m6A Reader YTHDF2 Regulates LPS-Induced Inflammatory Response
Abstract
:1. Introduction
2. Results
2.1. LPS Stimulation Increases YTHDF2 Expression in RAW 264.7 Cells
2.2. YTHDF2 Knockdown Promotes LPS-Induced Inflammatory Cytokine Expression in RAW 264.7 Cells
2.3. YTHDF2 Knockdown Has Little Effect on Cytokine mRNA Stability
2.4. YTHDF2 Knockdown Activates LPS-induced NF-κB and MAPK Signaling in RAW 264.7 Cells
2.5. YTHDF2 Knockdown Increases MAP2K4 and MAP4K4 Expression and mRNA Stability
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Cell Stimulation
4.3. YTHDF2 Small Interfering RNA (siRNA) Transfection
4.4. Real-Time Quantitative Polymerase Chain Reaction (qRT-PCR)
4.5. Western Blotting
4.6. mRNA Stability Assay
4.7. Statistical Analysis
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Medzhitov, R. Origin and physiological roles of inflammation. Nature 2008, 454, 428–435. [Google Scholar] [CrossRef] [PubMed]
- Park, S.B.; Park, G.H.; Um, Y.; Kim, H.N.; Song, H.M.; Kim, N.; Kim, H.S.; Jeong, J.B. Wood-cultivated ginseng exerts anti-inflammatory effect in LPS-stimulated RAW264.7 cells. Int. J. Biol. Macromol. 2018, 116, 327–334. [Google Scholar] [CrossRef] [PubMed]
- Zou, Y.H.; Zhao, L.; Xu, Y.K.; Bao, J.M.; Liu, X.; Zhang, J.S.; Li, W.; Ahmed, A.; Yin, S.; Tang, G.H. Anti-inflammatory sesquiterpenoids from the Traditional Chinese Medicine Salvia plebeia: Regulates pro-inflammatory mediators through inhibition of NF-kappaB and Erk1/2 signaling pathways in LPS-induced Raw264.7 cells. J. Ethnopharmacol. 2018, 210, 95–106. [Google Scholar] [CrossRef] [PubMed]
- Zou, J.; Guo, P.; Lv, N.; Huang, D. Lipopolysaccharide-induced tumor necrosis factor-alpha factor enhances inflammation and is associated with cancer (Review). Mol. Med. Rep. 2015, 12, 6399–6404. [Google Scholar] [CrossRef] [PubMed]
- Yao, Y.; Liu, K.; Zhao, Y.; Hu, X.; Wang, M. Pterostilbene and 4’-Methoxyresveratrol Inhibited Lipopolysaccharide-Induced Inflammatory Response in RAW264.7 Macrophages. Molecules 2018, 23, 1148. [Google Scholar] [CrossRef] [PubMed]
- Zhao, B.B.; Guo, H.J.; Liu, Y.; Luo, X.Y.; Yang, S.X.; Wang, Y.T.; Leng, X.; Mo, C.F.; Zou, Q. K313, a novel benzoxazole derivative, exhibits anti-inflammatory properties via inhibiting GSK3beta activity in LPS-induced RAW264.7 macrophages. J. Cell. Biochem. 2018, 119, 5382–5390. [Google Scholar] [CrossRef] [PubMed]
- Kaisho, T.; Akira, S. Toll-like receptors and their signaling mechanism in innate immunity. Acta Odontol. Scand. 2009, 59, 124–130. [Google Scholar] [CrossRef]
- Gerstberger, S.; Hafner, M.; Tuschl, T. A census of human RNA-binding proteins. Nat. Rev. Genet. 2014, 15, 829–845. [Google Scholar] [CrossRef] [PubMed]
- Bulbrook, D.; Brazier, H.; Mahajan, P.; Kliszczak, M.; Fedorov, O.; Marchese, F.P.; Aubareda, A.; Chalk, R.; Picaud, S.; Strain-Damerell, C.; et al. Tryptophan-Mediated Interactions between Tristetraprolin and the CNOT9 Subunit Are Required for CCR4-NOT Deadenylase Complex Recruitment. J. Mol. Biol. 2018, 430, 722–736. [Google Scholar] [CrossRef] [PubMed]
- Tiedje, C.; Diaz-Munoz, M.D.; Trulley, P.; Ahlfors, H.; Laass, K.; Blackshear, P.J.; Turner, M.; Gaestel, M. The RNA-binding protein TTP is a global post-transcriptional regulator of feedback control in inflammation. Nucleic Acids Res. 2016, 44, 7418–7440. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fabian, M.R.; Frank, F.; Rouya, C.; Siddiqui, N.; Lai, W.S.; Karetnikov, A.; Blackshear, P.J.; Nagar, B.; Sonenberg, N. Structural basis for the recruitment of the human CCR4-NOT deadenylase complex by tristetraprolin. Nat. Struct. Mol. Biol. 2013, 20, 735–739. [Google Scholar] [CrossRef] [PubMed]
