Transcriptomic Pattern of Genes Regulating Protein Response and Status of Mitochondrial Activity Are Related to Oocyte Maturational Competence—A Transcriptomic Study
Abstract
:1. Introduction
2. Results
3. Discussion
4. Material and Methods
4.1. Experimental Design
4.2. Animals
4.3. Collection of Porcine Ovaries and Cumulus-Oocyte-Complexes (COCs)
4.4. Assessment of Oocyte Developmental Competence by BCB Test
4.5. In Vitro Maturation of Porcine Cumulus-Oocyte-Complexes (COCs)
4.6. RNA Extraction from Porcine Oocytes
4.7. Microarray Expression Analysis and Statistics
4.8. Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) Analysis
4.9. Oocyte Mitochondrial Activity Examination
Author Contributions
Funding
Conflicts of Interest
References
- Suresh, K.P.; Nandi, S.; Mondal, S. Factors affecting laboratory production of buffalo embryos: A meta-analysis. Theriogenology 2009, 72, 978–985. [Google Scholar] [CrossRef]
- Rybska, M.; Knap, S.; Jankowski, M.; Jeseta, M.; Bukowska, D.; Antosik, P.; Nowicki, M.; Zabel, M.; Kempisty, B.; Jaśkowski, J.M. Cytoplasmic and nuclear maturation of oocytes in mammals—Living in the shadow of cells developmental capability. Med. J. Cell Biol. 2018, 6, 13–17. [Google Scholar] [CrossRef]
- Chermuła, B.; Brązert, M.; Jeseta, M.; Ożegowska, K.; Sujka-Kordowska, P.; Konwerska, A.; Bryja, A.; Kranc, W.; Jankowski, M.; Nawrocki, M.J.; et al. The Unique Mechanisms of Cellular Proliferation, Migration and Apoptosis are Regulated through Oocyte Maturational Development—A Complete Transcriptomic and Histochemical Study. Int. J. Mol. Sci. 2018, 20, 84. [Google Scholar] [CrossRef] [PubMed]
- Ożegowska, K.; Dyszkiewicz-Konwińska, M.; Celichowski, P.; Nawrocki, M.J.; Bryja, A.; Jankowski, M.; Kranc, W.; Brązert, M.; Knap, S.; Jeseta, M.; et al. Expression pattern of new genes regulating female sex differentiation and in vitro maturational status of oocytes in pigs. Theriogenology 2018, 121, 122–133. [Google Scholar] [CrossRef]
- Celichowski, P.; Nawrocki, M.J.; Dyszkiewicz-Konwińska, M.; Jankowski, M.; Budna, J.; Bryja, A.; Kranc, W.; Borys, S.; Knap, S.; Ciesiółka, S.; et al. “Positive Regulation of RNA Metabolic Process” Ontology Group Highly Regulated in Porcine Oocytes Matured In Vitro: A Microarray Approach. BioMed Res. Int. 2018, 2018, 1–10. [Google Scholar] [CrossRef] [Green Version]
- El Shourbagy, S.H.; Spikings, E.C.; Freitas, M.; John, J.C.S. Mitochondria directly influence fertilisation outcome in the pig. Reproduction 2006, 131, 233–245. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moyes, C.D.; Battersby, B.J.; Leary, S.C. Regulation of muscle mitochondrial design. J. Exp. Biol. 1998, 201, 299–307. [Google Scholar] [PubMed]
- Liu, H.; Shi, W.; Wang, D.; Zhao, X. Association analysis of mitochondrial DNA polymorphisms with oocyte number in pigs. Reprod. Fertil. Dev. 2019, 31, 805. [Google Scholar] [CrossRef]
- Zand, E.; Fathi, R.; Nasrabadi, M.H.; Atrabi, M.J.; Spears, N.; Akbarinejad, V. Maturational gene upregulation and mitochondrial activity enhancement in mouse in vitro matured oocytes and using granulosa cell conditioned medium. Zygote 2018, 26, 366–371. [Google Scholar] [CrossRef]
