Induced Apoptosis of MDA-MB-231 Cells
2.4. Expression Modulation of SA-Genes Was Modulated by C2-Ceramide
2.5. The Regulation of Senescence- and Pro-Apoptotic Factors in C2-Ceramide-Created Breast Cancer Cells
3. Discussion
4. Materials and Methods
4.1. Preparation of C2-Ceramide
4.2. Reagents
4.3. Cell Cultures
4.4. Cell Proliferation Assessment
4.5. Apoptosis Assessment
4.6. Senescence-Associated β-Galactosidase (SA-β-gal) Staining
4.7. Reverse Transcription-qPCR Assessment
4.8. Western Blotting Assay
4.9. Assessment of p53 Activator
4.10. Statistical Analysis
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Akram, M.; Iqbal, M.; Daniyal, M.; Khan, A.U. Awareness and current knowledge of breast cancer. Biol. Res. 2017, 50, 33. [Google Scholar] [CrossRef] [PubMed]
- Hayflick, L. The limited in vitro lifetime of human diploid cell strains. Exp. Cell Res. 1965, 37, 614–636. [Google Scholar] [CrossRef]
- Gewirtz, D.A.; Holt, S.E.; Elmore, L.W. Accelerated senescence: An emerging role in tumor cell response to chemotherapy and radiation. Biochem. Pharm. 2008, 76, 947–957. [Google Scholar] [CrossRef] [PubMed]
- Mathon, N.F.; Lloyd, A.C. Milestones in cell division: Cell senescence and cancer. Nat. Rev. Cancer 2001, 1, 203. [Google Scholar] [CrossRef] [PubMed]
- Choudhury, A.R.; Ju, Z.; Djojosubroto, M.W.; Schienke, A.; Lechel, A.; Schaetzlein, S.; Jiang, H.; Stepczynska, A.; Wang, C.; Buer, J.; et al. Cdkn1a deletion improves stem cell function and lifespan of mice with dysfunctional telomeres without accelerating cancer formation. Nat. Genet. 2007, 39, 99–105. [Google Scholar] [CrossRef] [PubMed]
- D’Adda di Fagagna, F.; Reaper, P.M.; Clay-Farrace, L.; Fiegler, H.; Carr, P.; Von Zglinicki, T.; Saretzki, G.; Carter, N.P.; Jackson, S.P. A DNA damage checkpoint response in telomere-initiated senescence. Nature 2003, 426, 194–198. [Google Scholar] [CrossRef] [PubMed]
- Campisi, J. Cellular senescence as a tumor-suppressor mechanism. Trends Cell Biol. 2001, 11, S27–S31. [Google Scholar] [CrossRef] [Green Version]
- Serrano, M.; Lin, A.W.; McCurrach, M.E.; Beach, D.; Lowe, S.W. Oncogenic ras provokes premature cell senescence associated with accumulation of p53 and p16INK4a. Cell 1997, 88, 593–602. [Google Scholar] [CrossRef]
- Braig, M.; Lee, S.; Loddenkemper, C.; Rudolph, C.; Peters, A.H.; Schlegelberger, B.; Stein, H.; Dorken, B.; Jenuwein, T.; Schmitt, C.A. Oncogene-induced senescence as an initial barrier in lymphoma development. Nature 2005, 436, 660–665. [Google Scholar] [CrossRef]
- Zhuang, D.; Mannava, S.; Grachtchouk, V.; Tang, W.H.; Patil, S.; Wawrzyniak, J.A.; Berman, A.E.; Giordano, T.J.; Prochownik, E.V.; Soengas, M.S.; et al. C-MYC overexpression is required for continuous suppression of oncogene-induced senescence in melanoma cells. Oncogene 2008, 27, 6623–6634. [Google Scholar] [CrossRef] [Green Version]
