Antidiabetic and Cardioprotective Effects of Pharmacological Inhibition of GRK2 in db/db Mice
Abstract
:1. Introduction
2. Results
2.1. KRX-C7 Inhibits GRK2 Kinase Activity in L6 Myoblast
2.2. KRX-C7 Improves Insulin Sensitivity
2.3. KRX-C7 Improves Insulin Sensitivity in db/db Mice
2.4. Effects of KRX-C7 Treatment on Insulin Mediated Glucose Transport Ex Vivo
2.5. KRX-C7 Improves Insulin Signaling in db/db Mice
2.6. KRX-C7 Reduces Cardiac Inflammation and Oxidative Stress
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Cell Viability Assay
4.3. KRX-C7 Internalization.
4.4. Deoxy-Glucose Uptake Measurement
4.5. GRK2 Activity Assay
4.6. Animals
4.7. Glucose Tolerance Test
4.8. Insulin Tolerance Test
4.9. Ex Vivo Glucose Uptake
4.10. Insulin Signaling
4.11. Immunoprecipitation and Western Blot
4.12. RNA Extraction and Real Time PCR
4.13. Protein Oxidation
4.14. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- O’Neill, S.; O’Driscoll, L. Metabolic syndrome: A closer look at the growing epidemic and its associated pathologies. Obes. Rev. 2015, 16, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Kahn, C.R. Insulin resistance: A common feature of diabetes mellitus. N. Engl. J. Med. 1986, 315, 252–254. [Google Scholar] [CrossRef] [PubMed]
- Ponikowski, P.; Voors, A.A.; Anker, S.D.; Bueno, H.; Cleland, J.G.; Coats, A.J.; Falk, V.; Gonzalez-Juanatey, J.R.; Harjola, V.P.; Jankowska, E.A.; et al. 2016 ESC Guidelines for the diagnosis and treatment of acute and chronic heart failure: The Task Force for the diagnosis and treatment of acute and chronic heart failure of the European Society of Cardiology (ESC). Developed with the special contribution of the Heart Failure Association (HFA) of the ESC. Eur. J. Heart Fail. 2016, 18, 891–975. [Google Scholar] [PubMed]
- Maack, C.; Lehrke, M.; Backs, J.; Heinzel, F.R.; Hulot, J.S.; Marx, N.; Paulus, W.J.; Rossignol, P.; Taegtmeyer, H.; Bauersachs, J.; et al. Heart failure and diabetes: Metabolic alterations and therapeutic interventions: A state-of-the-art review from the Translational Research Committee of the Heart Failure Association-European Society of Cardiology. Eur. Heart J. 2018, 39, 4243–4254. [Google Scholar] [CrossRef] [PubMed]
- Penela, P.; Ribas, C.; Mayor, F., Jr. Mechanisms of regulation of the expression and function of G protein-coupled receptor kinases. Cell. Signal. 2003, 15, 973–981. [Google Scholar] [CrossRef]
- Premont, R.T.; Gainetdinov, R.R. Physiological roles of G protein-coupled receptor kinases and arrestins. Annu. Rev. Physiol. 2007, 69, 511–534. [Google Scholar] [CrossRef] [PubMed]
- Choi, D.J.; Koch, W.J.; Hunter, J.J.; Rockman, H.A. Mechanism of beta-adrenergic receptor desensitization in cardiac hypertrophy is increased beta-adrenergic receptor kinase. J. Biol. Chem. 1997, 272, 17223–17229. [Google Scholar] [CrossRef]
