A Newly Created Meso-, Micro-, and Nano-Scale Rough Titanium Surface Promotes Bone-Implant Integration
Abstract
:1. Introduction
2. Results
2.1. Morphology of Titanium Surfaces
2.2. Roughness Characteristics of Titanium Surfaces
2.3. Cell Attachment and Spreading Behavior of Osteoblasts
2.4. Osteoblast Differentiation
2.5. Biomechanical Strength of Bone-Implant Integration
2.6. Topographical Determinants for Osteoconductivity and Osseointegration
3. Discussion
4. Materials and Methods
4.1. Titanium Samples and Surface Analysis
4.2. Osteoblastic Cell Culture
4.3. Cell Attachment Assay
4.4. Cell Morphology and Morphometry
4.5. Vinculin and Actin Expression Analysis
4.6. Alkaline Phosphatase (ALP) Activity
4.7. Mineralization Assay
4.8. Real-Time Quantitativepcr (Real-Time qPCR)
4.9. Implant Surgery
4.10. Biomechanical Implant Push-In Test
4.11. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
ALP | Alkaline phosphatase |
ANOVA | One-way analysis of variance |
cDNA | Complementary DNA |
ELISA | Enzyme-linked immunosorbent assay |
Gapdh | Glyceraldehyde-3-phosphate dehydrogenase |
Ocn | Osteocalcin |
Opn | Osteopontin |
PCR | Polymerase chain reaction |
SEM | Scanning electron microscopy |
WST | Water soluble tetrazolium salts |
References
- Boylan, M.R.; Chadda, A.; Slover, J.D.; Zuckerman, J.D.; Iorio, R.; Bosco, J.A. Preferred Single-Vendor Program for Total Joint Arthroplasty Implants: Surgeon Adoption, Outcomes, and Cost Savings. J. Bone Jt. Surg. Am. 2019, 101, 1381–1387. [Google Scholar] [CrossRef]
- Alexis, I.; Heierle, L.; Hammerle, C.H.F.; Husler, J.; Jung, R.E.; Thoma, D.S. Prospective randomized controlled clinical study comparing two types of two-piece dental implants supporting fixed reconstructions—Results at 5 years of loading. Clin. Oral. Implants Res. 2019. [Google Scholar] [CrossRef]
- Wang, M.; Tang, T. Surface treatment strategies to combat implant-related infection from the beginning. J. Orthop. Translat. 2019, 17, 42–54. [Google Scholar] [CrossRef] [PubMed]
- Kaur, M.; Singh, K. Review on titanium and titanium based alloys as biomaterials for orthopaedic applications. Mater Sci. Eng. C. Mater. Biol. Appl. 2019, 102, 844–862. [Google Scholar] [CrossRef] [PubMed]
- Leno, M.B.; Liu, S.Y.; Chen, C.T.; Liao, H.T. Comparison of functional outcomes and patient-reported satisfaction between titanium and absorbable plates and screws for fixation of mandibular fractures: A one-year prospective study. J. Craniomaxillofac Surg. 2017, 45, 704–709. [Google Scholar] [CrossRef] [PubMed]
- Rengaraja, D.; Jagade, M.; Rao, K.; Sonate, R.; Singhal, A. Reconstruction of Maxilla with Titanium Mesh and Fascia Lata—A Case Report. J. Clin. Diagn. Res. 2017, 11, MD03–MD05. [Google Scholar] [CrossRef] [PubMed]
- Banakis Hartl, R.M.; Mattingly, J.K.; Greene, N.T.; Jenkins, H.A.; Cass, S.P.; Tollin, D.J. A Preliminary Investigation of the Air-Bone Gap: Changes in Intracochlear Sound Pressure With Air- and Bone-conducted Stimuli After Cochlear Implantation. Otol. Neurotol. 2016, 37, 1291–1299. [Google Scholar] [CrossRef] [Green Version]
- Tabuchi, M.; Ikeda, T.; Hirota, M.; Nakagawa, K.; Park, W.; Miyazawa, K.; Goto, S.; Ogawa, T. Effect of UV Photofunctionalization on Biologic and Anchoring Capability of Orthodontic Miniscrews. Int. J. Oral Maxillofac. Implants 2015, 30, 868–879. [Google Scholar] [CrossRef] [Green Version]
