Reg3α and Reg3β Expressions Followed by JAK2/STAT3 Activation Play a Pivotal Role in the Acceleration of Liver Hypertrophy in a Rat ALPPS Model
Abstract
:1. Introduction
2. Results
2.1. Effects of the Site of the Liver Partition on Liver Hypertrophy
2.2. Effects of the Site of the Liver Partition on Cytokine Production
2.3. Expression of Hepatocyte Growth Factor (HGF) mRNA in the Liver Tissue of FLR
2.4. Janus Kinase (JAK) 2/Signal Transducer and Activator of Transcription (STAT) 3 Pathway in the ALPPS Group
2.5. Regenerating Islet-Derived (Reg)3α and Reg3β Are Related to Rapid Liver Hypertrophy in ALPPS
2.6. Location of Reg3α and Reg3β Protein Expression
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Surgical Procedures and Study Design
4.3. Serum Liver Enzymes
4.4. Enzyme-Linked Immunosorbent Assay (ELISA) for Serum Inflammatory Cytokines
4.5. Immunohistochemistry
4.6. JAK2 Inhibitor in ALPPS Model
4.7. Quantitative Real-Time Reverse Transcription Polymerase Chain Reaction (RT-PCR)
4.8. cRNA Microarray for Gene Expression Profiling
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
Abbreviations
ALPPS | associating liver partition and portal vein ligation for staged hepatectomy |
PiLL | partition inside the ligated lobe |
PVL | portal vein ligation |
JAK2 | Janus kinase 2 |
STAT3 | signal transducer and activator of transcription 3 |
Reg3 | regenerating islet-derived 3 |
FLR | future liver remnant |
RML | right median lobe |
LLL | left lateral lobe |
BW | body weight |
Day | postoperative day |
PCNA | proliferating cell nuclear antigen |
pH3 | phosphorylated Histone H3 |
AST | aspartate aminotransferase |
ALT | alanine aminotransferase |
LDH | lactate dehydrogenase |
IL-6 | interleukin-6 |
TNF-α | tumor necrosis factor-α |
HGF | hepatocyte growth factor |
RNA | ribonucleic acid |
mRNA | messenger ribonucleic acid |
HIP/PAP | human hepatocarcinoma-intestine-pancreas/pancreas-associated protein |
cRNA | complementary ribonucleic acid |
GAPDH | glyceraldehyde 3-phosphate dehydrogenase |
ELISA | enzyme-linked immunosorbent assay |
cDNA | complementary deoxyribonucleic acid |
DMSO | dimethylsulfoxide |
RT-PCR | reverse transcription polymerase chain reaction |
RNA | ribonucleic acid |
limma | Linear Models for Microarray Analysis |
References
- Clavien, P.A.; Oberkofler, C.E.; Raptis, D.A.; Lehmann, K.; Rickenbacher, A.; El-Badry, A.M. What is critical for liver surgery and partial liver transplantation: Size or quality? Hepatology 2010, 52, 715–729. [Google Scholar] [CrossRef]
- Clavien, P.A.; Petrowsky, H.; DeOliveira, M.; Graf, R. Strategies for safer liver surgery and partial liver transplantation. N. Engl. J. Med. 2007, 356, 1545–1559. [Google Scholar] [CrossRef] [PubMed]
- Abulkhir, A.; Limongelli, P.; Healey, A.J.; Damrah, O.; Tait, P.; Jackson, J.; Habib, N.; Jiao, L.R. Preoperative portal vein embolization for major liver resection: A meta-analysis. Ann. Surg. 2008, 247, 49–57. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, H.; Zhu, S. Present status and future perspectives of preoperative portal vein embolization. Am. J. Surg. 2009, 197, 686–690. [Google Scholar] [CrossRef] [PubMed]