- Bartkova, J.; Rezaei, N.; Liontos, M.; Karakaidos, P.; Kletsas, D.; Issaeva, N.; Vassiliou, L.V.; Kolettas, E.; Niforou, K.; Zoumpourlis, V.C.; et al. Oncogene-induced senescence is part of the tumorigenesis barrier imposed by DNA damage checkpoints. Nature 2006, 444, 633–637. [Google Scholar] [CrossRef] [PubMed]
- Al-Hajj, M.; Wicha, M.S.; Benito-Hernandez, A.; Morrison, S.J.; Clarke, M.F. Prospective identification of tumorigenic breast cancer cells. Proc. Natl. Acad. Sci. USA 2003, 100, 3983–3988. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Goodell, M.A.; McKinney-Freeman, S.; Camargo, F.D. Isolation and characterization of side population cells. Methods Mol. Biol. 2005, 290, 343–352. [Google Scholar] [PubMed]
- Ho, M.M.; Ng, A.V.; Lam, S.; Hung, J.Y. Side population in human lung cancer cell lines and tumors is enriched with stem-like cancer cells. Cancer Res. 2007, 67, 4827–4833. [Google Scholar] [CrossRef] [PubMed]
- Sionov, R.V.; Haupt, Y. The cellular response to p53: The decision between life and death. Oncogene 1999, 18, 6145–6157. [Google Scholar] [CrossRef] [PubMed]
- Lacroix, M.; Toillon, R.A.; Leclercq, G. p53 and breast cancer, an update. Endocr. Relat. Cancer 2006, 13, 293–325. [Google Scholar] [CrossRef]
- Prives, C.; Hall, P.A. The p53 pathway. J. Pathol. 1999, 187, 112–126. [Google Scholar] [CrossRef]
- He, C.; Li, L.; Guan, X.; Xiong, L.; Miao, X. Mutant p53 Gain of Function and Chemoresistance: The Role of Mutant p53 in Response to Clinical Chemotherapy. Chemotherapy 2017, 62, 43–53. [Google Scholar] [CrossRef] [PubMed]
- Hientz, K.; Mohr, A.; Bhakta-Guha, D.; Efferth, T. The role of p53 in cancer drug resistance and targeted chemotherapy. Oncotarget 2017, 8, 8921–8946. [Google Scholar] [CrossRef]
- Knappskog, S.; Lonning, P.E. P53 and its molecular basis to chemoresistance in breast cancer. Expert Opin. Ther. Targets 2012, 16, S23–S30. [Google Scholar] [CrossRef]
- Zhang, S.; Zhou, L.; Hong, B.; van den Heuvel, A.P.J.; Prabhu, V.V.; Warfel, N.A.; Kline, C.L.B.; Dicker, D.T.; Kopelovich, L.; El-Deiry, W.S. Small-molecule NSC59984 restores p53 pathway signaling and antitumor effects against colorectal cancer via p73 activation and degradation of mutant p53. Cancer Res. 2015, 75, 3842–3852. [Google Scholar] [CrossRef]
- Yan, W.; Zhang, Y.; Zhang, J.; Liu, S.; Cho, S.J.; Chen, X. Mutant p53 protein is targeted by arsenic for degradation and plays a role in arsenic-mediated growth suppression. J. Biol. Chem. 2011, 286, 17478–17486. [Google Scholar] [CrossRef] [PubMed]
- Gordon, R.R.; Nelson, P.S. Cellular senescence and cancer chemotherapy resistance. Drug Resist. Updates 2012, 15, 123–131. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Skolová, B.; Hudská, K.R.; Pullmannová, P.; Kováčik, A.; Palát, K.; Roh, J.; Fleddermann, J.; Estrela-Lopis, I.; Vávrová, K. Different phase behavior and packing of ceramides with long (C16) and very long (C24) acyls in model membranes: Infrared spectroscopy using deuterated lipids. J. Phys. Chem. B 2014, 118, 10460–10470. [Google Scholar]
