Role of Poly [ADP-ribose] Polymerase 1 in Activating the Kirsten ras (KRAS) Gene in Response to Oxidative Stress
Abstract
:1. Introduction
2. Results and Discussion
2.1. G4 Formation in the KRAS Promoter and Guanine Oxidation
2.2. Under Oxidative Stress, PARP-1 Is Recruited to the KRAS Promoter where It Binds to G4 32R and G4 mid1 and G4 mid2
2.3. G4 32R Forms A Multi-Protein Complex with PARP-1, MAZ and hnRNP A1
2.4. PARP-1 Undergoes Autoparylation upon Binding to the KRAS G4
2.5. The Transcription Pre-Initiation Complex Formed at G4 32R Contains Parylated PARP-1
2.6. PARP-1 and G4 Are Essential for KRAS Expression
3. Materials and Methods
3.1. Oligonucleotides
3.2. Cell Culture
3.3. Chromatin Immunoprecipitation and Quantitative PCR
- G4-plus 5′-GTACGCCCGTCTGAAGAAGA-3′ (nucleotides (nt) 4889–4908, 0.2 μM),
- G4-minus 5′-GAGCACACCGATGAGTTCGG-3′ (nt 4958–4977, 0.1 μM),
- Ctr1-plus 5′-ACAAAAAGGTGCTGGGTGAGA-3′ (nt 12–32, 0.2 μM),
- Ctr1-minus 5′-TCCCCTTCCCGGAGACTTAAT-3′ (nt 248–268, 0.2 μM),
- Ctr2-plus 5′-CTCCGACTCTCAGGCTCAAG-3′ (nt 7536–7555, 0.15 μM),
- Ctr2-minus 5′-CAGCACTTTGGGAGGCTTAG-3′ (nt 7692–7711, 0.15 μM).
3.4. Mobility Shift Assays
3.5. Nuclear Extract and Biotin-Streptavidin Pull Down Assay
3.6. Western Blots
3.7. PAR Immunoprecipitation Assay
3.8. PARP-1 AutoPARylation and Inhibition Assays
3.9. Inhibition of KRAS by G4 Decoys, siRNA and Veliparib
3.10. Panc-1 Nuclear Extract
3.11. UV-Melting and CD
3.12. Fluorescence Experiments
3.13. Biotinylated-Anthrathiophenedione Pull-Down Assay
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
Abbreviations
KRAS | Kirsten ras gene |
MAZ | MYC associated zinc finger protein |
hnRNP A1 | Heterogeneous nuclear ribonucleoprotein A1 |
PARP-1 | Poly[ADP-ribose] polymerase 1 |
PDAC | Pancreatic ductal adenocarcinoma |
8OG | 8-Oxoguanine |
TSS | Transcription start site |
ChIP | Chromatin immunoprecipitation |
PARylation | Poly(ADP-ribosyl)ation |
References
- Vincent, A.; Herman, J.; Schulick, R.; Hruban, R.H.; Goggins, M. Pancreatic cancer. Lancet 2011, 378, 607–620. [Google Scholar] [CrossRef]
- Collins, M.A.; Bednar, F.; Zhang, Y.; Brisset, J.C.; Galbán, S.; Galbán, C.J.; Rakshit, S.; Flannagan, K.S.; Adsay, N.V.; Pasca Di Magliano, M. Oncogenic Kras is required for both the initiation and maintenance of pancreatic cancer in mice. J. Clin. Investig. 2012, 122, 639–653. [Google Scholar] [CrossRef] [Green Version]
- Ying, H.; Kimmelman, A.C.; Lyssiotis, C.A.; Hua, S.; Chu, G.C.; Fletcher-Sananikone, E.; Locasale, J.W.; Son, J.; Zhang, H.; Coloff, J.L.; et al. Oncogenic kras maintains pancreatic tumors through regulation of anabolic glucose metabolism. Cell 2012, 149, 656–670. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Diehl, F.F.; Lewis, C.A.; Fiske, B.P.; Vander Heiden, M.G. Cellular redox state constrains serine synthesis and nucleotide production to impact cell proliferation. Nat. Metab. 2019, 1, 861–867. [Google Scholar] [CrossRef] [PubMed]
- Son, J.; Lyssiotis, C.A.; Ying, H.; Wang, X.; Hua, S.; Ligorio, M.; Perera, R.M.; Ferrone, C.R.; Mullarky, E.; Shyh-Chang, N.; et al. Glutamine supports pancreatic cancer growth through a KRAS-regulated metabolic pathway. Nature 2013, 496, 101–105. [Google Scholar] [CrossRef] [PubMed]
