Distinct Dopamine D2 Receptor Antagonists Differentially Impact D2 Receptor Oligomerization
Abstract
:1. Introduction
2. Results
2.1. Pharmacological Properties of the D2LR Fusion Proteins
2.2. Targeting the Dopamine D2LR Homodimer using the NanoBiT Assay
2.3. Antagonist-Dependent Modulation of the Level of D2LR Homodimer Formation
2.3.1. Short-Term Effects
2.3.2. Long-Term Effects
2.3.3. Screening of a Broader Panel of D2R ligands
2.4. Validation of the Spiperone-Modulating Capacity on the D2LR Homodimer
2.5. Spiperone and Clozapine Achieve Stable Binding Poses in D2R during Molecular Dynamics Simulations
2.6. Spiperone and Clozapine Select for Different Sidechain Conformations in D2R TM5 and TM6
2.7. Aromatic Interactions Stabilize D2R Homodimer Model Interface during MD Simulation
2.8. D2LR Oligomerization
3. Discussion
4. Materials and Methods
4.1. Chemicals and Reagents
4.2. Cloning of the Dopamine D2R into the NanoBiT® plasmids
4.3. Cell Culture
4.3.1. Expression in HEK293T Cells
4.3.2. Cell Preparation for Dimerization Assay with HEK293T Cells in Suspension
4.3.3. Cell Preparation for Dimerization Assay with Adherent HEK293T Cells
4.3.4. Fluorescence Normalization and Signal-To-Noise Ratio
4.4. NanoBiT®-Based Validation of the Functionality of D2LR Luminescent Fusion Proteins by mini-Gαi Protein-Mediated Signaling
4.5. Detection of the Expression Levels of D2LR Dimers by Western Blot
4.6. Data Analysis
4.7. Computational Modeling
4.8. Molecular Dynamic (MD) Simulations
4.9. MD Simulation Analysis
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
GPCR | G protein-coupled receptor |
PCA | protein complementation assay |
PPI | protein-protein interaction |
NanoBiT | NanoLuciferase Binary technology |
D2LR | Dopamine D2Long receptor |
References
- Beaulieu, J.M.; Gainetdinov, R.R. The physiology, signaling, and pharmacology of dopamine receptors. Pharm. Rev. 2011, 63, 182–217. [Google Scholar] [CrossRef] [PubMed]
- Rangel-Barajas, C.; Coronel, I.; Floran, B. Dopamine Receptors and Neurodegeneration. Aging Dis. 2015, 6, 349–368. [Google Scholar] [CrossRef] [Green Version]
- Missale, C.; Nash, S.R.; Robinson, S.W.; Jaber, M.; Caron, M.G. Dopamine receptors: From structure to function. Physiol. Rev. 1998, 78, 189–225. [Google Scholar] [CrossRef]
- Farran, B. An update on the physiological and therapeutic relevance of GPCR oligomers. Pharmacol. Res. 2017, 117, 303–327. [Google Scholar] [CrossRef]
- Ferre, S.; Casado, V.; Devi, L.A.; Filizola, M.; Jockers, R.; Lohse, M.J.; Milligan, G.; Pin, J.P.; Guitart, X. G protein-coupled receptor oligomerization revisited: Functional and pharmacological perspectives. Pharm. Rev. 2014, 66, 413–434. [Google Scholar] [CrossRef] [PubMed]
- Fiorentini, C.; Busi, C.; Spano, P.; Missale, C. Dimerization of dopamine D1 and D3 receptors in the regulation of striatal function. Curr. Opin. Pharmacol. 2010, 10, 87–92. [Google Scholar] [CrossRef] [PubMed]
- Blasiak, E.; Lukasiewicz, S.; Szafran-Pilch, K.; Dziedzicka-Wasylewska, M. Genetic variants of dopamine D2 receptor impact heterodimerization with dopamine D1 receptor. Pharmacol. Rep. 2017, 69, 235–241. [Google Scholar] [CrossRef]
- O’Dowd, B.F.; Nguyen, T.; Ji, X.; George, S.R. D5 dopamine receptor carboxyl tail involved in D5-D2 heteromer formation. Biochem. Biophys. Res. Commun. 2013, 431, 586–589. [Google Scholar] [CrossRef] [Green Version]