- Goldkorn, T.; Chung, S.; Filosto, S. Lung cancer and lung injury: The dual role of ceramide. In Sphingolipids in Disease; Springer: Berlin/Heidelberg, Germany, 2013; pp. 93–113. [Google Scholar]
- Flowers, M.; Fabriás, G.; Delgado, A.; Casas, J.; Abad, J.L.; Cabot, M.C. C6-ceramide and targeted inhibition of acid ceramidase induce synergistic decreases in breast cancer cell growth. Breast Cancer Res. Treat. 2012, 133, 447–458. [Google Scholar] [CrossRef] [PubMed]
- Demarchi, F.; Bertoli, C.; Greer, P.; Schneider, C. Ceramide triggers an NF-κB-dependent survival pathway through calpain. Cell Death Differ. 2005, 12, 512. [Google Scholar] [CrossRef] [PubMed]
- Xu, L.; Deng, X. Suppression of cancer cell migration and invasion by protein phosphatase 2A through dephosphorylation of μ-and m-calpains. J. Biol. Chem. 2006, 281, 35567–35575. [Google Scholar] [CrossRef] [PubMed]
- Lin, I.L.; Chou, H.L.; Lee, J.C.; Chen, F.W.; Fong, Y.; Chang, W.C.; Huang, H.W.; Wu, C.Y.; Chang, W.T.; Wang, H.D.; et al. The antiproliferative effect of C2-ceramide on lung cancer cells through apoptosis by inhibiting Akt and NFkappaB. Cancer Cell Int. 2014, 14, 1. [Google Scholar] [CrossRef]
- Chang, Y.C.; Fong, Y.; Tsai, E.M.; Chang, Y.G.; Chou, H.L.; Wu, C.Y.; Teng, Y.N.; Liu, T.C.; Yuan, S.S.; Chiu, C.C. Exogenous C (8)-Ceramide Induces Apoptosis by Overproduction of ROS and the Switch of Superoxide Dismutases SOD1 to SOD2 in Human Lung Cancer Cells. Int. J. Mol. Sci. 2018, 19, 3010. [Google Scholar] [CrossRef]
- Jiang, C.; Liu, G.; Luckhardt, T.; Antony, V.; Zhou, Y.; Carter, A.B.; Thannickal, V.J.; Liu, R.M. Serpine 1 induces alveolar type II cell senescence through activating p53-p21-Rb pathway in fibrotic lung disease. Aging Cell 2017, 16, 1114–1124. [Google Scholar] [CrossRef]
- Morad, S.A.; Messner, M.C.; Levin, J.C.; Abdelmageed, N.; Park, H.; Merrill, A.H., Jr.; Cabot, M.C. Potential role of acid ceramidase in conversion of cytostatic to cytotoxic end-point in pancreatic cancer cells. Cancer Chemother. Pharm. 2013, 71, 635–645. [Google Scholar] [CrossRef] [PubMed]
- Huang, H.; Zhang, Y.; Liu, X.; Li, Z.; Xu, W.; He, S.; Huang, Y.; Zhang, H. Acid sphingomyelinase contributes to evodiamine-induced apoptosis in human gastric cancer SGC-7901 cells. DNA Cell Biol. 2011, 30, 407–412. [Google Scholar] [CrossRef] [PubMed]
- Fabrias, G.; Bedia, C.; Casas, J.; Abad, J.L.; Delgado, A. Ceramidases in hematological malignancies: Senseless or neglected target? Anti Cancer Agents Med. Chem. 2011, 11, 830–843. [Google Scholar] [CrossRef]
- Kang, J.H.; Garg, H.; Sigano, D.M.; Francella, N.; Blumenthal, R.; Marquez, V.E. Ceramides: Branched alkyl chains in the sphingolipid siblings of diacylglycerol improve biological potency. Bioorg. Med. Chem. 2009, 17, 1498–1505. [Google Scholar] [CrossRef] [PubMed]
- Chou, H.L.; Lin, Y.H.; Liu, W.; Wu, C.Y.; Li, R.N.; Huang, H.W.; Chou, C.H.; Chiou, S.J.; Chiu, C.C. Combination Therapy of Chloroquine and C2-Ceramide Enhances Cytotoxicity in Lung Cancer H460 and H1299 Cells. Cancers 2019, 11, 370. [Google Scholar] [CrossRef] [PubMed]