- Weinstein, I.B.; Joe, A.K. Mechanisms of Disease: Oncogene addiction—A rationale for molecular targeting in cancer therapy. Nat. Clin. Pract. Oncol. 2006, 3, 448–457. [Google Scholar] [CrossRef] [PubMed]
- Pagliarini, R.; Shao, W.; Sellers, W.R. Oncogene addiction: Pathways of therapeutic response, resistance, and road maps toward a cure. EMBO Rep. 2015, 16, 280–296. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McCormick, F. KRAS as a therapeutic target. Clin. Cancer Res. 2015, 21, 1797–1801. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cogoi, S.; Xodo, L.E. G4 DNA in ras genes and its potential in cancer therapy. Biochim. Biophys. Acta 2016, 1859, 663–674. [Google Scholar] [CrossRef]
- Cogoi, S.; Xodo, L.E. G-quadruplex formation within the promoter of the KRAS proto-oncogene and its effect on transcription. Nucleic Acids Res. 2006, 34, 2536–2549. [Google Scholar] [CrossRef]
- Cogoi, S.; Paramasivam, M.; Spolaore, B.; Xodo, L.E. Structural polymorphism within a regulatory element of the human KRAS promoter: Formation of G4-DNA recognized by nuclear proteins. Nucleic Acids Res. 2008, 36, 3765–3780. [Google Scholar] [CrossRef] [Green Version]
- Hänsel-Hertsch, R.; Beraldi, D.; Lensing, S.V.; Marsico, G.; Zyner, K.; Parry, A.; Di Antonio, M.; Pike, J.; Kimura, H.; Narita, M.; et al. G-quadruplex structures mark human regulatory chromatin. Nat. Genet. 2016, 48, 1267–1272. [Google Scholar] [CrossRef] [Green Version]
- Rhodes, D.; Lipps, H.J. Survey and summary G-quadruplexes and their regulatory roles in biology. Nucleic Acids Res. 2015, 43, 8627–8637. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Spiegel, J.; Adhikari, S.; Balasubramanian, S. The Structure and Function of DNA G-Quadruplexes. Trends Chem. 2020, 2, 123–136. [Google Scholar] [CrossRef] [Green Version]
- D’Amours, D.; Desnoyers, S.; D’Silva, I.; Poirier, G.G. Poly(ADP-ribosyl)ation reactions in the regulation of nuclear functions. Biochem. J. 1999, 342, 249–268. [Google Scholar] [CrossRef] [Green Version]
- Ji, Y.; Tulin, A.V. The roles of PARP1 in gene control and cell differentiation. Curr. Opin. Genet. Dev. 2010, 20, 512–518. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kraus, W.L. Transcriptional control by PARP-1: Chromatin modulation, enhancer-binding, coregulation, and insulation. Curr. Opin. Cell Biol. 2008, 20, 294–302. [Google Scholar] [CrossRef] [Green Version]
- Krishnakumar, R.; Kraus, W.L. The PARP side of the nucleus: Molecular actions, physiological outcomes, and clinical targets. Mol. Cell 2010, 39, 8–24. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kraus, W.L.; Hottiger, M.O. PARP-1 and gene regulation: Progress and puzzles. Mol. Asp. Med. 2013, 34, 1109–1123. [Google Scholar] [CrossRef]
- Schreiber, V.; Dantzer, F.; Amé, J.C.; De Murcia, G. Poly(ADP-ribose): Novel functions for an old molecule. Nat. Rev. Mol. Cell Biol. 2006, 7, 517–528. [Google Scholar] [CrossRef]