- Kang, E.; Wu, J.; Gutierrez, N.M.; Koski, A.; Tippner-Hedges, R.; Agaronyan, K.; Platero-Luengo, A.; Martinez-Redondo, P.; Ma, H.; Lee, Y.; et al. Mitochondrial replacement in human oocytes carrying pathogenic mitochondrial DNA mutations. Nat. Cell Biol. 2016, 540, 270–275. [Google Scholar] [CrossRef]
- Budna, J.; Celichowski, P.; Karimi, P.; Kranc, W.; Bryja, A.; Ciesiółka, S.; Rybska, M.; Borys, S.; Jeseta, M.; Bukowska, D.; et al. Does Porcine Oocytes Maturation in Vitro is Regulated by Genes Involved in “transforming growth factor β receptor signaling pathway”? Adv. Cell Biol. 2017, 5, 1–14. [Google Scholar] [CrossRef]
- Kranc, W.; Budna, J.; Chachuła, A.; Borys, S.; Bryja, A.; Rybska, M.; Ciesiółka, S.; Sumelka, E.; Jeseta, M.; Brüssow, K.P.; et al. Cell Migration’ Is the Ontology Group Differentially Expressed in Porcine Oocytes Before and After In Vitro Maturation: A Microarray Approach. DNA Cell Biol. 2017, 36, 273–282. [Google Scholar] [CrossRef]
- Budna, J.; Bryja, A.; Celichowski, P.; Kranc, W.; Ciesiółka, S.; Borys, S.; Rybska, M.; Kolecka-Bednarczyk, A.; Jeseta, M.; Bukowska, D.; et al. ‘Bone Development’ Is an Ontology Group Upregulated in Porcine Oocytes Before In Vitro Maturation: A Microarray Approach. DNA Cell Biol. 2017, 36, 638–646. [Google Scholar] [CrossRef] [PubMed]
- Krishna, A.; Bhatt, M.L.B.; Singh, V.; Singh, S.; Gangwar, P.K.; Singh, U.S.; Kumar, V.; Mehrotra, D. Differential Expression of c-fos Proto-Oncogene in Normal Oral Mucosa versus Squamous Cell Carcinoma. Asian Pac. J. Cancer Prev. 2018, 19, 867–874. [Google Scholar] [PubMed]
- Li, X.; Liu, C.; Jin, M.; Lu, B. Oocyte-Specific Expression of Mouse MEX3C652AA in the Ovary and Its Potential Role in Regulating Maternal Fos mRNA. Biol. Reprod. 2016, 94, 115. [Google Scholar] [CrossRef]
- Fakruzzaman, M.; Ghanem, N.; Bang, J.-I.; Ha, A.-N.; Lee, K.-L.; Sohn, S.-H.; Wang, Z.; Lee, D.-S.; Kong, I.-K. Effect of peroxiredoxin II on the quality and mitochondrial activity of pre-implantation bovine embryos. Reprod. Sci. 2015, 159, 172–183. [Google Scholar] [CrossRef] [PubMed]
- Guo, L.; Lan, J.; Lin, Y.; Guo, P.; Nie, Q.; Mao, Q.; Ren, L.; Qiu, Y. Hypoxia/ischemia up-regulates Id2 expression in neuronal cells in vivo and in vitro. Neurosci. Lett. 2013, 554, 88–93. [Google Scholar] [CrossRef]
- Zhong, W.; Xie, Y.; Abdallah, M.; Awonuga, A.O.; Slater, J.A.; Sipahi, L.; Puscheck, E.E.; Rappolee, D.A. Cellular stress causes reversible, PRKAA1/2-, and proteasome-dependent ID2 protein loss in trophoblast stem cells. Reproduction 2010, 140, 921–930. [Google Scholar] [CrossRef] [Green Version]
- Murre, C.; Massari, M.E. Helix-Loop-Helix Proteins: Regulators of Transcription in Eucaryotic Organisms. Mol. Cell. Biol. 2000, 20, 429–440. [Google Scholar] [Green Version]
- Budna, J.; Chachuła, A.; Kaźmierczak, D.; Rybska, M.; Ciesiółka, S.; Bryja, A.; Kranc, W.; Borys, S.; Żok, A.; Bukowska, D.; et al. Morphogenesis-related gene-expression profile in porcine oocytes before and after in vitro maturation. Zygote 2017, 25, 331–340. [Google Scholar] [CrossRef]
- Verbraak, E.J.C.; van ’t Veld, E.M.; Groot Koerkamp, M.; Roelen, B.A.J.; van Haeften, T.; Stoorvogel, W.; Zijlstra, C. Identification of genes targeted by FSH and oocytes in porcine granulosa cells. Theriogenology 2011, 75, 362–376. [Google Scholar] [CrossRef]