- Astakhova, A.A.; Chistyakov, D.V.; Sergeeva, M.G.; Reiser, G. Regulation of the ARE-binding proteins, TTP (tristetraprolin) and HuR (human antigen R), in inflammatory response in astrocytes. Neurochem. Int. 2018, 118, 82–90. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Hsu, P.J.; Chen, Y.S.; Yang, Y.G. Dynamic transcriptomic m(6)A decoration: Writers, erasers, readers and functions in RNA metabolism. Cell Res. 2018, 28, 616–624. [Google Scholar] [CrossRef] [PubMed]
- Dominissini, D.; Moshitch-Moshkovitz, S.; Schwartz, S.; Salmon-Divon, M.; Ungar, L.; Osenberg, S.; Cesarkas, K.; Jacob-Hirsch, J.; Amariglio, N.; Kupiec, M.; et al. Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature 2012, 485, 201–206. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Wang, X.; Li, C.; Hu, S.; Yu, J.; Song, S. Transcriptome-wide N(6)-methyladenosine profiling of rice callus and leaf reveals the presence of tissue-specific competitors involved in selective mRNA modification. RNA Biol. 2014, 11, 1180–1188. [Google Scholar] [CrossRef] [PubMed]
- Geula, S.; Moshitch-Moshkovitz, S.; Dominissini, D.; Mansour, A.A.; Kol, N.; Salmon-Divon, M.; Hershkovitz, V.; Peer, E.; Mor, N.; Manor, Y.S.; et al. Stem cells. m6A mRNA methylation facilitates resolution of naive pluripotency toward differentiation. Science 2015, 347, 1002–1006. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Sun, Y.; Xu, X.; Wang, D.; He, J.; Zhou, H.; Lu, Y.; Zeng, J.; Du, F.; Gong, A.; et al. YTH domain family 2 orchestrates epithelial-mesenchymal transition/proliferation dichotomy in pancreatic cancer cells. Cell Cycle 2017, 16, 2259–2271. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.; Chen, Y.; Sun, B.; Wang, L.; Yang, Y.; Ma, D.; Lv, J.; Heng, J.; Ding, Y.; Xue, Y.; et al. m(6)A modulates haematopoietic stem and progenitor cell specification. Nature 2017, 549, 273–276. [Google Scholar] [CrossRef] [PubMed]
- Tan, B.; Gao, S.J. RNA epitranscriptomics: Regulation of infection of RNA and DNA viruses by N(6)-methyladenosine (m(6) A). Rev. Med. Virol. 2018, 28, e1983. [Google Scholar] [CrossRef] [PubMed]
- Visvanathan, A.; Patil, V.; Arora, A.; Hegde, A.S.; Arivazhagan, A.; Santosh, V.; Somasundaram, K. Essential role of METTL3-mediated m(6)A modification in glioma stem-like cells maintenance and radioresistance. Oncogene 2018, 37, 522–533. [Google Scholar] [CrossRef] [PubMed]
- Li, A.; Chen, Y.S.; Ping, X.L.; Yang, X.; Xiao, W.; Yang, Y.; Sun, H.Y.; Zhu, Q.; Baidya, P.; Wang, X.; et al. Cytoplasmic m(6)A reader YTHDF3 promotes mRNA translation. Cell Res. 2017, 27, 444–447. [Google Scholar] [CrossRef] [PubMed]
- Coots, R.A.; Liu, X.M.; Mao, Y.; Dong, L.; Zhou, J.; Wan, J.; Zhang, X.; Qian, S.B. m(6)A Facilitates eIF4F-Independent mRNA Translation. Mol. Cell 2017, 68, 504–514. [Google Scholar] [CrossRef] [PubMed]
- Adhikari, S.; Xiao, W.; Zhao, Y.L.; Yang, Y.G. m(6)A: Signaling for mRNA splicing. RNA Biol. 2016, 13, 756–759. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Lu, Z.; Gomez, A.; Hon, G.C.; Yue, Y.; Han, D.; Fu, Y.; Parisien, M.; Dai, Q.; Jia, G.; et al. N6-methyladenosine-dependent regulation of messenger RNA stability. Nature 2014, 505, 117–120. [Google Scholar] [CrossRef] [PubMed]