- Alemasova, E.E.; Lavrik, O.I. Poly(ADP-ribosyl)ation by PARP1: Reaction mechanism and regulatory proteins. Nucleic Acids Res. 2019, 47, 3811–3827. [Google Scholar] [CrossRef] [Green Version]
- Paramasivam, M.; Membrino, A.; Cogoi, S.; Fukuda, H.; Nakagama, H.; Xodo, L.E. Protein hnRNP A1 and its derivative Up1 unfold quadruplex DNA in the human KRAS promoter: Implications for transcription. Nucleic Acids Res. 2009, 37, 2841–2853. [Google Scholar] [CrossRef] [Green Version]
- Cogoi, S.; Zorzet, S.; Rapozzi, V.; Géci, I.; Pedersen, E.B.; Xodo, L.E. MAZ-binding G4-decoy with locked nucleic acid and twisted intercalating nucleic acid modifications suppresses KRAS in pancreatic cancer cells and delays tumor growth in mice. Nucleic Acids Res. 2013, 41, 4049–4064. [Google Scholar] [CrossRef]
- Chu, P.C.; Yang, M.C.; Kulp, S.K.; Salunke, S.B.; Himmel, L.E.; Fang, C.S.; Jadhav, A.M.; Shan, Y.S.; Lee, C.T.; Lai, M.D.; et al. Regulation of oncogenic KRAS signaling via a novel KRAS-integrin-linked kinase-hnRNP A1 regulatory loop in human pancreatic cancer cells. Oncogene 2016, 35, 3897–3908. [Google Scholar] [CrossRef]
- Zhu, X.; Luo, W.; Liang, W.; Tang, F.; Bei, C.; Ren, Y.; Qin, L.; Tan, C.; Zhang, Y.; Tan, S. Overexpression and clinical significance of MYC-associated zinc finger protein in pancreatic carcinoma. Onco Targets Ther. 2016, 9, 7493–7501. [Google Scholar] [CrossRef] [Green Version]
- Cogoi, S.; Shchekotikhin, A.E.; Xodo, L.E. HRAS is silenced by two neighboring G-quadruplexes and activated by MAZ, a zinc-finger transcription factor with DNA unfolding property. Nucleic Acids Res. 2014, 42, 8379–8388. [Google Scholar] [CrossRef] [Green Version]
- Cogoi, S.; Rapozzi, V.; Cauci, S.; Xodo, L.E. Critical role of hnRNP A1 in activating KRAS transcription in pancreatic cancer cells: A molecular mechanism involving G4 DNA. Biochim. Biophys. Acta Gen. Subj. 2017, 1861, 1389–1398. [Google Scholar] [CrossRef]
- Morgan, R.K.; Batra, H.; Gaerig, V.C.; Hockings, J.; Brooks, T.A. Identification and characterization of a new G-quadruplex forming region within the kRAS promoter as a transcriptional regulator. Biochim. Biophys. Acta 2016, 1859, 235–245. [Google Scholar] [CrossRef] [Green Version]
- Kaiser, C.E.; Van Ert, N.A.; Agrawal, P.; Chawla, R.; Yang, D.; Hurley, L.H. Insight into the Complexity of the i-Motif and G-Quadruplex DNA Structures Formed in the KRAS Promoter and Subsequent Drug-Induced Gene Repression. J. Am. Chem. Soc. 2017, 139, 8522–8536. [Google Scholar] [CrossRef]
- Marquevielle, J.; Robert, C.; Lagrabette, O.; Wahid, M.; Bourdoncle, A.; Xodo, L.E.; Mergny, J.L.; Salgado, G.F. Structure of two G-quadruplexes in equilibrium in the KRAS promoter. Nucleic Acids Res. 2020, gkaa387. [Google Scholar] [CrossRef]
- Cadet, J.; Douki, T.; Ravanat, J.L. Oxidatively generated damage to the guanine moiety of DNA: Mechanistic aspects and formation in cells. Acc. Chem. Res. 2008, 41, 1075–1083. [Google Scholar] [CrossRef] [PubMed]
- Kanvah, S.; Joseph, J.; Schuster, G.B.; Barnett, R.N.; Cleveland, C.L.; Landman, U.Z.I. Oxidation of DNA: Damage to nucleobases. Acc. Chem. Res. 2010, 43, 280–287. [Google Scholar] [CrossRef]