- Van Craenenbroeck, K.; Borroto-Escuela, D.O.; Skieterska, K.; Duchou, J.; Romero-Fernandez, W.; Fuxe, K. Role of dimerization in dopamine D(4) receptor biogenesis. Curr. Protein Pept. Sci. 2014, 15, 659–665. [Google Scholar] [CrossRef] [PubMed]
- Nakagawa, M.; Kuri, M.; Kambara, N.; Tanigami, H.; Tanaka, H.; Kishi, Y.; Hamajima, N. Dopamine D2 receptor Taq IA polymorphism is associated with postoperative nausea and vomiting. J. Anesth. 2008, 22, 397–403. [Google Scholar] [CrossRef]
- Pan, Y.Q.; Qiao, L.; Xue, X.D.; Fu, J.H. Association between ANKK1 (rs1800497) polymorphism of DRD2 gene and attention deficit hyperactivity disorder: A meta-analysis. Neurosci. Lett. 2015, 590, 101–105. [Google Scholar] [CrossRef] [PubMed]
- Rocchetti, J.; Isingrini, E.; Dal Bo, G.; Sagheby, S.; Menegaux, A.; Tronche, F.; Levesque, D.; Moquin, L.; Gratton, A.; Wong, T.P.; et al. Presynaptic D2 dopamine receptors control long-term depression expression and memory processes in the temporal hippocampus. Biol. Psychiatry 2015, 77, 513–525. [Google Scholar] [CrossRef] [PubMed]
- Tozzi, A.; Tantucci, M.; Marchi, S.; Mazzocchetti, P.; Morari, M.; Pinton, P.; Mancini, A.; Calabresi, P. Dopamine D2 receptor-mediated neuroprotection in a G2019S Lrrk2 genetic model of Parkinson’s disease. Cell Death Dis. 2018, 9, 204. [Google Scholar] [CrossRef] [Green Version]
- Urs, N.M.; Peterson, S.M.; Caron, M.G. New Concepts in Dopamine D2 Receptor Biased Signaling and Implications for Schizophrenia Therapy. Biol. Psychiatry 2017, 81, 78–85. [Google Scholar] [CrossRef]
- Weber, M.A.; Graack, E.T.; Scholl, J.L.; Renner, K.J.; Forster, G.L.; Watt, M.J. Enhanced dopamine D2 autoreceptor function in the adult prefrontal cortex contributes to dopamine hypoactivity following adolescent social stress. Eur. J. Neurosci. 2018, 48, 1833–1850. [Google Scholar] [CrossRef] [PubMed]
- Weinstein, J.J.; van de Giessen, E.; Rosengard, R.J.; Xu, X.; Ojeil, N.; Brucato, G.; Gil, R.B.; Kegeles, L.S.; Laruelle, M.; Slifstein, M.; et al. PET imaging of dopamine-D2 receptor internalization in schizophrenia. Mol. Psychiatry 2018, 23, 1506–1511. [Google Scholar] [CrossRef]
- Araki, K.; Kuwano, R.; Morii, K.; Hayashi, S.; Minoshima, S.; Shimizu, N.; Katagiri, T.; Usui, H.; Kumanishi, T.; Takahashi, Y. Structure and expression of human and rat D2 dopamine receptor genes. Neurochem. Int. 1992, 21, 91–98. [Google Scholar] [CrossRef]
- Dal Toso, R.; Sommer, B.; Ewert, M.; Herb, A.; Pritchett, D.B.; Bach, A.; Shivers, B.D.; Seeburg, P.H. The dopamine D2 receptor: Two molecular forms generated by alternative splicing. EMBO J. 1989, 8, 4025–4034. [Google Scholar] [CrossRef]
- Borroto-Escuela, D.O.; Rodriguez, D.; Romero-Fernandez, W.; Kapla, J.; Jaiteh, M.; Ranganathan, A.; Lazarova, T.; Fuxe, K.; Carlsson, J. Mapping the Interface of a GPCR Dimer: A Structural Model of the A2A Adenosine and D2 Dopamine Receptor Heteromer. Front. Pharmacol. 2018, 9, 829. [Google Scholar] [CrossRef]
- Canals, M.; Marcellino, D.; Fanelli, F.; Ciruela, F.; de Benedetti, P.; Goldberg, S.R.; Neve, K.; Fuxe, K.; Agnati, L.F.; Woods, A.S.; et al. Adenosine A2A-dopamine D2 receptor-receptor heteromerization: Qualitative and quantitative assessment by fluorescence and bioluminescence energy transfer. J. Biol. Chem. 2003, 278, 46741–46749. [Google Scholar] [CrossRef]
- Niewiarowska-Sendo, A.; Polit, A.; Piwowar, M.; Tworzydlo, M.; Kozik, A.; Guevara-Lora, I. Bradykinin B2 and dopamine D2 receptors form a functional dimer. Biochim. Biophys. Acta 2017, 1864, 1855–1866. [Google Scholar] [CrossRef] [PubMed]