- Dzimiri, N.; Muiya, P.; Andres, E.; Al-Halees, Z. Differential functional expression of human myocardial G protein receptor kinases in left ventricular cardiac diseases. Eur. J. Pharmacol. 2004, 489, 167–177. [Google Scholar] [CrossRef] [PubMed]
- Sorriento, D.; Fusco, A.; Ciccarelli, M.; Rungi, A.; Anastasio, A.; Carillo, A.; Dorn, G.W., 2nd; Trimarco, B.; Iaccarino, G. Mitochondrial G protein coupled receptor kinase 2 regulates proinflammatory responses in macrophages. FEBS Lett. 2013, 587, 3487–3494. [Google Scholar] [CrossRef] [Green Version]
- Fusco, A.; Santulli, G.; Sorriento, D.; Cipolletta, E.; Garbi, C.; Dorn, G.W., 2nd; Trimarco, B.; Feliciello, A.; Iaccarino, G. Mitochondrial localization unveils a novel role for GRK2 in organelle biogenesis. Cell. Signal. 2012, 24, 468–475. [Google Scholar] [CrossRef] [PubMed]
- Chen, M.; Sato, P.Y.; Chuprun, J.K.; Peroutka, R.J.; Otis, N.J.; Ibetti, J.; Pan, S.; Sheu, S.S.; Gao, E.; Koch, W.J. Prodeath signaling of G protein-coupled receptor kinase 2 in cardiac myocytes after ischemic stress occurs via extracellular signal-regulated kinase-dependent heat shock protein 90-mediated mitochondrial targeting. Circ. Res. 2013, 112, 1121–1134. [Google Scholar] [CrossRef] [PubMed]
- Obrenovich, M.E.; Smith, M.A.; Siedlak, S.L.; Chen, S.G.; de la Torre, J.C.; Perry, G.; Aliev, G. Overexpression of GRK2 in Alzheimer disease and in a chronic hypoperfusion rat model is an early marker of brain mitochondrial lesions. Neurotox. Res. 2006, 10, 43–56. [Google Scholar] [CrossRef] [PubMed]
- Anis, Y.; Leshem, O.; Reuveni, H.; Wexler, I.; Ben Sasson, R.; Yahalom, B.; Laster, M.; Raz, I.; Ben Sasson, S.; Shafrir, E.; et al. Antidiabetic effect of novel modulating peptides of G-protein-coupled kinase in experimental models of diabetes. Diabetologia 2004, 47, 1232–1244. [Google Scholar] [CrossRef] [Green Version]
- Cipolletta, E.; Campanile, A.; Santulli, G.; Sanzari, E.; Leosco, D.; Campiglia, P.; Trimarco, B.; Iaccarino, G. The G protein coupled receptor kinase 2 plays an essential role in beta-adrenergic receptor-induced insulin resistance. Cardiovasc. Res. 2009, 84, 407–415. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ciccarelli, M.; Cipolletta, E.; Iaccarino, G. GRK2 at the control shaft of cellular metabolism. Curr. Pharm. Des. 2012, 18, 121–127. [Google Scholar] [CrossRef] [PubMed]
- Ciccarelli, M.; Chuprun, J.K.; Rengo, G.; Gao, E.; Wei, Z.; Peroutka, R.J.; Gold, J.I.; Gumpert, A.; Chen, M.; Otis, N.J.; et al. G protein-coupled receptor kinase 2 activity impairs cardiac glucose uptake and promotes insulin resistance after myocardial ischemia. Circulation 2011, 123, 1953–1962. [Google Scholar] [CrossRef]
- Sorriento, D.; Santulli, G.; Franco, A.; Cipolletta, E.; Napolitano, L.; Gambardella, J.; Gomez-Monterrey, I.; Campiglia, P.; Trimarco, B.; Iaccarino, G.; et al. Integrating GRK2 and NFkappaB in the Pathophysiology of Cardiac Hypertrophy. J. Cardiovasc. Transl. Res. 2015, 8, 493–502. [Google Scholar] [CrossRef]