- Kaune, H.; Peyrache, E.; Williams, S.A. Oocyte-derived Smad4 is not required for development of the oocyte or the preimplantation embryo. Theriogenology 2015, 83, 897–903. [Google Scholar] [CrossRef]
- Zhang, L.; Du, X.; Wei, S.; Li, D.; Li, Q. A comprehensive transcriptomic view on the role of SMAD4 gene by RNAi-mediated knockdown in porcine follicular granulosa cells. Reproduction 2016, 152, 81–89. [Google Scholar] [CrossRef] [Green Version]
- Trau, H.A.; Brännström, M.; Curry, T.E.; Duffy, D.M. Prostaglandin E2 and vascular endothelial growth factor A mediate angiogenesis of human ovarian follicular endothelial cells. Hum. Reprod. 2016, 31, 436–444. [Google Scholar] [CrossRef] [Green Version]
- Konwerska, A.; Janik, B.; Malińska, A.; Witkiewicz, W.; Zabel, M. The Contribution of Endothelial Marker Proteins in the Determination of Vascular Angiogenic Potential, in Normal Physiological Conditions and in Neoplasia. Adv. Cell Biol. 2011, 3, 69–83. [Google Scholar] [CrossRef] [Green Version]
- Douglas, L.M.; Alvarez, F.J.; McCreary, C.; Konopka, J.B. Septin Function in Yeast Model Systems and Pathogenic Fungi. Eukaryot. Cell 2005, 4, 1503–1512. [Google Scholar] [CrossRef] [Green Version]
- Behbahanian, A.; Eimani, H.; Zeinali, B.; Valojerdi, M.R.; Yazdi, P.E.; Shahverdi, A.; Gourabi, H.; Golkar-Narenji, A. In Vitro Maturation, Fertilization and Embryo Culture of Oocytes Obtained from Vitrified Auto-Transplanted Mouse Ovary. Int. J. Fertil. Steril. 2013, 6, 278–285. [Google Scholar]
- Zand-Vakili, M.; Golkar-Narenji, A.; E Mozdziak, P.; Eimani, H. An in vitro study on oocyte and follicles of transplanted ovaries treated with vascular endothelial growth factor. J. Turk. Gynecol. Assoc. 2017, 18, 167–173. [Google Scholar] [CrossRef]
- Wright, G.L.; Maroulakou, I.G.; Eldridge, J.; Liby, T.L.; Sridharan, V.; Tsichlis, P.N.; Muise-Helmericks, R.C. VEGF stimulation of mitochondrial biogenesis: requirement of AKT3 kinase. FASEB J. 2008, 22, 3264–3275. [Google Scholar] [CrossRef] [Green Version]
- Tirone, F. The gene PC3TIS21/BTG2, prototype member of the PC3/BTG/TOB family: Regulator in control of cell growth, differentiation, and DNA repair? J. Cell. Physiol. 2001, 187, 155–165. [Google Scholar] [CrossRef]
- Hu, X.; Xing, L.; Jiao, Y.; Xu, J.; Wang, X.; Han, A.; Yu, J. BTG2 overexpression increases the radiosensitivity of breast cancer cells in vitro and in vivo. Oncol. Res. 2013, 20, 457–465. [Google Scholar] [CrossRef]
- Zhang, Y.-J.; Wei, L.; Liu, M.; Li, J.; Zheng, Y.-Q.; Gao, Y.; Li, X.-R. BTG2 inhibits the proliferation, invasion, and apoptosis of MDA-MB-231 triple-negative breast cancer cells. Tumor Biol. 2013, 34, 1605–1613. [Google Scholar] [CrossRef]
- Fiori, M.E.; Villanova, L.; Barbini, C.; de Angelis, M.L.; De Maria, R. miR-663 sustains NSCLC by inhibiting mitochondrial outer membrane permeabilization (MOMP) through PUMA/BBC3 and BTG2. Cell Death 2018, 9, 49. [Google Scholar] [CrossRef] [Green Version]
- Borys, S.; Khozmi, R.; Kranc, W.; Bryja, A.; Dyszkiewicz-Konwinska, M.; Jeseta, M.; Kempisty, B. Recent Findings of the Types of Programmed Cell Death. Adv. Cell Biol. 2017, 5, 43–49. [Google Scholar] [CrossRef] [Green Version]