- Kearn, C.S.; Blake-Palmer, K.; Daniel, E.; Mackie, K.; Glass, M. Concurrent stimulation of cannabinoid CB1 and dopamine D2 receptors enhances heterodimer formation: A mechanism for receptor cross-talk? Mol. Pharmacol. 2005, 67, 1697–1704. [Google Scholar] [CrossRef] [PubMed]
- Pinna, A.; Bonaventura, J.; Farre, D.; Sanchez, M.; Simola, N.; Mallol, J.; Lluis, C.; Costa, G.; Baqi, Y.; Muller, C.E.; et al. L-DOPA disrupts adenosine A(2A)-cannabinoid CB(1)-dopamine D(2) receptor heteromer cross-talk in the striatum of hemiparkinsonian rats: Biochemical and behavioral studies. Exp. Neurol. 2014, 253, 180–191. [Google Scholar] [CrossRef] [PubMed]
- Ng, G.Y.; O’Dowd, B.F.; Lee, S.P.; Chung, H.T.; Brann, M.R.; Seeman, P.; George, S.R. Dopamine D2 receptor dimers and receptor-blocking peptides. Biochem. Biophys. Res. Commun. 1996, 227, 200–204. [Google Scholar] [CrossRef] [PubMed]
- Armstrong, D.; Strange, P.G. Dopamine D2 receptor dimer formation: Evidence from ligand binding. J. Biol. Chem. 2001, 276, 22621–22629. [Google Scholar] [CrossRef] [PubMed]
- Wurch, T.; Matsumoto, A.; Pauwels, P.J. Agonist-independent and -dependent oligomerization of dopamine D(2) receptors by fusion to fluorescent proteins. FEBS Lett. 2001, 507, 109–113. [Google Scholar] [CrossRef]
- Sagar, G.D.; Gereben, B.; Callebaut, I.; Mornon, J.P.; Zeold, A.; da Silva, W.S.; Luongo, C.; Dentice, M.; Tente, S.M.; Freitas, B.C.G.; et al. Ubiquitination-induced conformational change within the deiodinase dimer is a switch regulating enzyme activity. Mol. Cell Biol. 2007, 27, 4774–4783. [Google Scholar] [CrossRef] [PubMed]
- Kasai, R.S.; Ito, S.V.; Awane, R.M.; Fujiwara, T.K.; Kusumi, A. The Class-A GPCR Dopamine D2 Receptor Forms Transient Dimers Stabilized by Agonists: Detection by Single-Molecule Tracking. Cell Biochem. Biophys. 2018, 76, 29–37. [Google Scholar] [CrossRef] [PubMed]
- Kaczor, A.A.; Jorg, M.; Capuano, B. The dopamine D2 receptor dimer and its interaction with homobivalent antagonists: Homology modeling, docking and molecular dynamics. J. Mol. Model. 2016, 22, 203. [Google Scholar] [CrossRef]
- Kaczor, A.A.; Rutkowska, E.; Bartuzi, D.; Targowska-Duda, K.M.; Matosiuk, D.; Selent, J. Computational methods for studying G protein-coupled receptors (GPCRs). Methods Cell Biol. 2016, 132, 359–399. [Google Scholar]
- Tabor, A.; Weisenburger, S.; Banerjee, A.; Purkayastha, N.; Kaindl, J.M.; Hubner, H.; Wei, L.; Gromer, T.W.; Kornhuber, J.; Tschammer, N.; et al. Visualization and ligand-induced modulation of dopamine receptor dimerization at the single molecule level. Sci. Rep. 2016, 6, 33233. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pulido, D.; Casado-Anguera, V.; Perez-Benito, L.; Moreno, E.; Cordomi, A.; Lopez, L.; Cortes, A.; Ferre, S.; Pardo, L.; Casado, V. Design of a True Bivalent Ligand with Picomolar Binding Affinity for a G Protein-Coupled Receptor Homodimer. J. Med. Chem. 2018, 61, 9335–9346. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.P.; O’Dowd, B.F.; Rajaram, R.D.; Nguyen, T.; George, S.R. D2 dopamine receptor homodimerization is mediated by multiple sites of interaction, including an intermolecular interaction involving transmembrane domain 4. Biochemistry 2003, 42, 11023–11031. [Google Scholar] [CrossRef] [PubMed]
- Guo, W.; Shi, L.; Javitch, J.A. The fourth transmembrane segment forms the interface of the dopamine D2 receptor homodimer. J. Biol. Chem. 2003, 278, 4385–4388. [Google Scholar] [CrossRef] [PubMed]