- Tesmer, V.M.; Lennarz, S.; Mayer, G.; Tesmer, J.J. Molecular mechanism for inhibition of g protein-coupled receptor kinase 2 by a selective RNA aptamer. Structure 2012, 20, 1300–1309. [Google Scholar] [CrossRef]
- Kassack, M.U.; Hogger, P.; Gschwend, D.A.; Kameyama, K.; Haga, T.; Graul, R.C.; Sadee, W. Molecular modeling of G-protein coupled receptor kinase 2: Docking and biochemical evaluation of inhibitors. AAPS Pharmsci 2000, 2, E2. [Google Scholar] [CrossRef]
- Thal, D.M.; Homan, K.T.; Chen, J.; Wu, E.K.; Hinkle, P.M.; Huang, Z.M.; Chuprun, J.K.; Song, J.; Gao, E.; Cheung, J.Y.; et al. Paroxetine is a direct inhibitor of g protein-coupled receptor kinase 2 and increases myocardial contractility. ACS Chem. Biol. 2012, 7, 1830–1839. [Google Scholar] [CrossRef]
- Mayor, F., Jr.; Lucas, E.; Jurado-Pueyo, M.; Garcia-Guerra, L.; Nieto-Vazquez, I.; Vila-Bedmar, R.; Fernandez-Veledo, S.; Murga, C. G Protein-coupled receptor kinase 2 (GRK2): A novel modulator of insulin resistance. Arch. Physiol. Biochem. 2011, 117, 125–130. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schumacher, S.M.; Gao, E.; Zhu, W.; Chen, X.; Chuprun, J.K.; Feldman, A.M.; Tesmer, J.J.; Koch, W.J. Paroxetine-mediated GRK2 inhibition reverses cardiac dysfunction and remodeling after myocardial infarction. Sci. Transl. Med. 2015, 7, 277ra31. [Google Scholar] [CrossRef]
- Carotenuto, A.; Cipolletta, E.; Gomez-Monterrey, I.; Sala, M.; Vernieri, E.; Limatola, A.; Bertamino, A.; Musella, S.; Sorriento, D.; Grieco, P.; et al. Design, synthesis and efficacy of novel G protein-coupled receptor kinase 2 inhibitors. Eur. J. Med. Chem. 2013, 69, 384–392. [Google Scholar] [CrossRef]
- Gomez-Monterrey, I.; Carotenuto, A.; Cipolletta, E.; Sala, M.; Vernieri, E.; Limatola, A.; Bertamino, A.; Musella, S.; Grieco, P.; Trimarco, B.; et al. SAR study and conformational analysis of a series of novel peptide G protein-coupled receptor kinase 2 inhibitors. Biopolymers 2014, 101, 121–128. [Google Scholar] [CrossRef]
- Ciccarelli, M.; Sorriento, D.; Franco, A.; Fusco, A.; Del Giudice, C.; Annunziata, R.; Cipolletta, E.; Monti, M.G.; Dorn, G.W., 2nd; Trimarco, B.; et al. Endothelial G protein-coupled receptor kinase 2 regulates vascular homeostasis through the control of free radical oxygen species. Arterioscler. Thromb. Vasc. Biol. 2013, 33, 2415–2424. [Google Scholar] [CrossRef] [PubMed]
- Sorriento, D.; Ciccarelli, M.; Santulli, G.; Illario, M.; Trimarco, B.; Iaccarino, G. Trafficking GRK2: Cellular and Metabolic consequences of GRK2 subcellular localization. Transl. Med. UniSa 2014, 10, 3–7. [Google Scholar]
- Mori, J.; Patel, V.B.; Abo Alrob, O.; Basu, R.; Altamimi, T.; Desaulniers, J.; Wagg, C.S.; Kassiri, Z.; Lopaschuk, G.D.; Oudit, G.Y. Angiotensin 1-7 ameliorates diabetic cardiomyopathy and diastolic dysfunction in db/db mice by reducing lipotoxicity and inflammation. Circ. Heart Fail. 2014, 7, 327–339. [Google Scholar] [CrossRef] [PubMed]
