Thrombocytosis and Effects of IL-6 Knock-Out in a Colitis-Associated Cancer Model
Abstract
:1. Introduction
2. Results
2.1. Verification of IL-6 Gene Knockout
2.2. Histopathological and Clinical Characteristics
2.3. PCR Results
2.4. Intraluminal Fluorescent Endomicroscopy
2.5. Imaging Studies
3. Discussion
4. Materials and Methods
4.1. IL-6 Gene Knockout
4.2. Animals Used in the Experiments
4.3. Experimental Protocol
4.4. Quantitative Real-Time PCR
- rplp1 for TAAGGCCGCGTTGAGGTG
- rplp1 rev GATCTTATCCTCCGTGACCGT
- thbs1 for CAT GCC ATG GCC AAC AAA CA
- thbs1 rev TTG CAC TCA CAG CGG TAC AT
- thpo1 for CTT CTC CAC CCG GAC AGA GT
- thpo1 rev CTG GCC AGG GTG TCT AAC TG
4.5. In Vivo Imaging Using PET/MRI and Intraluminal Fluorescent Confocal Endomicroscopy
4.6. Image Analysis
4.7. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Global Burden of Disease Cancer Collaboration; Fitzmaurice, C.; Akinyemiju, T.F.; Al Lami, F.H.; Alam, T.; Alizadeh-Navaei, R.; Allen, C.; Alsharif, U.; Alvis-Guzman, N.; Amini, E.; et al. Global, regional, and national cancer incidence, mortality, years of life lost, years lived with disability, and disability-adjusted life-years for 29 cancer groups, 1990 to 2016: A systematic analysis for the global burden of disease study. JAMA Oncol. 2018, 4, 1553–1568. [Google Scholar] [CrossRef]
- Sasaki, K.; Kawai, K.; Tsuno, N.H.; Sunami, E.; Kitayama, J. Impact of preoperative thrombocytosis on the survival of patients with primary colorectal cancer. World J. Surg. 2012, 36, 192–200. [Google Scholar] [CrossRef] [PubMed]
- Zhu, X.; Cao, Y.; Lu, P.; Kang, Y.; Lin, Z.; Hao, T.; Song, Y. Evaluation of platelet indices as diagnostic biomarkers for colorectal cancer. Sci. Rep. 2018, 8, 11814. [Google Scholar] [CrossRef] [PubMed]
- Rao, X.D.; Zhang, H.; Xu, Z.S.; Cheng, H.; Shen, W.; Wang, X.P. Poor prognostic role of the pretreatment platelet counts in colorectal cancer: A meta-analysis. Medicine 2018, 97, e10831. [Google Scholar] [CrossRef] [PubMed]
- Erpenbeck, L.; Schon, M.P. Deadly allies: The fatal interplay between platelets and metastasizing cancer cells. Blood 2010, 115, 3427–3436. [Google Scholar] [CrossRef]
- Gay, L.J.; Felding-Habermann, B. Contribution of platelets to tumour metastasis. Nat. Rev. Cancer 2011, 11, 123–134. [Google Scholar] [CrossRef]
- Nieswandt, B.; Hafner, M.; Echtenacher, B.; Mannel, D.N. Lysis of tumor cells by natural killer cells in mice is impeded by platelets. Cancer Res. 1999, 59, 1295–1300. [Google Scholar]
- Palumbo, J.S.; Talmage, K.E.; Massari, J.V.; La Jeunesse, C.M.; Flick, M.J.; Kombrinck, K.W.; Jirouskova, M.; Degen, J.L. Platelets and fibrin(ogen) increase metastatic potential by impeding natural killer cell-mediated elimination of tumor cells. Blood 2005, 105, 178–185. [Google Scholar] [CrossRef] [Green Version]
- Assoian, R.K.; Sporn, M.B. Type beta transforming growth factor in human platelets: Release during platelet degranulation and action on vascular smooth muscle cells. J. Cell Biol. 1986, 102, 1217–1223. [Google Scholar] [CrossRef] [Green Version]
- Kaplan, K.L.; Broekman, M.J.; Chernoff, A.; Lesznik, G.R.; Drillings, M. Platelet alpha-granule proteins: Studies on release and subcellular localization. Blood 1979, 53, 604–618. [Google Scholar] [CrossRef] [Green Version]
- Verheul, H.M.; Hoekman, K.; Lupu, F.; Broxterman, H.J.; van der Valk, P.; Kakkar, A.K.; Pinedo, H.M. Platelet and coagulation activation with vascular endothelial growth factor generation in soft tissue sarcomas. Clin. Cancer Res. 2000, 6, 166–171. [Google Scholar]
- Banks, R.E.; Forbes, M.A.; Kinsey, S.E.; Stanley, A.; Ingham, E.; Walters, C.; Selby, P.J. Release of the angiogenic cytokine vascular endothelial growth factor (VEGF) from platelets: Significance for VEGF measurements and cancer biology. Br. J. Cancer 1998, 77, 956–964. [Google Scholar] [CrossRef] [Green Version]