- Bonaventura, J.; Navarro, G.; Casado-Anguera, V.; Azdad, K.; Rea, W.; Moreno, E.; Brugarolas, M.; Mallol, J.; Canela, E.I.; Lluis, C.; et al. Allosteric interactions between agonists and antagonists within the adenosine A2A receptor-dopamine D2 receptor heterotetramer. Proc. Natl. Acad. Sci. USA 2015, 112, E3609–E3618. [Google Scholar] [CrossRef] [Green Version]
- Ferre, S.; Bonaventura, J.; Zhu, W.; Hatcher-Solis, C.; Taura, J.; Quiroz, C.; Cai, N.S.; Moreno, E.; Casado-Anguera, V.; Kravitz, A.V.; et al. Essential Control of the Function of the Striatopallidal Neuron by Pre-coupled Complexes of Adenosine A2A-Dopamine D2 Receptor Heterotetramers and Adenylyl Cyclase. Front. Pharmacol. 2018, 9, 243. [Google Scholar] [CrossRef]
- Martinez-Pinilla, E.; Rodriguez-Perez, A.I.; Navarro, G.; Aguinaga, D.; Moreno, E.; Lanciego, J.L.; Labandeira-Garcia, J.L.; Franco, R. Dopamine D2 and angiotensin II type 1 receptors form functional heteromers in rat striatum. Biochem. Pharmacol. 2015, 96, 131–142. [Google Scholar] [CrossRef] [PubMed]
- Navarro, G.; Cordomi, A.; Casado-Anguera, V.; Moreno, E.; Cai, N.S.; Cortes, A.; Canela, E.I.; Dessauer, C.W.; Casado, V.; Pardo, L.; et al. Evidence for functional pre-coupled complexes of receptor heteromers and adenylyl cyclase. Nat. Commun. 2018, 9, 1242. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Oliveira, P.A.; Dalton, J.A.R.; Lopez-Cano, M.; Ricarte, A.; Morato, X.; Matheus, F.C.; Cunha, A.S.; Muller, C.E.; Takahashi, R.N.; Fernandez-Duenas, V.; et al. Angiotensin II type 1/adenosine A 2A receptor oligomers: A novel target for tardive dyskinesia. Sci. Rep. 2017, 7, 1857. [Google Scholar] [CrossRef]
- Qian, M.; Wouters, E.; Dalton, J.A.R.; Risseeuw, M.D.P.; Crans, R.A.J.; Stove, C.; Giraldo, J.; Van Craenenbroeck, K.; Van Calenbergh, S. Synthesis toward Bivalent Ligands for the Dopamine D2 and Metabotropic Glutamate 5 Receptors. J. Med. Chem. 2018, 61, 8212–8225. [Google Scholar] [CrossRef]
- Guitart, X.; Navarro, G.; Moreno, E.; Yano, H.; Cai, N.S.; Sanchez-Soto, M.; Kumar-Barodia, S.; Naidu, Y.T.; Mallol, J.; Cortes, A.; et al. Functional selectivity of allosteric interactions within G protein-coupled receptor oligomers: The dopamine D1-D3 receptor heterotetramer. Mol. Pharmacol. 2014, 86, 417–429. [Google Scholar] [CrossRef] [PubMed]
- Kasai, R.S.; Kusumi, A. Single-molecule imaging revealed dynamic GPCR dimerization. Curr. Opin. Cell Biol. 2014, 27, 78–86. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guo, W.; Urizar, E.; Kralikova, M.; Mobarec, J.C.; Shi, L.; Filizola, M.; Javitch, J.A. Dopamine D2 receptors form higher order oligomers at physiological expression levels. EMBO J. 2008, 27, 2293–2304. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Strange, P.G. Oligomers of D2 dopamine receptors: Evidence from ligand binding. J. Mol. Neurosci. 2005, 26, 155–160. [Google Scholar] [CrossRef]
- Hern, J.A.; Baig, A.H.; Mashanov, G.I.; Birdsall, B.; Corrie, J.E.; Lazareno, S.; Molloy, J.E.; Birdsall, N.J. Formation and dissociation of M1 muscarinic receptor dimers seen by total internal reflection fluorescence imaging of single molecules. Proc. Natl. Acad. Sci. USA 2010, 107, 2693–2698. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kasai, R.S.; Suzuki, K.G.; Prossnitz, E.R.; Koyama-Honda, I.; Nakada, C.; Fujiwara, T.K.; Kusumi, A. Full characterization of GPCR monomer-dimer dynamic equilibrium by single molecule imaging. J. Cell Biol. 2011, 192, 463–480. [Google Scholar] [CrossRef]