- Branemark, P.I.; Hansson, B.O.; Adell, R.; Breine, U.; Lindstrom, J.; Hallen, O.; Ohman, A. Osseointegrated implants in the treatment of the edentulous jaw. Experience from a 10-year period. Scand J. Plast Reconstr. Surg. Suppl. 1977, 16, 1–132. [Google Scholar]
- Albrektsson, T.; Johansson, C. Osteoinduction, osteoconduction and osseointegration. Eur. Spine J. 2001, 10 (Suppl. 2), S96–S101. [Google Scholar] [CrossRef] [Green Version]
- Iwasa, F.; Tsukimura, N.; Sugita, Y.; Kanuru, R.K.; Kubo, K.; Hasnain, H.; Att, W.; Ogawa, T. TiO2 micro-nano-hybrid surface to alleviate biological aging of UV-photofunctionalized titanium. Int. J. Nanomedicine 2011, 6, 1327–1341. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kubo, K.; Tsukimura, N.; Iwasa, F.; Ueno, T.; Saruwatari, L.; Aita, H.; Chiou, W.A.; Ogawa, T. Cellular behavior on TiO2 nanonodular structures in a micro-to-nanoscale hierarchy model. Biomaterials 2009, 30, 5319–5329. [Google Scholar] [CrossRef] [PubMed]
- Marenzi, G.; Spagnuolo, G.; Sammartino, J.C.; Gasparro, R.; Rebaudi, A.; Salerno, M. Micro-Scale Surface Patterning of Titanium Dental Implants by Anodization in the Presence of Modifying Salts. Materials 2019, 12, 1753. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Souza, J.C.M.; Sordi, M.B.; Kanazawa, M.; Ravindran, S.; Henriques, B.; Silva, F.S.; Aparicio, C.; Cooper, L.F. Nano-scale modification of titanium implant surfaces to enhance osseointegration. Acta Biomater. 2019, 94, 112–131. [Google Scholar] [CrossRef]
- Bachle, M.; Kohal, R.J. A systematic review of the influence of different titanium surfaces on proliferation, differentiation and protein synthesis of osteoblast-like MG63 cells. Clin. Oral Implants Res. 2004, 15, 683–692. [Google Scholar] [CrossRef]
- Meng, H.W.; Chien, E.Y.; Chien, H.H. Dental implant bioactive surface modifications and their effects on osseointegration: A review. Biomark Res. 2016, 4, 24. [Google Scholar] [CrossRef] [Green Version]
- Berni, M.; Lopomo, N.; Marchiori, G.; Gambardella, A.; Boi, M.; Bianchi, M.; Visani, A.; Pavan, P.; Russo, A.; Marcacci, M. Tribological characterization of zirconia coatings deposited on Ti6Al4V components for orthopedic applications. Mater. Sci. Eng. C. Mater. Biol. Appl. 2016, 62, 643–655. [Google Scholar] [CrossRef]
- Zizzari, V.L.; Marconi, G.D.; De Colli, M.; Zara, S.; Zavan, B.; Salini, V.; Fontana, A.; Cataldi, A.; Piattelli, A. In Vitro Behavior of Primary Human Osteoblasts Onto Microrough Titanium Surface. Implant Dent. 2015, 24, 377–383. [Google Scholar] [CrossRef] [Green Version]
- Saruta, J.; Sato, N.; Ishijima, M.; Okubo, T.; Hirota, M.; Ogawa, T. Disproportionate Effect of Sub-Micron Topography on Osteoconductive Capability of Titanium. Int. J. Mol. Sci. 2019, 20, 4027. [Google Scholar] [CrossRef] [Green Version]
- Aita, H.; Hori, N.; Takeuchi, M.; Suzuki, T.; Yamada, M.; Anpo, M.; Ogawa, T. The effect of ultraviolet functionalization of titanium on integration with bone. Biomaterials 2009, 30, 1015–1025. [Google Scholar] [CrossRef]