- Gupta, G.P.; Massague, J. Platelets and metastasis revisited: A novel fatty link. J. Clin. Investig. 2004, 114, 1691–1693. [Google Scholar] [CrossRef] [Green Version]
- Tsuruo, T.; Fujita, N. Platelet aggregation in the formation of tumor metastasis. Proc. Jpn. Acad. Ser. B Phys. Biol. Sci. 2008, 84, 189–198. [Google Scholar] [CrossRef]
- Stone, R.L.; Nick, A.M.; McNeish, I.A.; Balkwill, F.; Han, H.D.; Bottsford-Miller, J.; Rupairmoole, R.; Armaiz-Pena, G.N.; Pecot, C.V.; Coward, J.; et al. Paraneoplastic thrombocytosis in ovarian cancer. N. Engl. J. Med. 2012, 366, 610–618. [Google Scholar] [CrossRef] [Green Version]
- Wang, C.; Li, P.; Xuan, J.; Zhu, C.; Liu, J.; Shan, L.; Du, Q.; Ren, Y.; Ye, J. Cholesterol enhances colorectal cancer progression via ROS elevation and MAPK signaling pathway activation. Cell. Physiol. Biochem. 2017, 42, 729–742. [Google Scholar] [CrossRef]
- Yassin, M.; Sadowska, Z.; Djurhuus, D.; Nielsen, B.; Tougaard, P.; Olsen, J.; Pedersen, A.E. Upregulation of PD-1 follows tumour development in the AOM/DSS model of inflammation-induced colorectal cancer in mice. Immunology 2019, 158, 35–46. [Google Scholar] [CrossRef] [Green Version]
- Saleiro, D.; Murillo, G.; Benya, R.V.; Bissonnette, M.; Hart, J.; Mehta, R.G. Estrogen receptor-beta protects against colitis-associated neoplasia in mice. Int. J. Cancer 2012, 131, 2553–2561. [Google Scholar] [CrossRef] [Green Version]
- Ray, A.L.; Berggren, K.L.; Restrepo Cruz, S.; Gan, G.N.; Beswick, E.J. Inhibition of MK2 suppresses IL-1beta, IL-6, and TNF-alpha-dependent colorectal cancer growth. Int. J. Cancer 2018, 142, 1702–1711. [Google Scholar] [CrossRef] [Green Version]
- Kaushansky, K. Thrombopoietin and the hematopoietic stem cell. Ann. N. Y. Acad. Sci. 2005, 1044, 139–141. [Google Scholar] [CrossRef]
- Deutsch, V.R.; Tomer, A. Megakaryocyte development and platelet production. Br. J. Haematol. 2006, 134, 453–466. [Google Scholar] [CrossRef]
- Fielder, P.J.; Gurney, A.L.; Stefanich, E.; Marian, M.; Moore, M.W.; Carver-Moore, K.; de Sauvage, F.J. Regulation of thrombopoietin levels by c-mpl-mediated binding to platelets. Blood 1996, 87, 2154–2161. [Google Scholar] [CrossRef] [Green Version]
- Kaser, A.; Brandacher, G.; Steurer, W.; Kaser, S.; Offner, F.A.; Zoller, H.; Theurl, I.; Widder, W.; Molnar, C.; Ludwiczek, O.; et al. Interleukin-6 stimulates thrombopoiesis through thrombopoietin: Role in inflammatory thrombocytosis. Blood 2001, 98, 2720–2725. [Google Scholar] [CrossRef] [Green Version]
- De Vita, F.; Romano, C.; Orditura, M.; Galizia, G.; Martinelli, E.; Lieto, E.; Catalano, G. Interleukin-6 serum level correlates with survival in advanced gastrointestinal cancer patients but is not an independent prognostic indicator. J. Interferon Cytokine Res. 2001, 21, 45–52. [Google Scholar] [CrossRef]
- Buergy, D.; Wenz, F.; Groden, C.; Brockmann, M.A. Tumor-platelet interaction in solid tumors. Int. J. Cancer 2012, 130, 2747–2760. [Google Scholar] [CrossRef]
- Knupfer, H.; Preiss, R. Serum interleukin-6 levels in colorectal cancer patients—A summary of published results. Int. J. Colorectal Dis. 2010, 25, 135–140. [Google Scholar] [CrossRef]
- Becker, C.; Fantini, M.C.; Schramm, C.; Lehr, H.A.; Wirtz, S.; Nikolaev, A.; Burg, J.; Strand, S.; Kiesslich, R.; Huber, S.; et al. TGF-beta suppresses tumor progression in colon cancer by inhibition of IL-6 trans-signaling. Immunity 2004, 21, 491–501. [Google Scholar] [CrossRef] [Green Version]
- Grivennikov, S.; Karin, E.; Terzic, J.; Mucida, D.; Yu, G.Y.; Vallabhapurapu, S.; Scheller, J.; Rose-John, S.; Cheroutre, H.; Eckmann, L.; et al. IL-6 and Stat3 are required for survival of intestinal epithelial cells and development of colitis-associated cancer. Cancer Cell 2009, 15, 103–113. [Google Scholar] [CrossRef] [Green Version]