- Huang, Y.; Zhang, J.; Shao, H.; Liu, J.; Jin, M.; Chen, J.; Zhao, H. miR-33a Mediates the Anti-Tumor Effect of Lovastatin in Osteosarcoma by Targeting CYR61. Cell. Physiol. Biochem. 2018, 51, 938–948. [Google Scholar] [CrossRef]
- Chien, W.; Kumagai, T.; Miller, C.W.; Desmond, J.C.; Frank, J.M.; Said, J.W.; Koeffler, H.P. Cyr61 Suppresses Growth of Human Endometrial Cancer Cells. J. Biol. Chem. 2004, 279, 53087–53096. [Google Scholar] [CrossRef] [Green Version]
- Chen, Y.; Breen, K.; E Pepling, M. Estrogen can signal through multiple pathways to regulate oocyte cyst breakdown and primordial follicle assembly in the neonatal mouse ovary. J. Endocrinol. 2009, 202, 407–417. [Google Scholar] [CrossRef] [Green Version]
- Ribas, V.; Drew, B.G.; Zhou, Z.; Phun, J.; Kalajian, N.Y.; Soleymani, T.; Daraei, P.; Widjaja, K.; Wanagat, J.; Vallim, T.Q.D.A.; et al. Skeletal muscle action of estrogen receptor α is critical for the maintenance of mitochondrial function and metabolic homeostasis in females. Sci. Transl. Med. 2016, 8, 334ra54. [Google Scholar] [CrossRef]
- McElroy, S.L.; Byrne, J.A.; Chavez, S.L.; Behr, B.; Hsueh, A.J.; Westphal, L.M.; Pera, R.A.R. Parthenogenic Blastocysts Derived from Cumulus-Free In Vitro Matured Human Oocytes. PLoS ONE 2010, 5, e10979. [Google Scholar] [CrossRef]
- Walters, K.A.; Middleton, L.J.; Joseph, S.R.; Hazra, R.; Jimenez, M.; Simanainen, U.; Allan, C.M.; Handelsman, D.J. Targeted Loss of Androgen Receptor Signaling in Murine Granulosa Cells of Preantral and Antral Follicles Causes Female Subfertility. Biol. Reprod. 2012, 87, 151. [Google Scholar] [CrossRef]
- Wang, X.; Deng, H.; Basu, I.; Zhu, L. Induction of Androgen Receptor-Dependent Apoptosis in Prostate Cancer Cells by the Retinoblastoma Protein. Cancer Res. 2004, 64, 1377–1385. [Google Scholar] [CrossRef] [Green Version]
- Van Montfoort, A.P.; Geraedts, J.P.; Dumoulin, J.C.; Stassen, A.P.; Evers, J.; Ayoubi, T.A. Differential gene expression in cumulus cells as a prognostic indicator of embryo viability: A microarray analysis. Mol. Hum. Reprod. 2008, 14, 157–168. [Google Scholar] [CrossRef]
- Budna, J.; Rybska, M.; Ciesiółka, S.; Bryja, A.; Borys, S.; Kranc, W.; Wojtanowicz-Markiewicz, K.; Jeseta, M.; Sumelka, E.; Bukowska, D.; et al. Expression of genes associated with BMP signaling pathway in porcine oocytes before and after IVM—A microarray approach. Reprod. Biol. Endocrinol. 2017, 15, 43. [Google Scholar] [CrossRef]
- Lin, J.; Patel, S.R.; Cheng, X.; Cho, E.A.; Levitan, I.; Ullenbruch, M.; Phan, S.H.; Park, J.M.; Dressler, G.R. Kielin/chordin-like protein, a novel enhancer of BMP signaling, attenuates renal fibrotic disease. Nat. Med. 2005, 11, 387–393. [Google Scholar] [CrossRef]
- Bentov, Y.; Casper, R.F. The aging oocyte—Can mitochondrial function be improved? Fertil. Steril. 2013, 99, 18–22. [Google Scholar] [CrossRef]
- Egerszegi, I.; Alm, H.; Ratky, J.; Heleil, B.; Brüssow, K.-P.; Torner, H. Meiotic progression, mitochondrial features and fertilisation characteristics of porcine oocytes with different G6PDH activities. Reprod. Fertil. Dev. 2010, 22, 830–838. [Google Scholar] [CrossRef]
