Efficiency of Recombinant CRISPR/rCas9-Mediated miRNA Gene Editing in Rice
Abstract
:1. Introduction
2. Results
2.1. Functional Validation of Rice Codon-Optimized rCas9 Using Rice Protoplasts
2.2. Genome Editing Patterns Generated by rCas9
2.3. The Efficiency of CRISPR/rCas9-Mediated Mutagenesis on miRNA Genes
2.4. Patterns and Position of CRISPR/rCas9-Mediated Mutations in T0 Transgenic Rice
2.5. Inheritance of rCas9-Mediated Mutation
2.6. Function of the Drought-Induced OsmiR818b on Drought Responses in Rice Plants
3. Discussion
4. Materials and Methods
4.1. Plasmid Construction
4.2. Transient Expression of CRISPR/rCas9 Using Protoplasts
4.3. Plant Transformation
4.4. Analysis of Mutation Frequency in Transgenic Plants by Sanger Sequencing
4.5. miRNA Detection Using Stem–Loop RT-PCR
4.6. Drought-Stress Treatments and Tolerance Evaluation
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Doudna, J.A.; Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science 2014, 346, 1258096. [Google Scholar] [CrossRef]
- Gaj, T.; Gersbach, C.A.; Barbas, C.F. ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol. 2013, 31, 397–405. [Google Scholar] [CrossRef] [Green Version]
- Mishra, R.; Joshi, R.K.; Zhao, K. Base editing in crops: Current advances, limitations and future implications. Plant Biotechnol. J. 2020, 18, 20–31. [Google Scholar] [CrossRef]
- Zhou, J.; Deng, K.; Cheng, Y.; Zhong, Z.; Tian, L.; Tang, X.; Tang, A.; Zheng, X.; Zhang, T.; Qi, Y.; et al. CRISPR-Cas9 based genome editing reveals new insights into microRNA function and regulation in rice. Front. Plant Sci. 2017, 8, 1598. [Google Scholar] [CrossRef] [Green Version]
- Barrangou, R.; Marraffini, L.A. CRISPR-Cas systems: Prokaryotes upgrade to adaptive immunity. Mol. Cell 2014, 54, 234–244. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jinek, M.; Chylinski, K.; Fonfara, I.; Hauer, M.; Doudna, J.A.; Charpentier, E. A Programmable dual-RNA–guided DNA endonuclease in adaptive bacterial immunity. Science 2012, 337, 816–821. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Wu, J.-J.; Tang, T.; Liu, K.-D.; Dai, C. CRISPR/Cas9-mediated genome editing efficiently creates specific mutations at multiple loci using one sgRNA in Brassica napus. Sci. Rep. 2017, 7, 1–13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bruegmann, T.; Deecke, K.; Fladung, M. Evaluating the efficiency of gRNAs in CRISPR/Cas9 mediated genome editing in poplars. Int. J. Mol. Sci. 2019, 20, 3623. [Google Scholar] [CrossRef] [Green Version]
- Reinhart, B.J.; Weinstein, E.G.; Rhoades, M.W.; Bartel, B.; Bartel, D.P. MicroRNAs in plants. Genes Dev. 2002, 16, 1616–1626. [Google Scholar] [CrossRef] [Green Version]
- Zhang, B.; Pan, X.; Cobb, G.P.; Anderson, T.A. Plant microRNA: A small regulatory molecule with big impact. Dev. Biol. 2006, 289, 3–16. [Google Scholar] [CrossRef]
