Gonadal, Not Maternal, Acquisition of Duplicated pax6 Orthologs in Megalobrama Amblycephala
Abstract
:1. Introduction
2. Results
2.1. Cloning of Mapax6a and Mapax6b
2.2. Molecular Characterization of Mapax6a and Mapax6b
2.3. Different Expression Patterns between Mapax6a and Mapax6b
2.4. Mapax6a and Mapax6b Expressed in Adult Gonad besides Brain and Eye
3. Discussion
4. Materials and Methods
4.1. Fish and Embryo
4.2. Isolation of RNA and Sequencing of cDNA
4.3. Bioinformatic Analyses
4.4. Semi-Quantitative Reverse Transcription Polymerase Chain Reaction (sqRT-PCR)
4.5. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)
4.6. Western Blot Analysis
4.7. In Situ Hybridization
Supplementary Materials
Author Contributions
Acknowledgments
Conflicts of Interest
Abbreviations
DAPI | 4′,6-diamidino-2-phenylindole |
FISH | fluorescent in situ hybridization |
HD | homeodomain |
ISH | in situ hybridization |
ORF | open reading frame |
PAX | Paired Box |
PD | pair domain |
PST | proline–serine–threonine |
qRT-PCR | Quantitative Real-Time Polymerase Chain Reaction |
TBST | Tris-Buffered Saline Tween |
UTR | untranslated region |
WAGR | Wilms tumor, Aniridia, genitourinary abnormalities, and mental retardation |
WISH | whole-mount in situ hybridization |
References
- Chi, N.; Epstein, J.A. Getting your Pax straight: Pax proteins in development and disease. Trends Genet. 2002, 18, 41–47. [Google Scholar] [CrossRef]
- Cartier, L.; Laforge, T.; Feki, A.; Arnaudeau, S.; Dubois-Dauphin, M.; Krause, K.H. Pax6-induced alteration of cell fate: Shape changes, expression of neuronal alpha tubulin, postmitotic phenotype, and cell migration. J. Neurobiol. 2006, 66, 421–436. [Google Scholar] [CrossRef] [PubMed]
- Macdonald, R.; Wilson, S.W. Distribution of Pax6 protein during eye development suggests discrete roles in proliferative and differentiated visual cells. Dev. Genes Evol. 1997, 206, 363–369. [Google Scholar] [CrossRef] [PubMed]
- Cvekl, A.; Callaerts, P. PAX6: 25th anniversary and more to learn. Exp. Eye Res. 2017, 156, 10–21. [Google Scholar] [PubMed]
- Glaser, T.; Walton, D.S.; Maas, R.L. Genomic structure, evolutionary conservation and aniridia mutations in the human PAX6 gene. Nat. Genet. 1992, 2, 232–239. [Google Scholar] [CrossRef] [PubMed]
- Hill, R.E.; Favor, J.; Hogan, B.L.; Ton, C.C.; Saunders, G.F.; Hanson, I.M.; Prosser, J.; Jordan, T.; Hastie, N.D.; Van Heyningen, V. Mouse small eye results from mutations in a paired-like homeobox-containing gene. Nature 1991, 354, 522–525. [Google Scholar] [CrossRef] [PubMed]
- Nornes, S.; Clarkson, M.; Mikkola, I.; Pedersen, M.; Bardsley, A.; Martinez, J.P.; Krauss, S.; Johansen, T. Zebrafish contains two pax6 genes involved in eye development. Mech. Dev. 1998, 77, 185–196. [Google Scholar] [CrossRef]
- Quiring, R.; Walldorf, U.; Kloter, U.; Gehring, W.J. Homology of the eyeless gene of Drosophila to the Small eye gene in mice and Aniridia in humans. Science 1994, 265, 785–789. [Google Scholar] [PubMed]
- Tripathi, R.; Mishra, R. Interaction of Pax6 with SPARC and p53 in brain of mice indicates Smad3 dependent auto-regulation. J. Mol. Neurosci. 2010, 41, 397–403. [Google Scholar] [CrossRef]
- Sander, M.; Neubuser, A.; Kalamaras, J.; Ee, H.C.; Martin, G.R.; German, M.S. Genetic analysis reveals that PAX6 is required for normal transcription of pancreatic hormone genes and islet development. Genes Dev. 1997, 11, 1662–1673. [Google Scholar] [CrossRef]