- Mesquita, P.; Gomes Pde, S.; Sampaio, P.; Juodzbalys, G.; Afonso, A.; Fernandes, M.H. Surface properties and osteoblastic cytocompatibility of two blasted and Acid-etched titanium implant systems with distinct microtopography. J. Oral Maxillofac. Res. 2012, 3, e4. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bell, B.F.; Schuler, M.; Tosatti, S.; Textor, M.; Schwartz, Z.; Boyan, B.D. Osteoblast response to titanium surfaces functionalized with extracellular matrix peptide biomimetics. Clin. Oral. Implants Res. 2011, 22, 865–872. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schwartz, Z.; Olivares-Navarrete, R.; Wieland, M.; Cochran, D.L.; Boyan, B.D. Mechanisms regulating increased production of osteoprotegerin by osteoblasts cultured on microstructured titanium surfaces. Biomaterials 2009, 30, 3390–3396. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Deligianni, D.D.; Katsala, N.; Ladas, S.; Sotiropoulou, D.; Amedee, J.; Missirlis, Y.F. Effect of surface roughness of the titanium alloy Ti-6Al-4V on human bone marrow cell response and on protein adsorption. Biomaterials 2001, 22, 1241–1251. [Google Scholar] [CrossRef]
- Guo, J.; Padilla, R.J.; Ambrose, W.; De Kok, I.J.; Cooper, L.F. The effect of hydrofluoric acid treatment of TiO2 grit blasted titanium implants on adherent osteoblast gene expression in vitro and in vivo. Biomaterials 2007, 28, 5418–5425. [Google Scholar] [CrossRef]
- De Oliveira, P.T.; Nanci, A. Nanotexturing of titanium-based surfaces upregulates expression of bone sialoprotein and osteopontin by cultured osteogenic cells. Biomaterials 2004, 25, 403–413. [Google Scholar] [CrossRef]
- Scaglione, S.; Guarino, V.; Sandri, M.; Tampieri, A.; Ambrosio, L.; Quarto, R. In vivo lamellar bone formation in fibre coated MgCHA-PCL-composite scaffolds. J. Mater. Sci. Mater Med. 2012, 23, 117–128. [Google Scholar] [CrossRef]
- Salmasi, S.; Kalaskar, D.M.; Yoon, W.W.; Blunn, G.W.; Seifalian, A.M. Role of nanotopography in the development of tissue engineered 3D organs and tissues using mesenchymal stem cells. World J. Stem Cells 2015, 7, 266–280. [Google Scholar] [CrossRef]
- Lecht, S.; Cohen-Arazi, N.; Cohen, G.; Ettinger, K.; Momic, T.; Kolitz, M.; Naamneh, M.; Katzhendler, J.; Domb, A.J.; Lazarovici, P.; et al. Cytocompatibility of novel extracellular matrix protein analogs of biodegradable polyester polymers derived from alpha-hydroxy amino acids. J. Biomater. Sci. Polym. Ed. 2014, 25, 608–624. [Google Scholar] [CrossRef]
- Svanborg, L.M.; Andersson, M.; Wennerberg, A. Surface characterization of commercial oral implants on the nanometer level. J. Biomed. Mater Res. B Appl. Biomater. 2010, 92, 462–469. [Google Scholar] [CrossRef]
- Meirelles, L.; Arvidsson, A.; Albrektsson, T.; Wennerberg, A. Increased bone formation to unstable nano rough titanium implants. Clin. Oral Implants Res. 2007, 18, 326–332. [Google Scholar] [CrossRef] [PubMed]
- Meirelles, L.; Melin, L.; Peltola, T.; Kjellin, P.; Kangasniemi, I.; Currie, F.; Andersson, M.; Albrektsson, T.; Wennerberg, A. Effect of hydroxyapatite and titania nanostructures on early in vivo bone response. Clin. Implant. Dent. Relat. Res. 2008, 10, 245–254. [Google Scholar] [CrossRef]