- Iwakawa, H.-O.; Tomari, Y. Molecular insights into microRNA-mediated translational repression in plants. Mol. Cell 2013, 52, 591–601. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, J.; Mei, J.; Ren, G. Plant microRNAs: Biogenesis, homeostasis, and degradation. Front. Plant Sci. 2019, 10, 360. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, C.; Li, D.; Mao, D.; Liu, X.; Ji, C.; Li, X.; Zhao, X.; Cheng, Z.; Chen, C.; Zhu, L. Overexpression of microRNA319 impacts leaf morphogenesis and leads to enhanced cold tolerance in rice (Oryza sativa L.). Plant Cell Environ. 2013, 36, 2207–2218. [Google Scholar] [CrossRef] [PubMed]
- Djami-Tchatchou, A.T.; Sanan-Mishra, N.; Ntushelo, K.; Dubery, I.A. Functional roles of microRNAs in agronomically important plants—Potential as targets for crop improvement and protection. Front. Plant Sci. 2017, 8, 378. [Google Scholar] [CrossRef] [Green Version]
- Zamore, P.D.; Tuschl, T.; Sharp, P.A.; Bartel, D.P. RNAi: Double-stranded RNA directs the ATP-dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell 2000, 101, 25–33. [Google Scholar] [CrossRef] [Green Version]
- Todesco, M.; Rubio-Somoza, I.; Paz-Ares, J.; Weigel, D. A collection of target mimics for comprehensive analysis of microRNA function in Arabidopsis thaliana. PLoS Genet. 2010, 6, e1001031. [Google Scholar] [CrossRef] [Green Version]
- Yan, J.; Gu, Y.; Jia, X.; Kang, W.; Pan, S.; Tang, X.; Chen, X.; Tang, G. Effective small RNA destruction by the expression of a short tandem target mimic in Arabidopsis. Plant Cell 2012, 24, 415–427. [Google Scholar] [CrossRef] [Green Version]
- Reichel, M.; Li, Y.; Li, J.; Millar, A.A. Inhibiting plant microRNA activity: Molecular SPONGEs, target MIMICs and STTMs all display variable efficacies against target microRNAs. Plant Biotechnol. J. 2015, 13, 915–926. [Google Scholar] [CrossRef] [Green Version]
- Bi, H.; Fei, Q.; Li, R.; Liu, B.; Xia, R.; Char, S.N.; Meyers, B.C.; Yang, B. Disruption of miRNA sequences by TALENs and CRISPR/Cas9 induces varied lengths of miRNA production. Plant Biotechnol. J. 2020, 18, 1526–1536. [Google Scholar] [CrossRef] [Green Version]
- Chung, P.J.; Jung, H.; Jeong, D.-H.; Ha, S.-H.; Choi, Y.D.; Kim, J.-K. Transcriptome profiling of drought responsive noncoding RNAs and their target genes in rice. BMC Genom. 2016, 17, 563. [Google Scholar] [CrossRef] [Green Version]
- Zhang, B.; Yang, X.; Yang, C.; Li, M.; Guo, Y. Exploiting the CRISPR/Cas9 system for targeted genome mutagenesis in petunia. Sci. Rep. 2016, 6, 20315. [Google Scholar] [CrossRef] [PubMed]
- Ma, X.; Zhang, Q.; Zhu, Q.; Liu, W.; Chen, Y.; Qiu, R.; Wang, B.; Yang, Z.; Li, H.; Lin, Y.; et al. A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol. Plant 2015, 8, 1274–1284. [Google Scholar] [CrossRef] [PubMed]
- Mikami, M.; Toki, S.; Endo, M. Comparison of CRISPR/Cas9 expression constructs for efficient targeted mutagenesis in rice. Plant Mol. Biol. 2015, 88, 561–572. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Johnson, R.A.; Gurevich, V.; Levy, A.A. A rapid assay to quantify the cleavage efficiency of custom-designed nucleases in planta. Plant Mol. Biol. 2013, 82, 207–221. [Google Scholar] [CrossRef]