- Chang, T.C.; Wentzel, E.A.; Kent, O.A.; Ramachandran, K.; Mullendore, M.; Lee, K.H.; Feldmann, G.; Yamakuchi, M.; Ferlito, M.; Lowenstein, C.J.; et al. Transactivation of miR-34a by p53 broadly influences gene expression and promotes apoptosis. Mol. Cell 2007, 26, 745–752. [Google Scholar] [CrossRef] [PubMed]
- He, L.; He, X.; Lim, L.P.; de Stanchina, E.; Xuan, Z.; Liang, Y.; Xue, W.; Zender, L.; Magnus, J.; Ridzon, D.; et al. A microRNA component of the p53 tumour suppressor network. Nature 2007, 447, 1130–1134. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, Q.; Wu, P.C.; Roberson, R.S.; Luk, B.V.; Ivanova, I.; Chu, E.; Wu, D.Y. Survivin and escaping in therapy-induced cellular senescence. Int. J. Cancer 2011, 128, 1546–1558. [Google Scholar] [CrossRef]
- Vaughan, D.E.; Rai, R.; Khan, S.S.; Eren, M.; Ghosh, A.K. Plasminogen Activator Inhibitor-1 Is a Marker and a Mediator of Senescence. Arter. Thromb. Vasc. Biol. 2017, 37, 1446–1452. [Google Scholar] [CrossRef] [Green Version]
- Eren, M.; Boe, A.E.; Klyachko, E.A.; Vaughan, D.E. Role of plasminogen activator inhibitor-1 in senescence and aging. Semin. Thromb. Hemost. 2014, 40, 645–651. [Google Scholar] [CrossRef]
- Armstrong, D.M.F.; Sikka, G.; Armstrong, A.D.C.; Saad, K.R.; Freitas, W.R.; Berkowitz, D.E.; Fagundes, D.J.; Santhanam, L.; Taha, M.O. Knockdown of transglutaminase-2 prevents early age-induced vascular changes in mice1. Acta Cir. Bras. 2018, 33, 991–999. [Google Scholar] [CrossRef] [PubMed]
- Chakradeo, S.; Elmore, L.W.; Gewirtz, D.A. Is Senescence Reversible? Curr. Drug Targets 2016, 17, 460–466. [Google Scholar] [CrossRef] [PubMed]
- Sasaki, M.; Kumazaki, T.; Takano, H.; Nishiyama, M.; Mitsui, Y. Senescent cells are resistant to death despite low Bcl-2 level. Mech. Ageing Dev. 2001, 122, 1695–1706. [Google Scholar] [CrossRef]
- Synnott, N.C.; Bauer, M.R.; Madden, S.; Murray, A.; Klinger, R.; O’Donovan, N.; O’Connor, D.; Gallagher, W.M.; Crown, J.; Fersht, A.R.; et al. Mutant p53 as a therapeutic target for the treatment of triple-negative breast cancer: Preclinical investigation with the anti-p53 drug, PK11007. Cancer Lett. 2018, 414, 99–106. [Google Scholar] [CrossRef] [PubMed]
- Blaess, M.; Le, H.P.; Claus, R.A.; Kohl, M.; Deigner, H.P. Stereospecific induction of apoptosis in tumor cells via endogenous C16-ceramide and distinct transcripts. Cell Death Discov. 2015, 1, 15013. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ogretmen, B.; Pettus, B.J.; Rossi, M.J.; Wood, R.; Usta, J.; Szulc, Z.; Bielawska, A.; Obeid, L.M.; Hannun, Y.A. Biochemical mechanisms of the generation of endogenous long chain ceramide in response to exogenous short chain ceramide in the A549 human lung adenocarcinoma cell line. Role for endogenous ceramide in mediating the action of exogenous ceramide. J. Biol. Chem. 2002, 277, 12960–12969. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.Y.; Hwang, C.C.; Chen, W.Y.; Lee, J.C.; Fu, T.F.; Fang, K.; Chu, Y.C.; Huang, Y.L.; Lin, J.C.; Tsai, W.H.; et al. Additive effects of C (2)-ceramide on paclitaxel-induced premature senescence of human lung cancer cells. Life Sci. 2010, 87, 350–357. [Google Scholar] [CrossRef]