- St-Onge, L.; Sosa-Pineda, B.; Chowdhury, K.; Mansouri, A.; Gruss, P. Pax6 is required for differentiation of glucagon-producing alpha-cells in mouse pancreas. Nature 1997, 387, 406–409. [Google Scholar] [CrossRef]
- Aruga, J.; Odaka, Y.S.; Kamiya, A.; Furuya, H. Dicyema Pax6 and Zic: Tool-kit genes in a highly simplified bilaterian. BMC Evolut. Biol. 2007, 7, 201. [Google Scholar] [CrossRef]
- Kimura, R.; Yoshizaki, K.; Osumi, N. Dynamic expression patterns of Pax6 during spermatogenesis in the mouse. J. Anat. 2015, 227, 1–9. [Google Scholar] [CrossRef]
- Meighan, C.M.; Schwarzbauer, J.E. Control of C. elegans hermaphrodite gonad size and shape by vab-3/Pax6-mediated regulation of integrin receptors. Genes Dev. 2007, 21, 1615–1620. [Google Scholar] [CrossRef] [PubMed]
- Meyer, A.; Schartl, M. Gene and genome duplications in vertebrates: The one-to-four (-to-eight in fish) rule and the evolution of novel gene functions. Curr. Opin. Cell Biol. 1999, 11, 699–704. [Google Scholar] [CrossRef]
- Glasauer, S.M.; Neuhauss, S.C. Whole-genome duplication in teleost fishes and its evolutionary consequences. Mol. Genet. Genomics 2014, 289, 1045–1060. [Google Scholar] [CrossRef] [PubMed]
- Chen, T.; Cavari, B.; Schartl, M.; Hong, Y. Identification and expression of conserved and novel RNA variants of medaka pax6b gene. J. Exp. Zool. B Mol. Dev. Evol. 2017, 328, 412–422. [Google Scholar] [CrossRef] [PubMed]
- Krauss, S.; Johansen, T.; Korzh, V.; Moens, U.; Ericson, J.U.; Fjose, A. Zebrafish pax[zf-a]: A paired box-containing gene expressed in the neural tube. EMBO J. 1991, 10, 3609–3619. [Google Scholar] [CrossRef] [PubMed]
- Kleinjan, D.A.; Bancewicz, R.M.; Gautier, P.; Dahm, R.; Schonthaler, H.B.; Damante, G.; Seawright, A.; Hever, A.M.; Yeyati, P.L.; van Heyningen, V.; et al. Subfunctionalization of duplicated zebrafish pax6 genes by cis-regulatory divergence. PLoS Genet. 2008, 4, e29. [Google Scholar] [CrossRef]
- Ravi, V.; Bhatia, S.; Gautier, P.; Loosli, F.; Tay, B.H.; Tay, A.; Murdoch, E.; Coutinho, P.; van Heyningen, V.; Brenner, S.; et al. Sequencing of Pax6 loci from the elephant shark reveals a family of Pax6 genes in vertebrate genomes, forged by ancient duplications and divergences. PLoS Genet. 2013, 9, e1003177. [Google Scholar] [CrossRef]
- Takamiya, M.; Weger, B.D.; Schindler, S.; Beil, T.; Yang, L.; Armant, O.; Ferg, M.; Schlunck, G.; Reinhard, T.; Dickmeis, T.; et al. Molecular description of eye defects in the zebrafish Pax6b mutant, sunrise, reveals a Pax6b-dependent genetic network in the developing anterior chamber. PLoS ONE 2015, 10, e0117645. [Google Scholar] [CrossRef] [PubMed]
- Miles, C.; Elgar, G.; Coles, E.; Kleinjan, D.J.; van Heyningen, V.; Hastie, N. Complete sequencing of the Fugu WAGR region from WT1 to PAX6: Dramatic compaction and conservation of synteny with human chromosome 11p13. Proc. Natl. Acad. Sci. USA 1998, 95, 13068–13072. [Google Scholar] [CrossRef]
- Liu, H.; Chen, C.; Gao, Z.; Min, J.; Gu, Y.; Jian, J.; Jiang, X.; Cai, H.; Ebersberger, I.; Xu, M.; et al. The draft genome of blunt snout bream (Megalobrama amblycephala) reveals the development of intermuscular bone and adaptation to herbivorous diet. Gigascience 2017, 6, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Adjoumani, J.Y.; Wang, K.; Zhou, M.; Liu, W.; Zhang, D. Effect of dietary betaine on growth performance, antioxidant capacity and lipid metabolism in blunt snout bream fed a high-fat diet. Fish Physiol. Biochem. 2017, 43, 1733–1745. [Google Scholar] [CrossRef]