- Schnitzbauer, A.A.; Lang, S.A.; Goessmann, H.; Nadalin, S.; Baumgart, J.; Farkas, S.A.; Fichtner-Feigl, S.; Lorf, T.; Goralcyk, A.; Hörbelt, R.; et al. Right portal vein ligation combined with in situ splitting induces rapid left lateral liver lobe hypertrophy enabling 2-staged extended right hepatic resection in small-for-size settings. Ann. Surg. 2012, 255, 405–414. [Google Scholar] [CrossRef] [PubMed]
- Schadde, E.; Ardiles, V.; Slankamenac, K.; Tschuor, C.; Sergeant, G.; Amacker, N.; Baumgart, J.; Croome, K.; Hernandez-Alejandro, R.; Lang, H.; et al. ALPPS offers a better chance of complete resection in patients with primarily unresectable liver tumors compared with conventional-staged hepatectomies: Results of a multicenter analysis. World J. Surg. 2014, 38, 1510–1519. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schadde, E.; Raptis, D.A.; Schnitzbauer, A.A.; Ardiles, V.; Tschuor, C.; Lesurtel, M.; Abdalla, E.K.; Hernandez-Alejandro, R.; Jovine, E.; Machado, M.; et al. Prediction of mortality after ALPPS stage-1: An analysis of 320 patients from the international ALPPS registry. Ann. Surg. 2015, 262, 780–785. [Google Scholar] [CrossRef] [Green Version]
- Petrowsky, H.; Györi, G.; de Oliveira, M.; Lesurtel, M.; Clavien, P.A. Is partial-ALPPS safer than ALPPS?: A single-center experience. Ann. Surg. 2015, 261, e90–e92. [Google Scholar] [CrossRef] [Green Version]
- de Santibañes, E.; Alvarez, F.A.; Ardiles, V.; Pekolj, J.; de Santibañes, M. Inverting the ALPPS paradigm by minimizing first stage impact: The Mini-ALPPS technique. Langenbeck Arch. Surg. 2016, 401, 557–563. [Google Scholar] [CrossRef]
- Schlegel, A.; Lesurtel, M.; Melloul, E.; Limani, P.; Tschuor, C.; Graf, R.; Humar, B.; Clavien, P.A. ALPPS: From human to mice highlighting accelerated and novel mechanisms of liver regeneration. Ann. Surg. 2014, 260, 839–846. [Google Scholar] [CrossRef] [Green Version]
- Yao, L.; Li, C.; Ge, X.; Wang, H.; Xu, K.; Zhang, A.; Dong, J. Establishment of a rat model of portal vein ligation combined with in situ splitting. PLoS ONE 2014, 9, e105511. [Google Scholar] [CrossRef] [PubMed]
- Shi, H.; Yang, G.; Zheng, T.; Wang, J.; Li, L.; Liang, Y.; Xie, C.; Yin, D.; Sun, B.; Sun, J.; et al. A preliminary study of ALPPS procedure in a rat model. Sci. Rep. 2015, 5, 17567. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- García-Pérez, R.; Revilla-Nuin, B.; Martínez, C.M.; Bernabé-García, A.; Baroja Mazo, A.; Parrilla Paricio, P. Associated liver partition and portal vein ligation (ALPPS) vs selective portal vein ligation (PVL) for staged hepatectomy in a rat model. Similar regenerative response? PLoS ONE 2015, 10, e0144096. [Google Scholar] [CrossRef] [PubMed]
- Cao, F.; Zhang, Q.; Chen, W.; Han, C.; He, Y.; Ran, Q.; Yao, S. IL-6 increases SDCBP expression, cell proliferation, and cell invasion by activating JAK2/STAT3 in human glioma cells. Am. J. Transl. Res. 2017, 9, 4617–4626. [Google Scholar] [PubMed]
- Zhang, X.; Hu, F.; Li, G.; Li, G.; Yang, X.; Liu, L.; Zhang, R.; Zhang, B.; Feng, Y. Human colorectal cancer-derived mesenchymal stem cells promote colorectal cancer progression through IL-6/JAK2/STAT3 signaling. Cell Death Dis. 2018, 9, 25. [Google Scholar] [CrossRef]