- Calebiro, D.; Rieken, F.; Wagner, J.; Sungkaworn, T.; Zabel, U.; Borzi, A.; Cocucci, E.; Zurn, A.; Lohse, M.J. Single-molecule analysis of fluorescently labeled G-protein-coupled receptors reveals complexes with distinct dynamics and organization. Proc. Natl. Acad. Sci. USA 2013, 110, 743–748. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Pei, L.; Fletcher, P.J.; Kapur, S.; Seeman, P.; Liu, F. Schizophrenia, amphetamine-induced sensitized state and acute amphetamine exposure all show a common alteration: Increased dopamine D2 receptor dimerization. Mol. Brain 2010, 3, 25. [Google Scholar] [CrossRef]
- Laschet, C.; Dupuis, N.; Hanson, J. A dynamic and screening-compatible nanoluciferase-based complementation assay enables profiling of individual GPCR-G protein interactions. J. Biol. Chem. 2019, 294, 4079–4090. [Google Scholar] [CrossRef]
- Atwood, B.K.; Lopez, J.; Wager-Miller, J.; Mackie, K.; Straiker, A. Expression of G protein-coupled receptors and related proteins in HEK293, AtT20, BV2, and N18 cell lines as revealed by microarray analysis. BMC Genomics 2011, 12, 14. [Google Scholar] [CrossRef]
- Przybyla, J.A.; Watts, V.J. Ligand-induced regulation and localization of cannabinoid CB1 and dopamine D2L receptor heterodimers. J. Pharmacol. Exp. Ther. 2010, 332, 710–719. [Google Scholar] [CrossRef] [PubMed]
- Cannaert, A.; Storme, J.; Franz, F.; Auwarter, V.; Stove, C.P. Detection and Activity Profiling of Synthetic Cannabinoids and Their Metabolites with a Newly Developed Bioassay. Anal. Chem. 2016, 88, 11476–11485. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- He, J.; Xu, J.; Castleberry, A.M.; Lau, A.G.; Hall, R.A. Glycosylation of beta(1)-adrenergic receptors regulates receptor surface expression and dimerization. Biochem. Biophys. Res. Commun. 2002, 297, 565–572. [Google Scholar] [CrossRef]
- Ferre, S.; Bonaventura, J.; Tomasi, D.; Navarro, G.; Moreno, E.; Cortes, A.; Lluis, C.; Casado, V.; Volkow, N.D. Allosteric mechanisms within the adenosine A2A-dopamine D2 receptor heterotetramer. Neuropharmacology 2016, 104, 154–160. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Che, T.; Levit, A.; Shoichet, B.K.; Wacker, D.; Roth, B.L. Structure of the D2 dopamine receptor bound to the atypical antipsychotic drug risperidone. Nature 2018, 555, 269–273. [Google Scholar] [CrossRef] [PubMed]
- Ballesteros, J.A.; Weinstein, H. Integrated methods for the construction of three-dimensional models and computational probing of structure-function relations in G protein-coupled receptors. Methods Neurosci. 1995, 25, 366–428. [Google Scholar]
- Madhusudan Makwana, K.; Mahalakshmi, R. Implications of aromatic-aromatic interactions: From protein structures to peptide models. Protein Sci. A Publ. Protein Soc. 2015, 24, 1920–1933. [Google Scholar] [CrossRef] [PubMed]
- Lyskov, S.; Chou, F.C.; Conchuir, S.O.; Der, B.S.; Drew, K.; Kuroda, D.; Xu, J.; Weitzner, B.D.; Renfrew, P.D.; Sripakdeevong, P.; et al. Serverification of molecular modeling applications: The Rosetta Online Server that Includes Everyone (ROSIE). PLoS ONE 2013, 8, e63906. [Google Scholar] [CrossRef] [PubMed]
- Rossi, M.; Maggio, R.; Fasciani, I.; Scarselli, M. Historical Perspectives: From Monomers to Dimers and Beyond, an Exciting Journey in the World of G Protein-Coupled Receptors. In G-Protein-Coupled Receptor Dimers; Herrick-Davis, K., Milligan, G., Di Giovanni, G., Eds.; Springer International Publishing: Cham, Switzerland, 2017; pp. 3–14. [Google Scholar]