- Bollrath, J.; Phesse, T.J.; von Burstin, V.A.; Putoczki, T.; Bennecke, M.; Bateman, T.; Nebelsiek, T.; Lundgren-May, T.; Canli, O.; Schwitalla, S.; et al. gp130-mediated Stat3 activation in enterocytes regulates cell survival and cell-cycle progression during colitis-associated tumorigenesis. Cancer Cell 2009, 15, 91–102. [Google Scholar] [CrossRef] [Green Version]
- Waldner, M.J.; Wirtz, S.; Jefremow, A.; Warntjen, M.; Neufert, C.; Atreya, R.; Becker, C.; Weigmann, B.; Vieth, M.; Rose-John, S.; et al. VEGF receptor signaling links inflammation and tumorigenesis in colitis-associated cancer. J. Exp. Med. 2010, 207, 2855–2868. [Google Scholar] [CrossRef]
- Matsumoto, S.; Hara, T.; Mitsuyama, K.; Yamamoto, M.; Tsuruta, O.; Sata, M.; Scheller, J.; Rose-John, S.; Kado, S.; Takada, T. Essential roles of IL-6 trans-signaling in colonic epithelial cells, induced by the IL-6/soluble-IL-6 receptor derived from lamina propria macrophages, on the development of colitis-associated premalignant cancer in a murine model. J. Immunol. 2010, 184, 1543–1551. [Google Scholar] [CrossRef] [Green Version]
- Kuhn, K.A.; Manieri, N.A.; Liu, T.C.; Stappenbeck, T.S. IL-6 stimulates intestinal epithelial proliferation and repair after injury. PLoS ONE 2014, 9, e114195. [Google Scholar] [CrossRef] [Green Version]
- Dann, S.M.; Spehlmann, M.E.; Hammond, D.C.; Iimura, M.; Hase, K.; Choi, L.J.; Hanson, E.; Eckmann, L. IL-6-dependent mucosal protection prevents establishment of a microbial niche for attaching/effacing lesion-forming enteric bacterial pathogens. J. Immunol. 2008, 180, 6816–6826. [Google Scholar] [CrossRef]
- Ferris, R.L.; Blumenschein, G., Jr.; Fayette, J.; Guigay, J.; Colevas, A.D.; Licitra, L.; Harrington, K.; Kasper, S.; Vokes, E.E.; Even, C.; et al. Nivolumab for Recurrent Squamous-Cell Carcinoma of the Head and Neck. N. Engl. J. Med. 2016, 375, 1856–1867. [Google Scholar] [CrossRef]
- Becker, C.; Fantini, M.C.; Wirtz, S.; Nikolaev, A.; Kiesslich, R.; Lehr, H.A.; Galle, P.R.; Neurath, M.F. In vivo imaging of colitis and colon cancer development in mice using high resolution chromoendoscopy. Gut 2005, 54, 950–954. [Google Scholar] [CrossRef] [Green Version]
- Neufert, C.; Becker, C.; Neurath, M.F. An inducible mouse model of colon carcinogenesis for the analysis of sporadic and inflammation-driven tumor progression. Nat. Protoc. 2007, 2, 1998–2004. [Google Scholar] [CrossRef]
Animal | Averaged Intestinal Standardized Uptake Value of Intestines (g/mL) | Radioactivity Content in Intestines vs. Whole-Body Radioactivity |
---|---|---|
Mouse 1 WT CRC | 0.43 | 20.1% |
Mouse 2 IL-6 KO CRC | 0.15 | 5.3% |
Mouse 3 IL-6 KO CRC | 0.27 | 6.8% |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Josa, V.; Ferenczi, S.; Szalai, R.; Fuder, E.; Kuti, D.; Horvath, K.; Hegedus, N.; Kovacs, T.; Bagamery, G.; Juhasz, B.; et al. Thrombocytosis and Effects of IL-6 Knock-Out in a Colitis-Associated Cancer Model. Int. J. Mol. Sci. 2020, 21, 6218. https://doi.org/10.3390/ijms21176218
Josa V, Ferenczi S, Szalai R, Fuder E, Kuti D, Horvath K, Hegedus N, Kovacs T, Bagamery G, Juhasz B, et al. Thrombocytosis and Effects of IL-6 Knock-Out in a Colitis-Associated Cancer Model. International Journal of Molecular Sciences. 2020; 21(17):6218. https://doi.org/10.3390/ijms21176218
Chicago/Turabian StyleJosa, Valeria, Szilamer Ferenczi, Rita Szalai, Eniko Fuder, Daniel Kuti, Krisztina Horvath, Nikolett Hegedus, Tibor Kovacs, Gergo Bagamery, Balazs Juhasz, and et al. 2020. "Thrombocytosis and Effects of IL-6 Knock-Out in a Colitis-Associated Cancer Model" International Journal of Molecular Sciences 21, no. 17: 6218. https://doi.org/10.3390/ijms21176218