- Liu, X.; Wang, J.; Wang, H.; Yin, G.; Liu, Y.; Lei, X.; Xiang, M. REG3A accelerates pancreatic cancer cell growth under IL-6-associated inflammatory condition: Involvement of a REG3A-JAK2/STAT3 positive feedback loop. Cancer Lett. 2015, 362, 45–60. [Google Scholar] [CrossRef]
- Loncle, C.; Bonjoch, L.; Folch-Puy, E.; Lopez-Millan, M.B.; Lac, S.; Molejon, M.I.; Chuluyan, E.; Cordelier, P.; Dubus, P.; Lomberk, G.; et al. IL17 functions through the novel REG3β-JAK2-STAT3 inflammatory pathway to promote the transition from chronic pancreatitis to pancreatic cancer. Cancer Res. 2015, 75, 4852–4862. [Google Scholar] [CrossRef] [Green Version]
- Cressman, D.E.; Diamond, R.H.; Taub, R. Rapid activation of the Stat3 transcription complex in liver regeneration. Hepatology 1995, 21, 1443–1449. [Google Scholar] [CrossRef]
- Cressman, D.E.; Greenbaum, L.E.; DeAngelis, R.A.; Ciliberto, G.; Furth, E.E.; Poli, V.; Taub, R. Liver failure and defective hepatocyte regeneration in interleukin-6-deficient mice. Science 1996, 274, 1379–1383. [Google Scholar] [CrossRef]
- Blindenbacher, A.; Wang, X.; Langer, I.; Savino, R.; Terracciano, L.; Heim, M.H. Interleukin 6 is important for survival after partial hepatectomy in mice. Hepatology 2003, 38, 674–682. [Google Scholar] [CrossRef]
- Bowman, T.; Garcia, R.; Turkson, J.; Jove, R. STATs in oncogenesis. Oncogene 2000, 19, 2474–2488. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Buettner, R.; Mora, L.B.; Jove, R. Activated STAT signaling in human tumors provides novel molecular targets for therapeutic intervention. Clin. Cancer Res. 2002, 8, 945–954. [Google Scholar] [PubMed]
- Keim, V.; Rohr, G.; Stockert, H.G.; Haberich, F.J. An additional secretory protein in the rat pancreas. Digestion 1984, 29, 242–249. [Google Scholar] [CrossRef] [PubMed]
- Keim, V.; Iovanna, J.L.; Rohr, G.; Usadel, K.H.; Dagorn, J.C. Characterization of a rat pancreatic secretory protein associated with pancreatitis. Gastroenterology 1991, 100, 775–782. [Google Scholar] [CrossRef]
- Zhang, Y.W.; Ding, L.S.; Lai, M.D. Reg gene family and human diseases. World J. Gastroenterol. 2003, 9, 2635–2641. [Google Scholar] [CrossRef]
- Fleming, A.; Rosenberg, L. Prospects and challenges for islet regeneration as a treatment for diabetes: A review of islet neogenesis associated protein. J. Diabetes Sci. Technol. 2007, 1, 231–244. [Google Scholar] [CrossRef] [Green Version]
- Moniaux, N.; Song, H.; Darnaud, M.; Garbin, K.; Gigou, M.; Mitchell, C.; Samuel, D.; Jamot, L.; Amouyal, P.; Amouyal, G.; et al. Human hepatocarcinoma-intestine-pancreas/pancreatitis-associated protein cures fas-induced acute liver failure in mice by attenuating free-radical damage in injured livers. Hepatology 2011, 53, 618–627. [Google Scholar] [CrossRef]
- Lieu, H.T.; Batteux, F.; Simon, M.T.; Cortes, A.; Nicco, C.; Zavala, F.; Pauloin, A.; Tralhao, J.G.; Soubrane, O.; Weill, B.; et al. HIP/PAP accelerates liver regeneration and protects against acetaminophen injury in mice. Hepatology 2005, 42, 618–626. [Google Scholar] [CrossRef]
- Simon, M.T.; Pauloin, A.; Normand, G.; Lieu, H.T.; Mouly, H.; Pivert, G.; Carnot, F.; Tralhao, J.G.; Brechot, C.; Christa, L. HIP/PAP stimulates liver regeneration after partial hepatectomy and combines mitogenic and anti-apoptotic functions through the PKA signaling pathway. FASEB J. 2003, 17, 1441–1450. [Google Scholar] [CrossRef] [Green Version]