- Spyridopoulos, I.; Mayer, P.; Shook, K.S.; Axel, D.I.; Viebahn, R.; Karsch, K.R. Loss of cyclin A and G1-cell cycle arrest are a prerequisite of ceramide-induced toxicity in human arterial endothelial cells. Cardiovasc. Res. 2001, 50, 97–107. [Google Scholar] [CrossRef]
- Ahn, E.H.; Yang, H.; Hsieh, C.Y.; Sun, W.; Chang, C.C.; Schroeder, J.J. Evaluation of chemotherapeutic and cancer-protective properties of sphingosine and C2-ceramide in a human breast stem cell derived carcinogenesis model. Int. J. Oncol. 2019, 54, 655–664. [Google Scholar] [CrossRef]
- Chiu, C.C.; Chou, H.L.; Chen, B.H.; Chang, K.F.; Tseng, C.H.; Fong, Y.; Fu, T.F.; Chang, H.W.; Wu, C.Y.; Tsai, E.M.; et al. BPIQ, a novel synthetic quinoline derivative, inhibits growth and induces mitochondrial apoptosis of lung cancer cells in vitro and in zebrafish xenograft model. BMC Cancer 2015, 15, 962. [Google Scholar] [CrossRef]
- Dimri, G.P.; Lee, X.; Basile, G.; Acosta, M.; Scott, G.; Roskelley, C.; Medrano, E.E.; Linskens, M.; Rubelj, I.; Pereira-Smith, O. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc. Natl. Acad. Sci. USA 1995, 92, 9363–9367. [Google Scholar] [CrossRef] [PubMed]
Target Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Size (bp) |
---|---|---|---|
GAPDH | CGTCTTCACCATGGAGA | CGGCCATCACGCCCACAGTTT | 310 |
PAI-1 | GTGTTTCAGCAGGTGGCGC | CCGGAACAGCCTGAAGAAGTG | 310 |
SM22 | TGGCGTGATTCTGAGCAA | CTGCCAAGCTGCCCAAGG | 534 |
TGase II | CTCGTGGAGCCAGTTATCAACAGCTAC | TCTCGAAGTTCACCACCAGCTTGTG | 310 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chang, W.-T.; Wu, C.-Y.; Lin, Y.-C.; Wu, M.-T.; Su, K.-L.; Yuan, S.-S.; Wang, H.-M.D.; Fong, Y.; Lin, Y.-H.; Chiu, C.-C. C2-Ceramide-Induced Rb-Dominant Senescence-Like Phenotype Leads to Human Breast Cancer MCF-7 Escape from p53-Dependent Cell Death. Int. J. Mol. Sci. 2019, 20, 4292. https://doi.org/10.3390/ijms20174292
Chang W-T, Wu C-Y, Lin Y-C, Wu M-T, Su K-L, Yuan S-S, Wang H-MD, Fong Y, Lin Y-H, Chiu C-C. C2-Ceramide-Induced Rb-Dominant Senescence-Like Phenotype Leads to Human Breast Cancer MCF-7 Escape from p53-Dependent Cell Death. International Journal of Molecular Sciences. 2019; 20(17):4292. https://doi.org/10.3390/ijms20174292
Chicago/Turabian StyleChang, Wen-Tsan, Chang-Yi Wu, Yin-Chieh Lin, Min-Tsui Wu, Kai-Li Su, Shyng-Shiou Yuan, Hui-Min David Wang, Yao Fong, Yi-Hsiung Lin, and Chien-Chih Chiu. 2019. "C2-Ceramide-Induced Rb-Dominant Senescence-Like Phenotype Leads to Human Breast Cancer MCF-7 Escape from p53-Dependent Cell Death" International Journal of Molecular Sciences 20, no. 17: 4292. https://doi.org/10.3390/ijms20174292