- Loft, S.; Danielsen, P.H.; Mikkelsen, L.; Risom, L.; Forchhammer, L.; Møller, P. Biomarkers of oxidative damage to DNA and repair. Biochem. Soc. Trans. 2008, 36, 1071–1076. [Google Scholar] [CrossRef]
- Ferino, A.; Rapozzi, V.; Xodo, L.E. The ROS-KRAS-Nrf2 axis in the control of the redox homeostasis and the intersection with survival-apoptosis pathways: Implications for photodynamic therapy. J. Photochem. Photobiol. B 2020, 202, 111672. [Google Scholar] [CrossRef]
- Cogoi, S.; Ferino, A.; Miglietta, G.; Pedersen, E.B.; Xodo, L.E. The regulatory G4 motif of the Kirsten ras (KRAS) gene is sensitive to guanine oxidation: Implications on transcription. Nucleic Acids Res. 2018, 46, 661–676. [Google Scholar] [CrossRef]
- Saito, I.; Takayama, M.; Sugiyama, H.; Nakatani, K.; Tsuchida, A.; Yamamoto, M. Photoinduced DNA Cleavage via Electron Transfer: Demonstration That Guanine Residues Located 5′ to Guanine Are the Most Electron-Donating Sites. J. Am. Chem. Soc. 1995, 117, 6406–6407. [Google Scholar] [CrossRef]
- Miglietta, G.; Cogoi, S.; Marinello, J.; Capranico, G.; Tikhomirov, A.S.; Shchekotikhin, A.; Xodo, L.E. RNA G-Quadruplexes in Kirsten Ras (KRAS) Oncogene as Targets for Small Molecules Inhibiting Translation. J. Med. Chem. 2017, 60, 9448–9461. [Google Scholar] [CrossRef]
- Ding, Y.; Fleming, A.M.; Burrows, C.J. Sequencing the Mouse Genome for the Oxidatively Modified Base 8-Oxo-7,8-dihydroguanine by OG-Seq. J. Am. Chem. Soc. 2017, 139, 2569–2572. [Google Scholar] [CrossRef] [Green Version]
- Clark, D.W.; Phang, T.; Edwards, M.G.; Geraci, M.W.; Gillespie, M.N. Promoter G-quadruplex sequences are targets for base oxidation and strand cleavage during hypoxia-induced transcription. Free Radic. Biol. Med. 2012, 53, 51–59. [Google Scholar] [CrossRef] [Green Version]
- Vorlícková, M.; Tomasko, M.; Sagi, A.J.; Bednarova, K.; Sagi, J. 8-Oxoguanine in a quadruplex of the human telomere DNA sequence. FEBS J. 2012, 279, 29–39. [Google Scholar] [CrossRef]
- Beckett, J.; Burns, J.; Broxson, C.; Tornaletti, S. Spontaneous DNA lesions modulate DNA structural transitions occurring at nuclease hypersensitive element III1 of the human c-myc proto-oncogene. Biochemistry 2012, 51, 5257–5268. [Google Scholar] [CrossRef] [PubMed]
- Thomas, C.J.; Kotova, E.; Andrake, M.; Adolf-Bryfogle, J.; Glaser, R.; Regnard, C.; Tulin, A.V. Kinase-Mediated Changes in Nucleosome Conformation Trigger Chromatin Decondensation via Poly(ADP-Ribosyl)ation. Mol. Cell 2014, 53, 831–842. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kraus, W.L.; Lis, J.T. PARP goes transcription. Cell 2003, 113, 677–683. [Google Scholar] [CrossRef] [Green Version]
- Soldatenkov, V.A.; Vetcher, A.A.; Duka, T.; Ladame, S. First evidence of a functional interaction between DNA quadruplexes and poly(ADP-ribose) polymerase-1. ACS Chem. Biol. 2008, 3, 214–219. [Google Scholar] [CrossRef] [Green Version]