- Liao, S.; Sun, H.; Xu, C. YTH Domain: A Family of N(6)-methyladenosine (m(6)A) Readers. Genomics Proteomics Bioinform. 2018, 16, 99–107. [Google Scholar] [CrossRef] [PubMed]
- Zhu, T.; Roundtree, I.A.; Wang, P.; Wang, X.; Wang, L.; Sun, C.; Tian, Y.; Li, J.; He, C.; Xu, Y. Crystal structure of the YTH domain of YTHDF2 reveals mechanism for recognition of N6-methyladenosine. Cell Res. 2014, 24, 1493–1496. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, F.; Zhao, D.; Wu, J.; Shi, Y. Structure of the YTH domain of human YTHDF2 in complex with an m(6)A mononucleotide reveals an aromatic cage for m(6)A recognition. Cell Res. 2014, 24, 1490–1492. [Google Scholar] [CrossRef] [PubMed]
- Rauch, S.; He, C.; Dickinson, B.C. Targeted m(6)A Reader Proteins To Study Epitranscriptomic Regulation of Single RNAs. J. Am. Chem. Soc. 2018, 140, 11974–11981. [Google Scholar] [CrossRef] [PubMed]
- Du, H.; Zhao, Y.; He, J.; Zhang, Y.; Xi, H.; Liu, M.; Ma, J.; Wu, L. YTHDF2 destabilizes m(6)A-containing RNA through direct recruitment of the CCR4-NOT deadenylase complex. Nat. Commun. 2016, 7, 12626. [Google Scholar] [CrossRef] [PubMed]
- Hesser, C.R.; Karijolich, J.; Dominissini, D.; He, C.; Glaunsinger, B.A. N6-methyladenosine modification and the YTHDF2 reader protein play cell type specific roles in lytic viral gene expression during Kaposi’s sarcoma-associated herpesvirus infection. PLoS Pathog. 2018, 14, e1006995. [Google Scholar] [CrossRef] [PubMed]
- Chen, M.; Wei, L.; Law, C.T.; Tsang, F.H.; Shen, J.; Cheng, C.L.; Tsang, L.H.; Ho, D.W.; Chiu, D.K.; Lee, J.M.; et al. RNA N6-methyladenosine methyltransferase-like 3 promotes liver cancer progression through YTHDF2-dependent posttranscriptional silencing of SOCS2. Hepatology 2018, 67, 2254–2270. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Qian, P.; Shao, W.; Shi, H.; He, X.C.; Gogol, M.; Yu, Z.; Wang, Y.; Qi, M.; Zhu, Y.; et al. Suppression of m(6)A reader Ythdf2 promotes hematopoietic stem cell expansion. Cell Res. 2018, 28, 904–917. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Zhao, X.; Wang, W.; Shi, H.; Pan, Q.; Lu, Z.; Perez, S.P.; Suganthan, R.; He, C.; Bjoras, M.; et al. Ythdf2-mediated m(6)A mRNA clearance modulates neural development in mice. Genome Biol. 2018, 19, 69. [Google Scholar] [CrossRef] [PubMed]
- Cai, X.; Wang, X.; Cao, C.; Gao, Y.; Zhang, S.; Yang, Z.; Liu, Y.; Zhang, X.; Zhang, W.; Ye, L. HBXIP-elevated methyltransferase METTL3 promotes the progression of breast cancer via inhibiting tumor suppressor let-7g. Cancer Lett. 2018, 415, 11–19. [Google Scholar] [CrossRef] [PubMed]
- Yu, J.; Li, Y.; Wang, T.; Zhong, X. Modification of N6-methyladenosine RNA methylation on heat shock protein expression. PLoS ONE 2018, 13, e0198604. [Google Scholar] [CrossRef] [PubMed]
- Shrestha, A.; Pun, N.T.; Park, P.H. ZFP36L1 and AUF1 Induction Contribute to the Suppression of Inflammatory Mediators Expression by Globular Adiponectin via Autophagy Induction in Macrophages. Biomol. Ther. (Seoul) 2018, 26, 446–457. [Google Scholar] [CrossRef] [PubMed]
- McInnes, I.B.; Schett, G. Pathogenetic insights from the treatment of rheumatoid arthritis. Lancet 2017, 389, 2328–2337. [Google Scholar] [CrossRef] [Green Version]