- Roca, J.; Martínez, E.; Vazquez, J.M.; Lucas, X. Selection of immature pig oocytes for homologous in vitro penetration assays with the brilliant cresyl blue test. Reprod. Fertil. Dev. 1998, 10, 479–486. [Google Scholar] [CrossRef]
- Kranc, W.; Jankowski, M.; Budna, J.; Celichowski, P.; Khozmi, R.; Bryja, A.; Borys, S.; Dyszkiewicz-Konwińska, M.; Jeseta, M.; Magas, M.; et al. Amino acids metabolism and degradation is regulated during porcine oviductal epithelial cells (OECs) primary culture in vitro—A signaling pathways activation approach. Med. J. Cell Biol. 2018, 6, 18–26. [Google Scholar] [CrossRef]
- Chamier-Gliszczyńska, A.; Brązert, M.; Sujka-Kordowska, P.; Popis, M.; Ożegowska, K.; Stefańska, K.; Kocherova, I.; Celichowski, P.; Kulus, M.; Bukowska, D.; et al. Genes involved in angiogenesis and circulatory system development are differentially expressed in porcine epithelial oviductal cells during long-term primary in vitro culture—A transcriptomic study. Med. J. Cell Biol. 2018, 6, 163–173. [Google Scholar] [CrossRef]
- Bryja, A.; Dyszkiewicz-Konwińska, M.; Jankowski, M.; Celichowski, P.; Stefańska, K.; Chamier-Gliszczyńska, A.; Popis, M.; Mehr, K.; Bukowska, D.; Antosik, P.; et al. Ion homeostasis and transport are regulated by genes differentially expressed in porcine buccal pouch mucosal cells during long-term culture in vitro—A microarray approach. Med. J. Cell Biol. 2018, 6, 75–82. [Google Scholar] [CrossRef]
- Nawrocki, M.J.; Celichowski, P.; Jankowski, M.; Kranc, W.; Bryja, A.; Borys-Wójcik, S.; Jeseta, M.; Antosik, P.; Bukowska, D.; Bruska, M.; et al. Ontology groups representing angiogenesis and blood vessels development are highly up-regulated during porcine oviductal epithelial cells long-term real-time proliferation—A primary cell culture approach. Med. J. Cell Biol. 2018, 6, 186–194. [Google Scholar] [CrossRef]
- Stefańska, K.; Chamier-Gliszczyńska, A.; Jankowski, M.; Celichowski, P.; Kulus, M.; Rojewska, M.; Antosik, P.; Bukowska, D.; Bruska, M.; Nowicki, M.; et al. Epithelium morphogenesis and oviduct development are regulated by significant increase of expression of genes after long-term in vitro primary culture—A microarray assays. Med. J. Cell Biol. 2018, 6, 195–204. [Google Scholar] [CrossRef]
- Walter, W.; Sánchez-Cabo, F.; Ricote, M. GOplot: An R package for visually combining expression data with functional analysis: Fig. 1. Bioinformatics 2015, 31, 2912–2914. [Google Scholar] [CrossRef] [PubMed]
Official Gene Symbol | Fold Change | Adjusted p Value | logFC |
---|---|---|---|
FOS | 0.052794356 | 4.74 × 10−5 | −4.243472475 |
ID2 | 0.062979704 | 4.74 × 10−5 | −3.988969222 |
VEGFA | 0.069689389 | 0.001912689 | −3.84291719 |
BTG2 | 0.074386393 | 9.55 × 10−5 | −3.748817455 |
CYR61 | 0.080657036 | 7.54 × 10−5 | −3.632055792 |
ESR1 | 0.081629841 | 0.000522187 | −3.614759536 |
AR | 0.1059863 | 0.000138367 | −3.238050297 |
TACR3 | 0.115060322 | 0.000148036 | −3.119537684 |
CCND2 | 0.121809064 | 0.000178804 | −3.0373066 |
CHRDL1 | 0.139364543 | 4.74 × 10−5 | −2.843064537 |
EGR2 | 0.165503832 | 0.007949861 | −2.595063475 |
EDNRA | 0.166939028 | 0.00185422 | −2.582606817 |
ANGPTL4 | 0.183631311 | 0.000513422 | −2.44511602 |
TGFBR3 | 0.196522244 | 0.000405979 | −2.347235474 |