- Eustermann, S.; Wu, W.F.; Langelier, M.F.; Yang, J.C.; Easton, L.E.; Riccio, A.A.; Pascal, J.M.; Neuhaus, D. Structural Basis of Detection and Signaling of DNA Single-Strand Breaks by Human PARP-1. Mol. Cell 2015, 60, 742–754. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Eustermann, S.; Videler, H.; Yang, J.C.; Cole, P.T.; Gruszka, D.; Veprintsev, D.; Neuhaus, D. The DNA-binding domain of human PARP-1 interacts with DNA single-strand breaks as a monomer through its second zinc finger. J. Mol. Biol. 2011, 407, 149–170. [Google Scholar] [CrossRef] [Green Version]
- Dawicki-McKenna, J.M.; Langelier, M.F.; De Nizio, J.E.; Riccio, A.A.; Cao, C.D.; Karch, K.R.; McCauley, M.; Steffen, J.D.; Black, B.E.; Pascal, J.M. PARP-1 Activation Requires Local Unfolding of an Autoinhibitory Domain. Mol. Cell 2015, 60, 755–768. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gupte, R.; Liu, Z.; Kraus, W.L. Parps and adp-ribosylation: Recent advances linking molecular functions to biological outcomes. Genes Dev. 2017, 31, 101–126. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Langelier, M.F.; Eisemann, T.; Riccio, A.A.; Pascal, J.M. PARP family enzymes: Regulation and catalysis of the poly(ADP-ribose) posttranslational modification. Curr. Opin. Struct. Biol. 2018, 53, 187–198. [Google Scholar] [CrossRef]
- Jain, P.G.; Patel, B.D. Medicinal chemistry approaches of poly ADP-Ribose polymerase 1 (PARP1) inhibitors as anticancer agents—A recent update. Eur. J. Med. Chem. 2019, 165, 198–215. [Google Scholar] [CrossRef] [PubMed]
- Fleming, A.M.; Ding, Y.; Burrows, C.J. Oxidative DNA damage is epigenetic by regulating gene transcription via base excision repair. Proc. Natl. Acad. Sci. USA 2017, 114, 2604–2609. [Google Scholar] [CrossRef] [PubMed]
- Ba, X.; Boldogh, I. 8-oxoguanine DNA glycosylase 1: Beyond repair of oxidatively modified base lesion. Redox Biol. 2018, 14, 669–678. [Google Scholar] [CrossRef] [PubMed]
- Giorgio, M.; Dellino, G.I.; Gambino, V.; Roda, N.; Pelicci, P.G. On the epigenetic role of guanosine oxidation. Redox Biol. 2020, 29, 101398. [Google Scholar] [CrossRef] [PubMed]
- Gibson, B.A.; Zhang, Y.; Jiang, H.; Hussey, K.M.; Shrimp, J.M.; Lin, H.; Schwede, F.; Yu, Y.; Kraus, W.L. Chemical genetic discovery of PARP targets reveals a role for PARP-1 in transcription elongation. Science 2016, 353, 45–50. [Google Scholar] [CrossRef] [Green Version]
- Gunderson, C.C.; Moore, K.N. Olaparib: An oral PARP-1 and PARP-2 inhibitor with promising activity in ovarian cancer. Future Oncol. 2015, 11, 747–757. [Google Scholar] [CrossRef]
- Bodepudi, V.; Shibutani, S.; Johnson, F. Synthesis of 2′-Deoxy-7,8-dihydro-8-oxoguanosine and 2′-Deoxy-7,8-dihydro-8-oxoadenosine and Their Incorporation into Oligomeric DNA. Chem. Res. Toxicol. 1992, 5, 608–617. [Google Scholar] [CrossRef]
- Markwell, M.A.K.; Haas, S.M.; Bieber, L.L.; Tolbert, N.E. A modification of the Lowry procedure to simplify protein determination in membrane and lipoprotein samples. Anal. Biochem. 1978, 87, 206–210. [Google Scholar] [CrossRef]
- Fleming, A.M.; Burrows, C.J. Interplay of guanineoxidation and G-quadruplex folding in gene promoters. J. Am. Chem. Soc. 2020, 142, 1115–1136. [Google Scholar] [CrossRef]