- Rajab, F.H.; Liauw, C.M.; Benson, P.S.; Li, L.; Whitehead, K.A. Production of hybrid macro/micro/nano surface structures on Ti6Al4V surfaces by picosecond laser surface texturing and their antifouling characteristics. Colloids Surf. B. Biointerfaces 2017, 160, 688–696. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yin, C.; Zhang, Y.; Cai, Q.; Li, B.; Yang, H.; Wang, H.; Qi, H.; Zhou, Y.; Meng, W. Effects of the micro-nano surface topography of titanium alloy on the biological responses of osteoblast. J. Biomed. Mater Res. A 2017, 105, 757–769. [Google Scholar] [CrossRef] [PubMed]
- Takeuchi, K.; Saruwatari, L.; Nakamura, H.K.; Yang, J.M.; Ogawa, T. Enhanced intrinsic biomechanical properties of osteoblastic mineralized tissue on roughened titanium surface. J. Biomed. Mater. Res. A 2005, 72, 296–305. [Google Scholar] [CrossRef] [PubMed]
- Schwartz, Z.; Lohmann, C.H.; Vocke, A.K.; Sylvia, V.L.; Cochran, D.L.; Dean, D.D.; Boyan, B.D. Osteoblast response to titanium surface roughness and 1alpha,25-(OH)(2)D(3) is mediated through the mitogen-activated protein kinase (MAPK) pathway. J. Biomed. Mater. Res. 2001, 56, 417–426. [Google Scholar] [CrossRef]
- Att, W.; Hori, N.; Takeuchi, M.; Ouyang, J.; Yang, Y.; Anpo, M.; Ogawa, T. Time-dependent degradation of titanium osteoconductivity: An implication of biological aging of implant materials. Biomaterials 2009, 30, 5352–5363. [Google Scholar] [CrossRef]
- Stein, G.S.; Lian, J.B. Molecular mechanisms mediating proliferation/differentiation interrelationships during progressive development of the osteoblast phenotype. Endocr. Rev. 1993, 14, 424–442. [Google Scholar] [CrossRef]
- Siddhanti, S.R.; Quarles, L.D. Molecular to pharmacologic control of osteoblast proliferation and differentiation. J. Cell Biochem. 1994, 55, 310–320. [Google Scholar] [CrossRef]
- Alborzi, A.; Mac, K.; Glackin, C.A.; Murray, S.S.; Zernik, J.H. Endochondral and intramembranous fetal bone development: Osteoblastic cell proliferation, and expression of alkaline phosphatase, m-twist, and histone H4. J. Craniofac. Genet. Dev. Biol. 1996, 16, 94–106. [Google Scholar]
- Owen, T.A.; Aronow, M.; Shalhoub, V.; Barone, L.M.; Wilming, L.; Tassinari, M.S.; Kennedy, M.B.; Pockwinse, S.; Lian, J.B.; Stein, G.S. Progressive development of the rat osteoblast phenotype in vitro: Reciprocal relationships in expression of genes associated with osteoblast proliferation and differentiation during formation of the bone extracellular matrix. J. Cell Physiol. 1990, 143, 420–430. [Google Scholar] [CrossRef]
- Spinella-Jaegle, S.; Roman-Roman, S.; Faucheu, C.; Dunn, F.W.; Kawai, S.; Gallea, S.; Stiot, V.; Blanchet, A.M.; Courtois, B.; Baron, R.; et al. Opposite effects of bone morphogenetic protein-2 and transforming growth factor-beta1 on osteoblast differentiation. Bone 2001, 29, 323–330. [Google Scholar] [CrossRef]
- Alliston, T.; Choy, L.; Ducy, P.; Karsenty, G.; Derynck, R. TGF-beta-induced repression of CBFA1 by Smad3 decreases cbfa1 and osteocalcin expression and inhibits osteoblast differentiation. EMBO J. 2001, 20, 2254–2272. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hori, N.; Iwasa, F.; Ueno, T.; Takeuchi, K.; Tsukimura, N.; Yamada, M.; Hattori, M.; Yamamoto, A.; Ogawa, T. Selective cell affinity of biomimetic micro-nano-hybrid structured TiO2 overcomes the biological dilemma of osteoblasts. Dent. Mater. 2010, 26, 275–287. [Google Scholar] [CrossRef] [PubMed]