- Mariappan, N.; Elks, C.M.; Sriramula, S.; Guggilam, A.; Liu, Z.; Borkhsenious, O.; Francis, J. NF-kappaB-induced oxidative stress contributes to mitochondrial and cardiac dysfunction in type II diabetes. Cardiovasc. Res. 2010, 85, 473–483. [Google Scholar] [CrossRef]
- Lorenzo, O.; Picatoste, B.; Ares-Carrasco, S.; Ramirez, E.; Egido, J.; Tunon, J. Potential role of nuclear factor kappaB in diabetic cardiomyopathy. Mediat. Inflamm. 2011, 2011, 652097. [Google Scholar] [CrossRef]
- Ungerer, M.; Kessebohm, K.; Kronsbein, K.; Lohse, M.J.; Richardt, G. Activation of beta-adrenergic receptor kinase during myocardial ischemia. Circ. Res. 1996, 79, 455–460. [Google Scholar] [CrossRef]
- Gros, R.; Benovic, J.L.; Tan, C.M.; Feldman, R.D. G-protein-coupled receptor kinase activity is increased in hypertension. J. Clin. Investig. 1997, 99, 2087–2093. [Google Scholar] [CrossRef]
- Ungerer, M.; Bohm, M.; Elce, J.S.; Erdmann, E.; Lohse, M.J. Altered expression of beta-adrenergic receptor kinase and beta 1-adrenergic receptors in the failing human heart. Circulation 1993, 87, 454–463. [Google Scholar] [CrossRef]
- Ungerer, M.; Parruti, G.; Bohm, M.; Puzicha, M.; DeBlasi, A.; Erdmann, E.; Lohse, M.J. Expression of beta-arrestins and beta-adrenergic receptor kinases in the failing human heart. Circ. Res. 1994, 74, 206–213. [Google Scholar] [CrossRef]
- Usui, I.; Imamura, T.; Satoh, H.; Huang, J.; Babendure, J.L.; Hupfeld, C.J.; Olefsky, J.M. GRK2 is an endogenous protein inhibitor of the insulin signaling pathway for glucose transport stimulation. EMBO J. 2004, 23, 2821–2829. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Usui, I.; Imamura, T.; Babendure, J.L.; Satoh, H.; Lu, J.C.; Hupfeld, C.J.; Olefsky, J.M. G protein-coupled receptor kinase 2 mediates endothelin-1-induced insulin resistance via the inhibition of both Galphaq/11 and insulin receptor substrate-1 pathways in 3T3-L1 adipocytes. Mol. Endocrinol. 2005, 19, 2760–2768. [Google Scholar] [CrossRef]
- Garcia-Guerra, L.; Nieto-Vazquez, I.; Vila-Bedmar, R.; Jurado-Pueyo, M.; Zalba, G.; Diez, J.; Murga, C.; Fernandez-Veledo, S.; Mayor, F., Jr.; Lorenzo, M. G protein-coupled receptor kinase 2 plays a relevant role in insulin resistance and obesity. Diabetes 2010, 59, 2407–2417. [Google Scholar] [CrossRef] [PubMed]
- Shahid, G.; Hussain, T. GRK2 negatively regulates glycogen synthesis in mouse liver FL83B cells. J. Biol. Chem. 2007, 282, 20612–20620. [Google Scholar] [CrossRef]
- Fredersdorf, S.; Thumann, C.; Zimmermann, W.H.; Vetter, R.; Graf, T.; Luchner, A.; Riegger, G.A.; Schunkert, H.; Eschenhagen, T.; Weil, J. Increased myocardial SERCA expression in early type 2 diabetes mellitus is insulin dependent: In vivo and in vitro data. Cardiovasc. Diabetol. 2012, 11, 57. [Google Scholar] [CrossRef] [PubMed]
- Iaccarino, G.; Barbato, E.; Cipolleta, E.; Esposito, A.; Fiorillo, A.; Koch, W.J.; Trimarco, B. Cardiac betaARK1 upregulation induced by chronic salt deprivation in rats. Hypertension 2001, 38, 255–260. [Google Scholar] [CrossRef]