- Sajadimajd, S.; Khazaei, M. Oxidative Stress and Cancer: The Role of Nrf2. Curr. Cancer Drug Targets 2018, 18, 538–557. [Google Scholar] [CrossRef]
- Lee, S.B.; Sellers, B.N.; DeNicola, G.M. The Regulation of NRF2 by Nutrient-Responsive Signaling and Its Role in Anabolic Cancer Metabolism. Antioxid. Redox Signal. 2018, 29, 1774–1791. [Google Scholar] [CrossRef]
- Krishnakumar, R.; Kraus, W.L. PARP-1 Regulates Chromatin Structure and Transcription through a KDM5B-Dependent Pathway. Mol. Cell 2010, 39, 736–749. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kumar, P.; Yadav, V.K.; Baral, A.; Kumar, P.; Saha, D.; Chowdhury, S. Zinc-finger transcription factors are associated with guanine quadruplex motifs in human, chimpanzee, mouse and rat promoters genome-wide. Nucleic Acids Res. 2011, 39, 8005–8016. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Oligonucleotide | 5′ → 3′ | 8OG |
---|---|---|
G4 32R | AGGGCGGTGTGGGAAGAGGGAAGAGGGGGAGG | |
92 | AGGGCGGTGTGGGAAGAGGGAAGAGGGGGAGG (1) (3) | 1 |
96 | AGGGCGGTGTGGGAAGAGGGAAGAGGGGGAGG (1) (3) | 2 |
G4 mid | CGGGGAGAAGGAGGGGGCCGGGCCGGGCCGGCGGGGGAGGAGCGGGGGCCGGGC | |
G4 mid1 | CGGGGAGAAGGAGGGGGCCGGGCCGGGC | |
G4 mid2 | CGGGCCGGCGGGGGAGGAGCGGGGGCCGGGC | |
b-32R | b-TTTTAGGGCGGTGTGGGAAGAGGGAAGAGGGGGAGG (2) | |
b-92 | b-TTTTAGGGCGGTGTGGGAAGAGGGAAGAGGGGGAGG (1) (2) (3) | 1 |
b-96 | b-TTTTAGGGCGGTGTGGGAAGAGGGAAGAGGGGGAGG (1) (2) (3) | 2 |
b-mid | b-TTTTCGGGGAGAAGGAGGGGGCCGGGCCGGGCCGGCG--GGGGAGGAGCGGGGGCCGGGC (2) | |
b-mid1 | b-TTTTCGGGGAGAAGGAGGGGGCCGGGCCGGGC (2) | |
b-mid2 | b-TTTTCGGGCCGGCGGGGGAGGAGCGGGGGCCGGG (2) | |
b-midOX | b-TTTTCGGGGAGAAGGAGGGGGCCGGGCCGGGCCGGCG- -GGGGAGGAGCGGGGGCCGGGC (1) (2) | 2 |
b-mid1OX | b-TTTTCGGGGAGAAGGAGGGGGCCGGGCCGGGC (1) (2) | 1 |
b-mid2OX | b-TTTTCGGGCCGGCGGGGGAGGAGCGGGGGCCGGGC (1) (2) | 2 |
Cy5.5-32R | Cy5.5-AGGGCGGTGTGGGAAGAGGGAAGAGGGGGAGG | |
Cy5.5-mid1 | Cy5.5-CGGGGAGAAGGAGGGGGCCGGGCCGGGC | |
Cy5.5-mid2 | Cy5.5-CGGGCCGGCGGGGGAGGAGCGGGGGCCGGGC | |
Cy5.5-mid | Cy5.5-CGGGGAGAAGGAGGGGGCCGGGCCGGGCCGGCGGGGGAGGAGCGGGGGCCGGGC | |
32Y | CCTCCCCCTCTTCCCTCTTCCCACACCGCCCT | |
G4 mid Y | GCCCGGCCCCCGCTCCTCCCCCGCCGGCCCGGCCCGGCCCCCTCCTTCTCCCCG | |
Oligo dT | TTTTTTTTTTTTTTTT | |
ODN1 | Cy5.5-CATCAGAAGGCTAGCAATCA | |
ODN2 | Cy5.5-AATAGTAATTGCTTAGCCTG | |
ODN3 | Cy5.5-CCTAATGCTGCTAAACTCCC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cinque, G.; Ferino, A.; Pedersen, E.B.; Xodo, L.E. Role of Poly [ADP-ribose] Polymerase 1 in Activating the Kirsten ras (KRAS) Gene in Response to Oxidative Stress. Int. J. Mol. Sci. 2020, 21, 6237. https://doi.org/10.3390/ijms21176237
Cinque G, Ferino A, Pedersen EB, Xodo LE. Role of Poly [ADP-ribose] Polymerase 1 in Activating the Kirsten ras (KRAS) Gene in Response to Oxidative Stress. International Journal of Molecular Sciences. 2020; 21(17):6237. https://doi.org/10.3390/ijms21176237
Chicago/Turabian StyleCinque, Giorgio, Annalisa Ferino, Erik B. Pedersen, and Luigi E. Xodo. 2020. "Role of Poly [ADP-ribose] Polymerase 1 in Activating the Kirsten ras (KRAS) Gene in Response to Oxidative Stress" International Journal of Molecular Sciences 21, no. 17: 6237. https://doi.org/10.3390/ijms21176237