- Zhao, G.; Schwartz, Z.; Wieland, M.; Rupp, F.; Geis-Gerstorfer, J.; Cochran, D.L.; Boyan, B.D. High surface energy enhances cell response to titanium substrate microstructure. J. Biomed. Mater. Res. A 2005, 74, 49–58. [Google Scholar] [CrossRef]
- Boyan, B.D.; Bonewald, L.F.; Paschalis, E.P.; Lohmann, C.H.; Rosser, J.; Cochran, D.L.; Dean, D.D.; Schwartz, Z.; Boskey, A.L. Osteoblast-mediated mineral deposition in culture is dependent on surface microtopography. Calcif. Tissue Int. 2002, 71, 519–529. [Google Scholar] [CrossRef]
- Tsukimura, N.; Yamada, M.; Iwasa, F.; Minamikawa, H.; Att, W.; Ueno, T.; Saruwatari, L.; Aita, H.; Chiou, W.A.; Ogawa, T. Synergistic effects of UV photofunctionalization and micro-nano hybrid topography on the biological properties of titanium. Biomaterials 2011, 32, 4358–4368. [Google Scholar] [CrossRef]
- Ogawa, T.; Ozawa, S.; Shih, J.H.; Ryu, K.H.; Sukotjo, C.; Yang, J.M.; Nishimura, I. Biomechanical evaluation of osseous implants having different surface topographies in rats. J. Dent. Res. 2000, 79, 1857–1863. [Google Scholar] [CrossRef]
- Ivanovski, S. Osseointegration--the influence of implant surface. Ann. R. Australas Coll Dent. Surg. 2010, 20, 82–85. [Google Scholar]
- Jaffin, R.A.; Kumar, A.; Berman, C.L. Immediate loading of implants in partially and fully edentulous jaws: A series of 27 case reports. J. Periodontol. 2000, 71, 833–838. [Google Scholar] [CrossRef]
- Grassi, S.; Piattelli, A.; Ferrari, D.S.; Figueiredo, L.C.; Feres, M.; Iezzi, G.; Shibli, J.A. Histologic evaluation of human bone integration on machined and sandblasted acid-etched titanium surfaces in type IV bone. J. Oral Implantol. 2007, 33, 8–12. [Google Scholar] [CrossRef] [PubMed]
- Grassi, S.; Piattelli, A.; de Figueiredo, L.C.; Feres, M.; de Melo, L.; Iezzi, G.; Alba, R.C., Jr.; Shibli, J.A. Histologic evaluation of early human bone response to different implant surfaces. J. Periodontol. 2006, 77, 1736–1743. [Google Scholar] [CrossRef] [PubMed]
- Camarda, A.J.; Milot, P.; Ciaburro, H.; Rompre, P.H.; Sallaleh, I.; Do, C.M.A. Long-term randomized clinical trial evaluating the effects of fixture surface acid-etching and machined collar design on bone healing. Quintessence Int. 2018, 49, 733–743. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.H.; Park, K.; Choi, K.H.; Kim, S.H.; Kim, S.E.; Jeong, C.M.; Huh, J.B. Cell adhesion and in vivo osseointegration of sandblasted/acid etched/anodized dental implants. Int. J. Mol. Sci. 2015, 16, 10324–10336. [Google Scholar] [CrossRef] [Green Version]
- Weng, D.; Hoffmeyer, M.; Hurzeler, M.B.; Richter, E.J. Osseotite vs. machined surface in poor bone quality. A study in dogs. Clin. Oral Implants Res. 2003, 14, 703–708. [Google Scholar] [CrossRef]
- Ogawa, T.; Nishimura, I. Different bone integration profiles of turned and acid-etched implants associated with modulated expression of extracellular matrix genes. Int. J. Oral. Maxillofac. Implants 2003, 18, 200–210. [Google Scholar]
- Kubo, K.; Att, W.; Yamada, M.; Ohmi, K.; Tsukimura, N.; Suzuki, T.; Maeda, H.; Ogawa, T. Microtopography of titanium suppresses osteoblastic differentiation but enhances chondroblastic differentiation of rat femoral periosteum-derived cells. J. Biomed. Mater. Res. A 2008, 87, 380–391. [Google Scholar] [CrossRef]