- Zhong, L.; Liao, D.; Zhang, M.; Zeng, C.; Li, X.; Zhang, R.; Ma, H.; Kang, T. YTHDF2 suppresses cell proliferation and growth via destabilizing the EGFR mRNA in hepatocellular carcinoma. Cancer Lett. 2018, 442, 252–261. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Yin, B.; Li, H.; Xiao, B.; Lu, K.; Feng, C.; He, J.; Li, C. MKK4 from Litopenaeus vannamei is a regulator of p38 MAPK kinase and involved in anti-bacterial response. Dev. Comp. Immunol. 2018, 78, 61–70. [Google Scholar] [CrossRef] [PubMed]
- Raman, M.; Chen, W.; Cobb, M.H. Differential regulation and properties of MAPKs. Oncogene 2007, 26, 3100–3112. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kundumani-Sridharan, V.; Subramani, J.; Das, K.C. Thioredoxin Activates MKK4-NFkappaB Pathway in a Redox-dependent Manner to Control Manganese Superoxide Dismutase Gene Expression in Endothelial Cells. J. Biol. Chem. 2015, 290, 17505–17519. [Google Scholar] [CrossRef] [PubMed]
- Gao, X.; Chen, G.; Gao, C.; Zhang, D.H.; Kuan, S.F.; Stabile, L.P.; Liu, G.; Hu, J. MAP4K4 is a novel MAPK/ERK pathway regulator required for lung adenocarcinoma maintenance. Mol. Oncol. 2017, 11, 628–639. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Virbasius, J.V.; Czech, M.P. Map4k4 Signaling Nodes in Metabolic and Cardiovascular Diseases. Trends Endocrinol. Metab. 2016, 27, 484–492. [Google Scholar] [CrossRef] [PubMed]
- Flach, R.J.R.; Skoura, A.; Matevossian, A.; Danai, L.V.; Zheng, W.; Cortes, C.; Bhattacharya, S.K.; Aouadi, M.; Hagan, N.; Yawe, J.C.; et al. Endothelial protein kinase MAP4K4 promotes vascular inflammation and atherosclerosis. Nat. Commun. 2015, 6, 8995. [Google Scholar] [CrossRef] [PubMed]
- Huang, H.; Tang, Q.; Chu, H.; Jiang, J.; Zhang, H.; Hao, W.; Wei, X. MAP4K4 deletion inhibits proliferation and activation of CD4(+) T cell and promotes T regulatory cell generation in vitro. Cell. Immunol. 2014, 289, 15–20. [Google Scholar] [CrossRef] [PubMed]
siRNA | Sequences (5′-3′) |
---|---|
#1 siRNA | CCAUGAUUGAUGGACAGUCAGCUUU AAAGCUGACUGUCCAUCAAUCAUGG |
#2 siRNA | GGGUGGAUGGUAAUGGAGUAGGACA UGUCCUACUCCAUUACCAUCCACCC |
#3 siRNA | CCCAGUGGGAUUGACUUCUCAGCAU AUGCUGAGAAGUCAAUCCCACUCCC |
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
YTHDF2 | ATAGGAAAAGCCAATGGAGGG | CCAAAAGGTCAAGGAAACAAAG |
TNF-α | CCACCACGCTCTTCTGTCTA | GGTCTGGGCCATAGAACTGA |
IL-1β | CTTTGAAGTTGACGGACCCC | GCTTCTCCACAGCCACAATG |
IL-6 | CCTCTGGTCTTCTGGAGTACC | GGAGAGCATTGGAAATTGGGG |
IL-12 | GTGAACCTCACCTGTGACACGC | TGAATACTTCTCATAGTCCCTTTGG |
MAP2K4 | AATCGACAGCACGGTTTACTC | GCAGTGAAATCCCAGTGTTGTT |
MAP4K4 | CTGGCCGCCATCAAGGTTAT | AGCACCATAGTACGTGGCAAT |
GAPDH | GCAAAGTGGAGATTGTTGCC | TGGAAGATGGTGATGGGCTT |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yu, R.; Li, Q.; Feng, Z.; Cai, L.; Xu, Q. m6A Reader YTHDF2 Regulates LPS-Induced Inflammatory Response. Int. J. Mol. Sci. 2019, 20, 1323. https://doi.org/10.3390/ijms20061323
Yu R, Li Q, Feng Z, Cai L, Xu Q. m6A Reader YTHDF2 Regulates LPS-Induced Inflammatory Response. International Journal of Molecular Sciences. 2019; 20(6):1323. https://doi.org/10.3390/ijms20061323
Chicago/Turabian StyleYu, Ruiqing, Qimeng Li, Zhihui Feng, Luhui Cai, and Qiong Xu. 2019. "m6A Reader YTHDF2 Regulates LPS-Induced Inflammatory Response" International Journal of Molecular Sciences 20, no. 6: 1323. https://doi.org/10.3390/ijms20061323