- Ilien, B.; Glasser, N.; Clamme, J.P.; Didier, P.; Piemont, E.; Chinnappan, R.; Daval, S.B.; Galzi, J.L.; Mely, Y. Pirenzepine promotes the dimerization of muscarinic M1 receptors through a three-step binding process. J. Biol. Chem. 2009, 284, 19533–19543. [Google Scholar] [CrossRef]
- Milligan, G. G protein-coupled receptor dimerization: Function and ligand pharmacology. Mol. Pharmacol. 2004, 66, 1–7. [Google Scholar] [CrossRef]
- Saenz del Burgo, L.; Milligan, G. Heterodimerisation of G protein-coupled receptors: Implications for drug design and ligand screening. Expert Opin. Drug Discov. 2010, 5, 461–474. [Google Scholar] [CrossRef] [PubMed]
- Dixon, A.S.; Schwinn, M.K.; Hall, M.P.; Zimmerman, K.; Otto, P.; Lubben, T.H.; Butler, B.L.; Binkowski, B.F.; Machleidt, T.; Kirkland, T.A.; et al. NanoLuc Complementation Reporter Optimized for Accurate Measurement of Protein Interactions in Cells. ACS Chem. Biol. 2016, 11, 400–408. [Google Scholar] [CrossRef] [PubMed]
- Akam, E.; Strange, P.G. Inverse agonist properties of atypical antipsychotic drugs. Biochem. Pharmacol. 2004, 67, 2039–2045. [Google Scholar] [CrossRef] [PubMed]
- Donthamsetti, P.C.; Winter, N.; Schonberger, M.; Levitz, J.; Stanley, C.; Javitch, J.A.; Isacoff, E.Y.; Trauner, D. Optical Control of Dopamine Receptors Using a Photoswitchable Tethered Inverse Agonist. J. Am. Chem. Soc. 2017, 139, 18522–18535. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Newton, C.L.; Wood, M.D.; Strange, P.G. Examining the Effects of Sodium Ions on the Binding of Antagonists to Dopamine D2 and D3 Receptors. PLoS ONE 2016, 11, e0158808. [Google Scholar] [CrossRef]
- Roberts, D.J.; Strange, P.G. Mechanisms of inverse agonist action at D2 dopamine receptors. Br. J. Pharm. 2005, 145, 34–42. [Google Scholar] [CrossRef] [Green Version]
- Marsango, S.; Caltabiano, G.; Jimenez-Roses, M.; Millan, M.J.; Pediani, J.D.; Ward, R.J.; Milligan, G. A Molecular Basis for Selective Antagonist Destabilization of Dopamine D3 Receptor Quaternary Organization. Sci. Rep. 2017, 7, 2134. [Google Scholar] [CrossRef] [PubMed]
- Navarro, G.; Carriba, P.; Gandia, J.; Ciruela, F.; Casado, V.; Cortes, A.; Mallol, J.; Canela, E.I.; Lluis, C.; Franco, R. Detection of heteromers formed by cannabinoid CB1, dopamine D2, and adenosine A2A G-protein-coupled receptors by combining bimolecular fluorescence complementation and bioluminescence energy transfer. Sci. World J. 2008, 8, 1088–1097. [Google Scholar] [CrossRef]
- Gandia, J.; Galino, J.; Amaral, O.B.; Soriano, A.; Lluis, C.; Franco, R.; Ciruela, F. Detection of higher-order G protein-coupled receptor oligomers by a combined BRET-BiFC technique. FEBS Lett. 2008, 582, 2979–2984. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Borroto-Escuela, D.O.; Romero-Fernandez, W.; Tarakanov, A.O.; Ciruela, F.; Agnati, L.F.; Fuxe, K. On the existence of a possible A2A-D2-beta-Arrestin2 complex: A2A agonist modulation of D2 agonist-induced beta-arrestin2 recruitment. J. Mol. Biol. 2011, 406, 687–699. [Google Scholar] [CrossRef] [PubMed]
- Sahlholm, K.; Gomez-Soler, M.; Valle-Leon, M.; Lopez-Cano, M.; Taura, J.J.; Ciruela, F.; Fernandez-Duenas, V. Antipsychotic-Like Efficacy of Dopamine D2 Receptor-Biased Ligands is Dependent on Adenosine A2A Receptor Expression. Mol. Neurobiol. 2018, 55, 4952–4958. [Google Scholar] [CrossRef] [PubMed]
- Borroto-Escuela, D.O.; Marcellino, D.; Narvaez, M.; Flajolet, M.; Heintz, N.; Agnati, L.; Ciruela, F.; Fuxe, K. A serine point mutation in the adenosine A2AR C-terminal tail reduces receptor heteromerization and allosteric modulation of the dopamine D2R. Biochem. Biophys. Res. Commun. 2010, 394, 222–227. [Google Scholar] [CrossRef] [PubMed]