- Zhu, D.M.; Yang, K.; Wang, W.M.; Song, W. Establishment and characterization of a fin cell line from blunt snout bream, Megalobrama amblycephala. Fish Physiol. Biochem. 2013, 39, 1399–1410. [Google Scholar] [CrossRef]
- Liu, R.; Krishnan, H.B.; Xue, W.; Liu, C. Characterization of allergens isolated from the freshwater fish blunt snout bream (Megalobrama amblycephala). J. Agric. Food Chem. 2011, 59, 458–463. [Google Scholar] [CrossRef]
- Yu, M.; Xue, T.; Chen, T.; Fang, J.; Pan, Q.; Deng, Y.; Li, L.; Chen, K.; Wang, Y. Maternal inheritance of Nanog ortholog in blunt-snout bream. J. Exp. Zool. B Mol. Dev. Evol. 2017, 328, 749–759. [Google Scholar] [CrossRef]
- Gao, Z.; Luo, W.; Liu, H.; Zeng, C.; Liu, X.; Yi, S.; Wang, W. Transcriptome analysis and SSR/SNP markers information of the blunt snout bream (Megalobrama amblycephala). PLoS ONE 2012, 7, e42637. [Google Scholar] [CrossRef]
- Czerny, T.; Halder, G.; Kloter, U.; Souabni, A.; Gehring, W.J.; Busslinger, M. Twin of eyeless, a second Pax-6 gene of Drosophila, acts upstream of eyeless in the control of eye development. Mol. Cell 1999, 3, 297–307. [Google Scholar] [CrossRef]
- Puschel, A.W.; Gruss, P.; Westerfield, M. Sequence and expression pattern of pax-6 are highly conserved between zebrafish and mice. Development 1992, 114, 643–651. [Google Scholar] [PubMed]
- Halder, G.; Callaerts, P.; Gehring, W.J. Induction of ectopic eyes by targeted expression of the eyeless gene in Drosophila. Science 1995, 267, 1788–1792. [Google Scholar] [CrossRef] [PubMed]
- Pinson, J.; Mason, J.O.; Simpson, T.I.; Price, D.J. Regulation of the Pax6: Pax6(5a) mRNA ratio in the developing mammalian brain. BMC Dev. Biol. 2005, 5, 13. [Google Scholar] [CrossRef]
- Shimizu, N.; Watanabe, H.; Kubota, J.; Wu, J.; Saito, R.; Yokoi, T.; Era, T.; Iwatsubo, T.; Watanabe, T.; Nishina, S.; et al. Pax6-5a promotes neuronal differentiation of murine embryonic stem cells. Biol. Pharm. Bull. 2009, 32, 999–1003. [Google Scholar] [CrossRef]
- Singh, S.; Mishra, R.; Arango, N.A.; Deng, J.M.; Behringer, R.R.; Saunders, G.F. Iris hypoplasia in mice that lack the alternatively spliced Pax6(5a) isoform. Proc. Natl. Acad. Sci. USA 2002, 99, 6812–6815. [Google Scholar] [CrossRef]
- Nishina, S.; Kohsaka, S.; Yamaguchi, Y.; Handa, H.; Kawakami, A.; Fujisawa, H.; Azuma, N. PAX6 expression in the developing human eye. Br. J. Ophthalmol. 1999, 83, 723–727. [Google Scholar] [CrossRef]
- Suzuki, K.T.; Isoyama, Y.; Kashiwagi, K.; Sakuma, T.; Ochiai, H.; Sakamoto, N.; Furuno, N.; Kashiwagi, A.; Yamamoto, T. High efficiency TALENs enable F0 functional analysis by targeted gene disruption in Xenopus laevis embryos. Biol. Open 2013, 2, 448–452. [Google Scholar] [CrossRef] [PubMed]
- Nakayama, T.; Fisher, M.; Nakajima, K.; Odeleye, A.O.; Zimmerman, K.B.; Fish, M.B.; Yaoita, Y.; Chojnowski, J.L.; Lauderdale, J.D.; Netland, P.A.; et al. Xenopus pax6 mutants affect eye development and other organ systems, and have phenotypic similarities to human aniridia patients. Dev. Biol. 2015, 408, 328–344. [Google Scholar] [CrossRef] [PubMed]
- Murakami, Y.; Ogasawara, M.; Sugahara, F.; Hirano, S.; Satoh, N.; Kuratani, S. Identification and expression of the lamprey Pax6 gene: Evolutionary origin of the segmented brain of vertebrates. Development 2001, 128, 3521–3531. [Google Scholar]