- Santulli, G.; Cipolletta, E.; Sorriento, D.; Del Giudice, C.; Anastasio, A.; Monaco, S.; Maione, A.S.; Condorelli, G.; Puca, A.; Trimarco, B.; et al. CaMK4 Gene Deletion Induces Hypertension. J. Am. Heart Assoc. 2012, 1, e001081. [Google Scholar] [CrossRef] [PubMed]
- Asensio, C.; Jimenez, M.; Kuhne, F.; Rohner-Jeanrenaud, F.; Muzzin, P. The lack of beta-adrenoceptors results in enhanced insulin sensitivity in mice exhibiting increased adiposity and glucose intolerance. Diabetes 2005, 54, 3490–3495. [Google Scholar] [CrossRef] [PubMed]
- Kienesberger, P.C.; Lee, D.; Pulinilkunnil, T.; Brenner, D.S.; Cai, L.; Magnes, C.; Koefeler, H.C.; Streith, I.E.; Rechberger, G.N.; Haemmerle, G.; et al. Adipose triglyceride lipase deficiency causes tissue-specific changes in insulin signaling. J. Biol. Chem. 2009, 284, 30218–30229. [Google Scholar] [CrossRef] [PubMed]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; Vandesompele, J.; Wittwer, C.T. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [PubMed]
- Gambardella, J.; De Rosa, M.; Sorriento, D.; Prevete, N.; Fiordelisi, A.; Ciccarelli, M.; Trimarco, B.; De Luca, N.; Iaccarino, G. Parathyroid Hormone Causes Endothelial Dysfunction by Inducing Mitochondrial ROS and Specific Oxidative Signal Transduction Modifications. Oxid. Med. Cell. Longev. 2018, 2018, 9582319. [Google Scholar] [CrossRef] [PubMed]
Genbank Accession # | Gene | Sense Primer Sequence | Antisense Primer Sequence |
---|---|---|---|
19791 | 18s | GTAACCCGTTGAACCCATT | CCATCCAATCGGTAGTAGCG |
16193 | IL-6 | GAGGATACCACTCCCAACAGACC | AAGTGCATCATCGTTGTTCATACA |
17395 | MMP9 | CTTCTGGCGTGTGAGTTTCCA | ACTGCACGGTTGAAGCAAAGA |
230899 | ANF | ACCTGCTAGACCACCTGGAG | CCTTGGCTGTTATCTTCGGTACCGG |
20296 | MCP-2 | GGGTGCTGAAAAGCTACGAG | TCCAGCTTTGGCTGTCTCTT |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cipolletta, E.; Gambardella, J.; Fiordelisi, A.; Del Giudice, C.; Di Vaia, E.; Ciccarelli, M.; Sala, M.; Campiglia, P.; Coscioni, E.; Trimarco, B.; et al. Antidiabetic and Cardioprotective Effects of Pharmacological Inhibition of GRK2 in db/db Mice. Int. J. Mol. Sci. 2019, 20, 1492. https://doi.org/10.3390/ijms20061492
Cipolletta E, Gambardella J, Fiordelisi A, Del Giudice C, Di Vaia E, Ciccarelli M, Sala M, Campiglia P, Coscioni E, Trimarco B, et al. Antidiabetic and Cardioprotective Effects of Pharmacological Inhibition of GRK2 in db/db Mice. International Journal of Molecular Sciences. 2019; 20(6):1492. https://doi.org/10.3390/ijms20061492
Chicago/Turabian StyleCipolletta, Ersilia, Jessica Gambardella, Antonella Fiordelisi, Carmine Del Giudice, Eugenio Di Vaia, Michele Ciccarelli, Marina Sala, Pietro Campiglia, Enrico Coscioni, Bruno Trimarco, and et al. 2019. "Antidiabetic and Cardioprotective Effects of Pharmacological Inhibition of GRK2 in db/db Mice" International Journal of Molecular Sciences 20, no. 6: 1492. https://doi.org/10.3390/ijms20061492