- Antonelli, T.; Fuxe, K.; Agnati, L.; Mazzoni, E.; Tanganelli, S.; Tomasini, M.C.; Ferraro, L. Experimental studies and theoretical aspects on A2A/D2 receptor interactions in a model of Parkinson’s disease. Relevance for L-dopa induced dyskinesias. J. Neurol. Sci. 2006, 248, 16–22. [Google Scholar] [CrossRef] [PubMed]
- Fuxe, K.; Agnati, L.F.; Jacobsen, K.; Hillion, J.; Canals, M.; Torvinen, M.; Tinner-Staines, B.; Staines, W.; Rosin, D.; Terasmaa, A.; et al. Receptor heteromerization in adenosine A2A receptor signaling: Relevance for striatal function and Parkinson’s disease. Neurology 2003, 61 (11 Suppl. 6), S19–S23. [Google Scholar] [CrossRef] [PubMed]
- Fuxe, K.; Marcellino, D.; Genedani, S.; Agnati, L. Adenosine A(2A) receptors, dopamine D(2) receptors and their interactions in Parkinson’s disease. Mov. Disord. 2007, 22, 1990–2017. [Google Scholar] [CrossRef] [PubMed]
- Soriano, A.; Ventura, R.; Molero, A.; Hoen, R.; Casado, V.; Cortes, A.; Fanelli, F.; Albericio, F.; Lluis, C.; Franco, R.; et al. Adenosine A2A receptor-antagonist/dopamine D2 receptor-agonist bivalent ligands as pharmacological tools to detect A2A-D2 receptor heteromers. J. Med. Chem. 2009, 52, 5590–5602. [Google Scholar] [CrossRef]
- Lee, S.P.; O’Dowd, B.F.; Ng, G.Y.; Varghese, G.; Akil, H.; Mansour, A.; Nguyen, T.; George, S.R. Inhibition of cell surface expression by mutant receptors demonstrates that D2 dopamine receptors exist as oligomers in the cell. Mol. Pharmacol. 2000, 58, 120–128. [Google Scholar] [CrossRef]
- Kong, M.M.; Fan, T.; Varghese, G.; O’Dowd, B.F.; George, S.R. Agonist-induced cell surface trafficking of an intracellularly sequestered D1 dopamine receptor homo-oligomer. Mol. Pharmacol. 2006, 70, 78–89. [Google Scholar] [CrossRef]
- Platania, C.B.; Salomone, S.; Leggio, G.M.; Drago, F.; Bucolo, C. Homology modeling of dopamine D2 and D3 receptors: Molecular dynamics refinement and docking evaluation. PLoS ONE 2012, 7, e44316. [Google Scholar] [CrossRef]
- Skieterska, K.; Duchou, J.; Lintermans, B.; Van Craenenbroeck, K. Detection of G protein-coupled receptor (GPCR) dimerization by coimmunoprecipitation. Methods Cell Biol. 2013, 117, 323–340. [Google Scholar]
- Pettersen, E.F.; Goddard, T.D.; Huang, C.C.; Couch, G.S.; Greenblatt, D.M.; Meng, E.C.; Ferrin, T.E. UCSF Chimera—A visualization system for exploratory research and analysis. J. Comput. Chem. 2004, 25, 1605–1612. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.; Thiessen, P.A.; Bolton, E.E.; Chen, J.; Fu, G.; Gindulyte, A.; Han, L.; He, J.; He, S.; Shoemaker, B.A.; et al. PubChem Substance and Compound databases. Nucleic Acids Res. 2016, 44, D1202–D1213. [Google Scholar] [CrossRef] [PubMed]
- Morris, G.M.; Huey, R.; Lindstrom, W.; Sanner, M.F.; Belew, R.K.; Goodsell, D.S.; Olson, A.J. AutoDock4 and AutoDockTools4: Automated docking with selective receptor flexibility. J. Comput. Chem. 2009, 30, 2785–2791. [Google Scholar] [CrossRef] [PubMed]
- Manglik, A.; Kruse, A.C.; Kobilka, T.S.; Thian, F.S.; Mathiesen, J.M.; Sunahara, R.K.; Pardo, L.; Weis, W.I.; Kobilka, B.K.; Granier, S. Crystal structure of the micro-opioid receptor bound to a morphinan antagonist. Nature 2012, 485, 321–326. [Google Scholar] [CrossRef] [PubMed]