- Pineda, D.; Rossi, L.; Batistoni, R.; Salvetti, A.; Marsal, M.; Gremigni, V.; Falleni, A.; Gonzalez-Linares, J.; Deri, P.; Salo, E. The genetic network of prototypic planarian eye regeneration is Pax6 independent. Development 2002, 129, 1423–1434. [Google Scholar]
- Cinar, H.N.; Chisholm, A.D. Genetic analysis of the Caenorhabditis elegans pax-6 locus: Roles of paired domain-containing and nonpaired domain-containing isoforms. Genetics 2004, 168, 1307–1322. [Google Scholar] [CrossRef]
- Miyamoto, K.; Suzuki, K.T.; Suzuki, M.; Sakane, Y.; Sakuma, T.; Herberg, S.; Simeone, A.; Simpson, D.; Jullien, J.; Yamamoto, T.; et al. The Expression of TALEN before Fertilization Provides a Rapid Knock-Out Phenotype in Xenopus laevis Founder Embryos. PLoS ONE 2015, 10, e0142946. [Google Scholar] [CrossRef]
- Schaefer, J.J.; Oliver, G.; Henry, J.J. Conservation of gene expression during embryonic lens formation and cornea-lens transdifferentiation in Xenopus laevis. Dev. Dyn. 1999, 215, 308–318. [Google Scholar] [CrossRef]
- Ding, Z.; Zhao, X.; Su, L.; Zhou, F.; Chen, N.; Wu, J.; Fu, X.; Wu, F.; Wang, W.; Liu, H. The Megalobrama amblycephala transferrin and transferrin receptor genes: Molecular cloning, characterization and expression during early development and after Aeromonas hydrophila infection. Dev. Comp. Immunol. 2015, 49, 290–297. [Google Scholar] [CrossRef]
- Kimmel, C.B.; Ballard, W.W.; Kimmel, S.R.; Ullmann, B.; Schilling, T.F. Stages of embryonic development of the zebrafish. Dev. Dyn. 1995, 203, 253–310. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Xue, T.; Yu, M.; Pan, Q.; Wang, Y.; Fang, J.; Li, L.; Deng, Y.; Chen, K.; Wang, Q.; Chen, T. Black carp vasa identifies embryonic and gonadal germ cells. Dev. Genes Evol. 2017, 227, 231–243. [Google Scholar] [CrossRef]
Primer Name | Sequence (5′ to 3′) | Temp (°C) | Usage |
---|---|---|---|
pax6b-F | ATGATGCAAAACAGTCACAGCG | 59.1 | sqRT-PCR |
pax6b-R | GTGTGGAAGTCAAAGGGCGAAG | 60.8 | sqRT-PCR |
pax6b GSP | CTGTCCCTGTCCAAGTTCCCG | 61.9 | 3′RACE PCR |
pax6b NGSP | CTTCGCCCTTTGACTTCCACAC | 60.8 | 3′RACE PCR and probe |
pax6a GSP | TGTACCAGTCCAAGTGCCAGG | 61.4 | 3′RACE PCR |
pax6a NGSP | CCTGACGTCTCTCGGCTTCAAG | 61.7 | 3′RACE PCR and probe |
pax6a-F | CGTCCATGATGCAAAACAGTCAC | 59.5 | sqRT-PCR |
pax6a-R | CTTGAAGCCGAGAGACGTCAGG | 61.7 | sqRT-PCR |
pax6a qF | CCAGCCAGACCTCATCCTACTCC | 62.9 | qRT-PCR |
pax6a qR | CTTGAAGCCGAGAGACGTCAGG | 61.7 | qRT-PCR |
pax6b qF | GCAACCAAGCCAGACATCTTCC | 61.0 | qRT-PCR |
pax6b qR | GTGTGGAAGTCAAAGGGCGAAG | 60.8 | qRT-PCR |
β-actin qF | AAAATCAAGATCATCGCCCCAC | 59.0 | qRT-PCR |
β-actin qR | TACTCCTGCTTGCTAATCCAC | 59.4 | qRT-PCR |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pan, Q.; Xue, T.; Xia, B.; Luo, J.; Wang, Q.; Jiang, Y.; Yu, M.; Chen, T. Gonadal, Not Maternal, Acquisition of Duplicated pax6 Orthologs in Megalobrama Amblycephala. Int. J. Mol. Sci. 2019, 20, 1710. https://doi.org/10.3390/ijms20071710
Pan Q, Xue T, Xia B, Luo J, Wang Q, Jiang Y, Yu M, Chen T. Gonadal, Not Maternal, Acquisition of Duplicated pax6 Orthologs in Megalobrama Amblycephala. International Journal of Molecular Sciences. 2019; 20(7):1710. https://doi.org/10.3390/ijms20071710
Chicago/Turabian StylePan, Qihua, Ting Xue, Bilin Xia, Junzhi Luo, Qian Wang, Yuewen Jiang, Miao Yu, and Tiansheng Chen. 2019. "Gonadal, Not Maternal, Acquisition of Duplicated pax6 Orthologs in Megalobrama Amblycephala" International Journal of Molecular Sciences 20, no. 7: 1710. https://doi.org/10.3390/ijms20071710