- Zhang, H.; Zhang, J.; Wei, P.; Zhang, B.; Gou, F.; Feng, Z.; Mao, Y.; Yang, L.; Zhang, H.; Xu, N.; et al. The CRISPR/Cas9 system produces specific and homozygous targeted gene editing in rice in one generation. Plant Biotechnol. J. 2014, 12, 797–807. [Google Scholar] [CrossRef]
- Ren, F.; Ren, C.; Zhang, Z.; Duan, W.; Lecourieux, D.; Li, S.; Liang, Z. Efficiency optimization of CRISPR/Cas9-mediated targeted mutagenesis in grape. Front. Plant Sci. 2019, 10, 612. [Google Scholar] [CrossRef] [Green Version]
- Wang, T.; Wei, J.J.; Sabatini, D.M.; Lander, E.S. Genetic screens in human cells using the CRISPR-Cas9 system. Science 2014, 343, 80–84. [Google Scholar] [CrossRef] [Green Version]
- Shan, Q.; Wang, Y.; Chen, K.; Liang, Z.; Li, J.; Zhang, Y.; Zhang, K.; Liu, J.; Voytas, D.F.; Zheng, X.; et al. Rapid and efficient gene modification in rice and Brachypodium using TALENs. Mol. Plant 2013, 6, 1365–1368. [Google Scholar] [CrossRef] [Green Version]
- Basso, M.F.; Ferreira, P.C.G.; Kobayashi, A.K.; Harmon, F.G.; Nepomuceno, A.L.; Molinari, H.B.C.; Grossi-de-Sa, M.F. MicroRNAs and new biotechnological tools for its modulation and improving stress tolerance in plants. Plant Biotechol. J. 2019, 17, 1482–1500. [Google Scholar] [CrossRef] [Green Version]
- Ebert, M.S.; Neilson, J.R.; Sharp, P.A. MicroRNA sponges: Competitive inhibitors of small RNAs in mammalian cells. Nat. Methods 2007, 4, 721–726. [Google Scholar] [CrossRef]
- Chang, H.; Yi, B.; Ma, R.; Zhang, X.; Zhao, H.; Xi, Y. CRISPR/cas9, a novel genomic tool to knock down microRNA in vitro and in vivo. Sci. Rep. 2016, 6, 22312. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, Y.; Dai, Z.; Liang, Y.; Yin, M.; Ma, K.; He, M.; Ouyang, H.; Teng, C.-B. Sequence-specific inhibition of microRNA via CRISPR/CRISPRi system. Sci. Rep. 2014, 4, 3943. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kurata, J.S.; Lin, R.-J. MicroRNA-focused CRISPR-Cas9 library screen reveals fitness-associated miRNAs. RNA 2018, 24, 966–981. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Aquino-Jarquin, G. Emerging Role of CRISPR/Cas9 Technology for MicroRNAs Editing in Cancer Research. Cancer Res. 2017, 77, 6812–6817. [Google Scholar] [CrossRef] [Green Version]
- Komari, T.; Hiei, Y.; Saito, Y.; Murai, N.; Kumashiro, T. Vectors carrying two separate T-DNAs for co-transformation of higher plants mediated by Agrobacterium tumefaciens and segregation of transformants free from selection markers. Plant J. 1996, 10, 165–174. [Google Scholar] [CrossRef] [PubMed]
- Jeong, J.S.; Kim, Y.S.; Baek, K.H.; Jung, H.; Ha, S.H.; Do Choi, Y.; Kim, M.; Reuzeau, C.; Kim, J.K. Root-specific expression of OsNAC10 improves drought tolerance and grain yield in rice under field drought conditions. Plant Physiol. 2010, 153, 185–197. [Google Scholar] [CrossRef] [Green Version]
- Shim, J.S.; Oh, N.; Chung, P.J.; Kim, Y.S.; Choi, Y.D.; Kim, J.K. Overexpression of OsNAC14 Improves Drought Tolerance in Rice. Front. Plant Sci. 2018, 9, 310. [Google Scholar] [CrossRef]