- Starzl, T.E.; Fung, J.J. Themes of liver transplantation. Hepatology 2010, 51, 1869–1884. [Google Scholar] [CrossRef] [Green Version]
- Wang, B.; Zhao, L.; Fish, M.; Logan, C.Y.; Nusse, R. Self-renewing diploid Axin2(+) cells fuel homeostatic renewal of the liver. Nature 2015, 524, 180–185. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tsai, J.M.; Koh, P.W.; Stefanska, A.; Xing, L.; Walmsley, G.G.; Poux, N.; Weissman, I.; Rinkevich, Y. Localized hepatic lobular regeneration by central-vein-associated lineage-restricted progenitors. Proc. Natl. Acad. Sci. USA 2017, 114, 3654–3659. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gentleman, R.C.; Carey, V.J.; Bates, D.M.; Bolstad, B.; Dettling, M.; Dudoit, S.; Ellis, B.; Gautier, L.; Ge, Y.; Gentry, J.; et al. Bioconductor: Open software development for computational biology and bioinformatics. Genome Biol. 2004, 5, R80. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Smyth, G.K. Limma: Linear models for microarray data. In Bioinformatics and Computational Biology Solutions Using R and Bioconductor; Gentleman, R., Carey, V., Dudoit, S., Irizarry, R., Huber, W., Eds.; Springer: New York, NY, USA, 2005; pp. 397–420. [Google Scholar]
Gene | Classification | Ratio | Gene | Classification | Ratio |
---|---|---|---|---|---|
Akr1c2 | Alcohol metabolism | 14.32 | Il7 | Immune response | 2.044 |
Adh4 | Alcohol metabolism | 2.596 | Il1r1 | Immune response | 2.025 |
XAF1 | Apoptosis regulatory protein | 2.259 | Dhrs7 | Metabolism | 7.958 |
Procr | Blood coagulation | 2.425 | St6galnac4 | Metabolism | 2.505 |
Pla2g7 | Blood coagulation | 2.395 | Akr1c12 | Metabolism | 2.338 |
Itgb8 | Cell adhesion | 4.272 | Ldhb | Metabolism | 2.057 |
Siglec10 | Cell adhesion | 2.108 | Dcps | mRNA metabolism | 2.187 |
Ppdpf | Cell growth/differentiation | 2.021 | Ndnf | Neuronal factor | 6.066 |
Reg3a | Cell growth/differentiation | 5.619 | Gfra1 | Neuronal factor | 2.839 |
Reg3b | Cell growth/differentiation | 3.748 | Slc1a2 | Neuronal factor | 2.757 |
Pla2g2a | Cell growth/differentiation | 3.803 | Ptprt | Neuronal factor | 2.313 |
Ech1 | Energy metabolism | 2.998 | Sarm1 | Neuronal factor | 2.278 |
Acsm5 | Energy metabolism | 2.990 | Adora2b | Neuronal factor | 2.276 |
Acsm2a | Energy metabolism | 2.847 | Kcnn2 | Neuronal factor | 2.201 |
Pltp | Energy metabolism | 2.688 | Asrgl1 | Neuronal factor | 2.026 |
Slc13a5 | Energy metabolism | 2.649 | Asb15 | Protein metabolism | 10.38 |
Cxcl13 | Immune response | 7.468 | Slc7a8 | Protein metabolism | 2.374 |
Il1b | Immune response | 6.861 | Glul | Protein metabolism | 2.059 |
Siglec5 | Immune response | 6.649 | Pcsk5 | Protein metabolism | 2.037 |
Clec4a2 | Immune response | 5.488 | Pbsn | Purin metabolism | 2.098 |
Il7r | Immune response | 3.849 | Pbsn | Purin metabolism | 2.015 |
Cxcl1 | Immune response | 3.438 | Rhbdf2 | Signal transduction | 2.248 |
Cish | Immune response | 3.361 | Sectm1b | Signal transduction | 2.185 |
Ccl7 | Immune response | 3.189 | Inhbe | Signal transduction | 2.093 |
Il10 | Immune response | 3.134 | Cyp2j4 | Stress response | 2.553 |
Ccl3 | Immune response | 3.113 | Cyp3a9 | Stress response | 2.521 |