- Shim, J.; Nakamura, H.; Ogawa, T.; Gupta, V. An understanding of the mechanism that promotes adhesion between roughened titanium implants and mineralized tissue. J. Biomech. Eng. 2009, 131, 054503. [Google Scholar] [CrossRef]
- Hori, N.; Ueno, T.; Suzuki, T.; Yamada, M.; Att, W.; Okada, S.; Ohno, A.; Aita, H.; Kimoto, K.; Ogawa, T. Ultraviolet light treatment for the restoration of age-related degradation of titanium bioactivity. Int. J. Oral Maxillofac. Implants 2010, 25, 49–62. [Google Scholar]
- Att, W.; Hori, N.; Iwasa, F.; Yamada, M.; Ueno, T.; Ogawa, T. The effect of UV-photofunctionalization on the time-related bioactivity of titanium and chromium-cobalt alloys. Biomaterials 2009, 30, 4268–4276. [Google Scholar] [CrossRef]
- Saruwatari, L.; Aita, H.; Butz, F.; Nakamura, H.K.; Ouyang, J.; Yang, Y.; Chiou, W.A.; Ogawa, T. Osteoblasts generate harder, stiffer, and more delamination-resistant mineralized tissue on titanium than on polystyrene, associated with distinct tissue micro- and ultrastructure. J. Bone Miner. Res. 2005, 20, 2002–2016. [Google Scholar] [CrossRef] [PubMed]
- Kim, R.H.; Williams, D.W.; Bae, S.; Lee, R.S.; Oh, J.E.; Mehrazarin, S.; Kim, T.; Shin, K.H.; Park, N.H.; Kang, M.K. Camphorquinone inhibits odontogenic differentiation of dental pulp cells and triggers release of inflammatory cytokines. J. Endod 2013, 39, 57–61. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Saruta, J.; To, M.; Sugimoto, M.; Yamamoto, Y.; Shimizu, T.; Nakagawa, Y.; Inoue, H.; Saito, I.; Tsukinoki, K. Salivary Gland Derived BDNF Overexpression in Mice Exerts an Anxiolytic Effect. Int. J. Mol. Sci. 2017, 18, 1902. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ozawa, S.; Ogawa, T.; Iida, K.; Sukotjo, C.; Hasegawa, H.; Nishimura, R.D.; Nishimura, I. Ovariectomy hinders the early stage of bone-implant integration: Histomorphometric, biomechanical, and molecular analyses. Bone 2002, 30, 137–143. [Google Scholar] [CrossRef]
Gapdh | Forward | AACCCATCACCATCTTCCAGG |
Reverse | GCCTTCTCCATGGTGGTGAA | |
Opn | Forward | GACAGCAACGGGAAGACC |
Reverse | CAGGCTGGCTTTGGAACT | |
Ocn | Forward | GAGGGCAGTAAGGTGGTGAA |
Reverse | CGTCCTGGAAGCCAATGTG |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hasegawa, M.; Saruta, J.; Hirota, M.; Taniyama, T.; Sugita, Y.; Kubo, K.; Ishijima, M.; Ikeda, T.; Maeda, H.; Ogawa, T. A Newly Created Meso-, Micro-, and Nano-Scale Rough Titanium Surface Promotes Bone-Implant Integration. Int. J. Mol. Sci. 2020, 21, 783. https://doi.org/10.3390/ijms21030783
Hasegawa M, Saruta J, Hirota M, Taniyama T, Sugita Y, Kubo K, Ishijima M, Ikeda T, Maeda H, Ogawa T. A Newly Created Meso-, Micro-, and Nano-Scale Rough Titanium Surface Promotes Bone-Implant Integration. International Journal of Molecular Sciences. 2020; 21(3):783. https://doi.org/10.3390/ijms21030783
Chicago/Turabian StyleHasegawa, Masakazu, Juri Saruta, Makoto Hirota, Takashi Taniyama, Yoshihiko Sugita, Katsutoshi Kubo, Manabu Ishijima, Takayuki Ikeda, Hatsuhiko Maeda, and Takahiro Ogawa. 2020. "A Newly Created Meso-, Micro-, and Nano-Scale Rough Titanium Surface Promotes Bone-Implant Integration" International Journal of Molecular Sciences 21, no. 3: 783. https://doi.org/10.3390/ijms21030783