- Jang, I.-C.; Nahm, B.H.; Kim, J.-K. Subcellular targeting of green fluorescent protein to plastids in transgenic rice plants provides a high-level expression system. Mol. Breed 1999, 5, 453–461. [Google Scholar] [CrossRef]
- Chung, P.J.; Park, B.S.; Wang, H.; Liu, J.; Jang, I.-C.; Chua, N.-H. Light-inducible MiR163 targets PXMT1 transcripts to promote seed germination and primary root elongation in Arabidopsis. Plant Physiol. 2016, 170, 1772–1782. [Google Scholar] [CrossRef] [Green Version]
- Varkonyi-Gasic, E.; Wu, R.; Wood, M.; Walton, E.F.; Hellens, R.P. Protocol: A highly sensitive RT-PCR method for detection and quantification of microRNAs. Plant Methods 2007, 3, 12. [Google Scholar] [CrossRef] [Green Version]
- Chen, C.; Ridzon, D.A.; Broomer, A.J.; Zhou, Z.; Lee, D.H.; Nguyen, J.T.; Barbisin, M.; Xu, N.L.; Mahuvakar, V.R.; Andersen, M.R.; et al. Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 2005, 33, e179. [Google Scholar] [CrossRef] [PubMed]
Target Gene | gRNA | GC(%) | Tm | WT | Mono-Allelic | Biallelic | Total Plants | Mutation Rate (%) | |
---|---|---|---|---|---|---|---|---|---|
Homo | Hetero | ||||||||
miR399d | TCACCAAAACGGCCTGCCAAAGG | 55 | 73.0 | 40 | 6 | 46 | 13.0% | ||
miR418 | AATTCCACCGTGGTCCCTGGAGG | 60 | 70.5 | 26 | 6 | 10 | 42 | 38.1% | |
miR156d | AGAGTGAGCACACGGCGTGATGG | 60 | 70.1 | 3 | 8 | 37 | 48 | 93.8% | |
miR399e | TGCCCAGCAATGCAACTTTGCGG | 50 | 69.6 | 14 | 14 | 1 | 3 | 32 | 56.3% |
miR399i | TGCTAGCCTTTCCCTGCCAAAGG | 55 | 69.2 | 3 | 6 | 8 | 4 | 21 | 85.7% |
miR169f | AAGAGCTGATTCGGTAGCCAAGG | 50 | 64.2 | 7 | 3 | 10 | 29 | 49 | 85.7% |
miR171f | TTGGCATGGTTCAATCAAACCGG | 40 | 63.7 | 21 | 1 | 3 | 24 | 49 | 57.1% |
OsNAC14 | AAGAGCTCTGGTGCAAGAAGGGG | 50 | 61.8 | 3 | 4 | 5 | 36 | 48 | 93.8% |
miR156g | GAAGAGAGTGAGCACACAGCGGG | 55 | 61.0 | 1 | 2 | 3 | 12 | 18 | 94.4% |
miR399k | GGTTACCAGACTACTGCCAAAGG | 50 | 59.7 | 3 | 7 | 20 | 30 | 100.0% | |
miR818b | ATCCAAAATCCCTTATATTATGG | 25 | 52.5 | 17 | 2 | 19 | 10.5% | ||
miR814a | ACTTCATAGTACAACGAATCTGG | 35 | 51.3 | 19 | 3 | 1 | 23 | 17.4% | |
miR816 | ATATTTTACTACAACGAATCTGG | 25 | 48.2 | 32 | 1 | 33 | 3.0% | ||
Total | 186 | 39 | 51 | 182 | 458 | ||||
40.6% | 8.5% | 11.1% | 39.7% |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chung, P.J.; Chung, H.; Oh, N.; Choi, J.; Bang, S.W.; Jung, S.E.; Jung, H.; Shim, J.S.; Kim, J.-K. Efficiency of Recombinant CRISPR/rCas9-Mediated miRNA Gene Editing in Rice. Int. J. Mol. Sci. 2020, 21, 9606. https://doi.org/10.3390/ijms21249606
Chung PJ, Chung H, Oh N, Choi J, Bang SW, Jung SE, Jung H, Shim JS, Kim J-K. Efficiency of Recombinant CRISPR/rCas9-Mediated miRNA Gene Editing in Rice. International Journal of Molecular Sciences. 2020; 21(24):9606. https://doi.org/10.3390/ijms21249606
Chicago/Turabian StyleChung, Pil Joong, Hoyong Chung, Nuri Oh, Joohee Choi, Seung Woon Bang, Se Eun Jung, Harin Jung, Jae Sung Shim, and Ju-Kon Kim. 2020. "Efficiency of Recombinant CRISPR/rCas9-Mediated miRNA Gene Editing in Rice" International Journal of Molecular Sciences 21, no. 24: 9606. https://doi.org/10.3390/ijms21249606