Adgre1 | Immune response | 3.051 | Cybb | Stress response | 2.140 |
Clec4a3 | Immune response | 2.985 | Cyp4b1 | Stress response | 5.069 |
Slamf6 | Immune response | 2.972 | Ephx2 | Stress response | 3.787 |
Il1a | Immune response | 2.917 | Serpina3m | Stress response | 3.509 |
Csf2rb | Immune response | 2.714 | Ubd | Stress response | 3.229 |
Timd4 | Immune response | 2.630 | Hspb1 | Stress response | 3.008 |
Siglec8 | Immune response | 2.618 | Cyp8b1 | Stress response | 2.840 |
Pilra | Immune response | 2.592 | Rac2 | Stress response | 2.576 |
Cd22 | Immune response | 2.530 | Tbxas1 | Stress response | 2.479 |
Selp | Immune response | 2.462 | Steap4 | Stress response | 2.474 |
Cd7 | Immune response | 2.396 | Nos1ap | Stress response | 2.437 |
Cd14 | Immune response | 2.372 | Reg3g | Stress response | 2.430 |
Cxcr5 | Immune response | 2.329 | Sult1c2 | Stress response | 2.427 |
Emr4 | Immune response | 2.306 | Naip5 | Stress response | 2.342 |
Il2rg | Immune response | 2.283 | Cyp7b1 | Stress response | 2.096 |
Cd44 | Immune response | 2.275 | Clec4a1 | Stress response | 2.079 |
Samsn1 | Immune response | 2.250 | Rnd2 | Stress response | 2.052 |
Cd72 | Immune response | 2.226 | Fxyd2 | Transport | 2.290 |
Igsf6 | Immune response | 2.180 | Slco1a1 | Transport | 2.139 |
Cebpd | Immune response | 2.163 | Slc43a3 | Transport | 2.137 |
Csf1r | Immune response | 2.160 | Slc13a3 | Transport | 2.110 |
Fcgr2a | Immune response | 2.118 | Snx10 | Transport | 2.110 |
Slamf7 | Immune response | 2.093 | Slc22a8 | Transport | 2.009 |
Cd37 | Immune response | 2.090 | Fam169b | Unknown | 3.655 |
Cd84 | Immune response | 2.083 | RT1-N2 | Unknown | 2.759 |
Tcp11l2 | Immune response | 2.080 | Klra7 | Unknown | 2.749 |
Genes | Forward | Reverse | Size (bp) |
---|---|---|---|
IL-6 | TGCTCTGGTCTTCTGGAGTTC | TGTTGCTCAGACTCTCCCTTC | 249 |
TNF-α | ATGTACCTGGGAGGAGTCTTC | AGAGTAATGGGGGTCAGAGTC | 188 |
HGF | AAGAGTGGCATCAAGTGCCAG | CTGGATTGCTTGTGAAACACC | 145 |
Reg3α | TGACTGAAGCTGAATGAAAGG | CAAGCAAGTACAGCCTTGTCATG | 236 |
Reg3β | CTCCCTCACAGTTAAGATGTTGC | CCTAACTGCCACATGAGACTTTC | 165 |
PCNA | TATTTGGCTCCCAAGATCGAAG | TTGGTGACAGAAAAGACCTCAG | 121 |
GAPDH | ACATCAAGAAGGTGGTGAAGC | ATGGGAGTTGCTGTTGAAGTC | 104 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Otsuka, N.; Yoshioka, M.; Abe, Y.; Nakagawa, Y.; Uchinami, H.; Yamamoto, Y. Reg3α and Reg3β Expressions Followed by JAK2/STAT3 Activation Play a Pivotal Role in the Acceleration of Liver Hypertrophy in a Rat ALPPS Model. Int. J. Mol. Sci. 2020, 21, 4077. https://doi.org/10.3390/ijms21114077
Otsuka N, Yoshioka M, Abe Y, Nakagawa Y, Uchinami H, Yamamoto Y. Reg3α and Reg3β Expressions Followed by JAK2/STAT3 Activation Play a Pivotal Role in the Acceleration of Liver Hypertrophy in a Rat ALPPS Model. International Journal of Molecular Sciences. 2020; 21(11):4077. https://doi.org/10.3390/ijms21114077
Chicago/Turabian StyleOtsuka, Naohiko, Masato Yoshioka, Yuki Abe, Yasuhiko Nakagawa, Hiroshi Uchinami, and Yuzo Yamamoto. 2020. "Reg3α and Reg3β Expressions Followed by JAK2/STAT3 Activation Play a Pivotal Role in the Acceleration of Liver Hypertrophy in a Rat ALPPS Model" International Journal of Molecular Sciences 21, no. 11: 4077. https://doi.org/10.3390/ijms21114077