- Case, D.A.; Cheatham, T.E., 3rd; Darden, T.; Gohlke, H.; Luo, R.; Merz, K.M., Jr.; Onufriev, A.; Simmerling, C.; Wang, B.; Woods, R.J.; et al. The Amber biomolecular simulation programs. J. Comput. Chem. 2005, 26, 1668–1688. [Google Scholar] [CrossRef] [PubMed]
- Jo, S.; Kim, T.; Iyer, V.G.; Im, W. CHARMM-GUI: A web-based graphical user interface for CHARMM. J. Comput. Chem. 2008, 29, 1859–1865. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lomize, M.A.; Lomize, A.L.; Pogozheva, I.D.; Mosberg, H.I. OPM: Orientations of proteins in membranes database. Bioinformatics 2006, 22, 623–625. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; MacKerell, A.D., Jr. CHARMM36 all-atom additive protein force field: Validation based on comparison to NMR data. J. Comput. Chem. 2013, 34, 2135–2145. [Google Scholar] [CrossRef] [Green Version]
- Vanommeslaeghe, K.; Hatcher, E.; Acharya, C.; Kundu, S.; Zhong, S.; Shim, J.; Darian, E.; Guvench, O.; Lopes, P.; Vorobyov, I.; et al. CHARMM general force field: A force field for drug-like molecules compatible with the CHARMM all-atom additive biological force fields. J. Comput. Chem. 2010, 31, 671–690. [Google Scholar] [CrossRef]
- Harvey, M.J.; Giupponi, G.; Fabritiis, G.D. ACEMD: Accelerating Biomolecular Dynamics in the Microsecond Time Scale. J. Chem. Theory Comput. 2009, 5, 1632–1639. [Google Scholar] [CrossRef] [Green Version]
- Humphrey, W.; Dalke, A.; Schulten, K. VMD: Visual molecular dynamics. J. Mol. Graph. 1996, 14, 33–38. [Google Scholar] [CrossRef]
- Schymkowitz, J.; Borg, J.; Stricher, F.; Nys, R.; Rousseau, F.; Serrano, L. The FoldX web server: An online force field. Nucleic Acids Res. 2005, 33, W382–W388. [Google Scholar] [CrossRef] [PubMed]
Ligand | Unique Interactions | Common Interactions | |
---|---|---|---|
Risperidone | Trp100ECL1 | Asp1143.32 | (I) |
Ser1975.48 | Cys1183.36 | (III) | |
Phe3826.44 | Ile1223.40 | (III) | |
Tyr4167.43 | Trp3866.48 | (II) | |
Phe3896.51 | (II) | ||
Clozapine | Phe1895.38 | Asp1143.32 | (I) |
Ser1935.42 | Val1153.33 | (IV) | |
Phe1985.47 | Ile184ECL2 | (IV) | |
Phe3906.52 | Ser1935.42 | (IV) | |
His3936.55 | Trp3866.48 | (II) | |
Phe3896.51 | (II) | ||
Spiperone | Val912.61 | Asp1143.32 | (I) |
Phe1103.28 | Val1153.33 | (IV) | |
Cys1183.36 | (III) | ||
Ile1223.40 | (III) | ||
Ile184ECL2 | (IV) | ||
Ser1935.42 | (IV) |
Fusion Protein | Primers (5′ > 3′) a | Tm (°C) b | RE c | |
---|---|---|---|---|
D2LR-LgBiT | F | GTTAAGCTTATGAAGACGATCATC | 64 | HindIII |
R | GCAGAATTCGCGCAGTGGAGGATC | EcoRI | ||
D2LR-SmBiT | F | GTTAAGCTTATGAAGACGATCATC | 64 | HindIII |
R | GCAGAATTCGCGCAGTGGAGGATC | EcoRI | ||
A2a-LgBiT | F | CGTTAAGCTTATGAAGACGATCATCGCCCTG | 69 | HindIII |
R | TGCAGAATTCGCAGAAACCCCAGCACC | EcoRI |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wouters, E.; Marín, A.R.; Dalton, J.A.R.; Giraldo, J.; Stove, C. Distinct Dopamine D2 Receptor Antagonists Differentially Impact D2 Receptor Oligomerization. Int. J. Mol. Sci. 2019, 20, 1686. https://doi.org/10.3390/ijms20071686
Wouters E, Marín AR, Dalton JAR, Giraldo J, Stove C. Distinct Dopamine D2 Receptor Antagonists Differentially Impact D2 Receptor Oligomerization. International Journal of Molecular Sciences. 2019; 20(7):1686. https://doi.org/10.3390/ijms20071686
Chicago/Turabian StyleWouters, Elise, Adrián Ricarte Marín, James Andrew Rupert Dalton, Jesús Giraldo, and Christophe Stove. 2019. "Distinct Dopamine D2 Receptor Antagonists Differentially Impact D2 Receptor Oligomerization" International Journal of Molecular Sciences 20, no. 7: 1686. https://doi.org/10.3390/ijms20071686