FST | 0.224696558 | 0.000364693 | −2.153950068 |
MCL1 | 0.244179957 | 0.001775249 | −2.033983311 |
IHH | 0.304995843 | 0.000551261 | −1.713138513 |
INSR | 0.31601561 | 0.001912689 | −1.661932271 |
ZCCHC11 | 0.3216223 | 0.019809962 | −1.636560654 |
ID1 | 0.335473139 | 0.003974331 | −1.575730839 |
TXNIP | 0.355538611 | 0.000780875 | −1.491921851 |
SMAD4 | 0.367802201 | 0.001238681 | −1.442997981 |
MAP3K1 | 0.36876538 | 0.024748462 | −1.439224873 |
EGR1 | 0.376128185 | 0.005477006 | −1.410703676 |
PDLIM1 | 0.380689412 | 0.001429255 | −1.393313651 |
UBE2B | 0.382779667 | 0.041104659 | −1.385413899 |
PHIP | 0.385682339 | 0.02111605 | −1.374515012 |
ECE1 | 0.395387731 | 0.001177804 | −1.338659992 |
IGFBP7 | 0.403759522 | 0.002496043 | −1.30843181 |
KLF10 | 0.405438718 | 0.00684513 | −1.302444226 |
EIF2AK3 | 0.41888965 | 0.008422055 | −1.255357857 |
VCP | 0.435612412 | 0.007402292 | −1.198883032 |
HSPA4 | 0.441182204 | 0.002321468 | −1.180553494 |
SERPINH1 | 0.467321273 | 0.006338248 | −1.097513384 |
PLD1 | 0.468341554 | 0.011044722 | −1.094367046 |
MMP14 | 0.488721147 | 0.038060423 | −1.032916564 |
Gene | Gene ID | Primer Sequence (5′–3′) | Product Size (bp) |
---|---|---|---|
FOS | 100144486 | AGAATCCGAAGGGAAAGGAACTTCTCCTTCAGCAGGTTGG | 150 |
ID2 | 654298 | CCAGTGAGGTCCGTTAGGAAGACAATAGTGGGGTGCGAGT | 243 |
VEGFA | 397157 | CTACCTCCACCATGCCAAGTACACTCCAGACCTTCGTCGT | 232 |
BTG2 | 100048932 | TGGTTTCCTGAAAAGCCATCGGACACTTCATAGGGGTCCA | 150 |
CYR61 | 100153791 | GAGCCTCGCGTTCTCTACACTGCATCTCTTGCCCTTTTTC | 217 |
ESR1 | 397435 | CGTCCAAGCTCAAAGAGACCCGAAGAATGTGCTCGATGAA | 160 |
AR | 397582 | GAACCTACCAGGGACCATGTCTGTTTCCCTTCAGCAGCTC | 156 |
TACR3 | 100521983 | GGTCCCAAACAACACTTCACTGCCTTTAGCTGCTCATGGTA | 161 |
CCND2 | 397162 | GGCAAGTTGAAGTGGAACCTTGGCGAACTTGAAGTCAGTG | 154 |
CHRDL1 | 100521058 | TTCCTAGAAGGAAGCAAGACAGCGTTCTCTGAGCAGATGCAG | 151 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chermuła, B.; Brązert, M.; Jeseta, M.; Ożegowska, K.; Kocherova, I.; Jankowski, M.; Celichowski, P.; Sujka-Kordowska, P.; Konwerska, A.; Piotrowska-Kempisty, H.; et al. Transcriptomic Pattern of Genes Regulating Protein Response and Status of Mitochondrial Activity Are Related to Oocyte Maturational Competence—A Transcriptomic Study. Int. J. Mol. Sci. 2019, 20, 2238. https://doi.org/10.3390/ijms20092238
Chermuła B, Brązert M, Jeseta M, Ożegowska K, Kocherova I, Jankowski M, Celichowski P, Sujka-Kordowska P, Konwerska A, Piotrowska-Kempisty H, et al. Transcriptomic Pattern of Genes Regulating Protein Response and Status of Mitochondrial Activity Are Related to Oocyte Maturational Competence—A Transcriptomic Study. International Journal of Molecular Sciences. 2019; 20(9):2238. https://doi.org/10.3390/ijms20092238
Chicago/Turabian StyleChermuła, Błażej, Maciej Brązert, Michal Jeseta, Katarzyna Ożegowska, Ievgenia Kocherova, Maurycy Jankowski, Piotr Celichowski, Patrycja Sujka-Kordowska, Aneta Konwerska, Hanna Piotrowska-Kempisty, and et al. 2019. "Transcriptomic Pattern of Genes Regulating Protein Response and Status of Mitochondrial Activity Are Related to Oocyte Maturational Competence—A Transcriptomic Study" International Journal of Molecular Sciences 20, no. 9: 2238. https://doi.org/10.3390/ijms20092238