The Cuban Propolis Component Nemorosone Inhibits Proliferation and Metastatic Properties of Human Colorectal Cancer Cells
Abstract
:1. Introduction
2. Results
2.1. NEM and CP Suppress CRC Cell Viability
2.2. Inhibitory Effect of NEM and CP on Clonogenic Capacity of CRC Cell Lines
2.3. NEM and CP Induce G1 Phase Cell Cycle Arrest in CRC Cell Lines
2.4. NEM and CP Induce Apoptosis in CRC Cell Lines
2.5. NEM and CP Regulate the Expression of Apoptosis-related Genes in CRC Cell Lines
2.6. NEM and CP Promote the Activation of Caspases in CRC Cell Lines
2.7. NEM and CP Inhibited Migration and Invasion of CRC Cell Lines
2.8. NEM and CP Regulate Expression of MMP9 and EMT Protein Markers in CRC Cell Lines
3. Discussion
4. Materials and Methods
4.1. Chemicals and Antibodies
4.2. Sample Preparation
4.3. Cell Culture
4.4. Cell Viability Assay
4.5. Colony Formation Assay
4.6. Cell Cycle Assay
4.7. Annexin V-FITC/PI Assay
4.8. RNA Extraction and Quantitative RT-PCR (qRT-PCR)
4.9. Caspase-Glo 3/7 Assay
4.10. Wounding Healing Assay
4.11. Cell Migration and Invasion Assays
4.12. Metalloproteinase Activity
4.13. Immunocytochemistry (ICC)
4.14. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Brody, H. Colorectal cancer. Nature 2015, 521, S1. [Google Scholar] [CrossRef] [PubMed]
- Siegel, R.L.; Miller, K.D.; Fedewa, S.A.; Ahnen, D.J.; Meester, R.G.S.; Barzi, A.; Jemal, A. Colorectal cancer statistics, 2017: Colorectal Cancer Statistics, 2017. CA A Cancer J. Clin. 2017, 67, 177–193. [Google Scholar] [CrossRef] [PubMed]
- Vogel, A.; Hofheinz, R.D.; Kubicka, S.; Arnold, D. Treatment decisions in metastatic colorectal cancer—Beyond first and second line combination therapies. Cancer Treat. Rev. 2017, 59, 54–60. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dromain, C.; Caramella, C.; Dartigues, P.; Goere, D.; Ducreux, M.; Deschamps, F. Liver, lung and peritoneal metastases in colorectal cancers: Is the patient still curable? What should the radiologist know. Diagn. Interv. Imaging 2014, 95, 513–523. [Google Scholar] [CrossRef] [Green Version]
- Dahabre, J.; Vasilaki, M.; Stathopoulos, G.P.; Kondaxis, A.; Iliadis, K.; Papadopoulos, G.; Stathopoulos, J.; Rigatos, S.; Vasilikos, K.; Koutantos, J. Surgical management in lung metastases from colorectal cancer. Anticancer Res. 2007, 27, 4387–4390. [Google Scholar] [PubMed]
- Tsoulfas, G. Surgical treatment of hepatic metastases from colorectal cancer. WJGO 2011, 3, 1. [Google Scholar] [CrossRef] [PubMed]
- Andres, A.; Mentha, G.; Adam, R.; Gerstel, E.; Skipenko, O.G.; Barroso, E.; Lopez-Ben, S.; Hubert, C.; Majno, P.E.; Toso, C. Surgical management of patients with colorectal cancer and simultaneous liver and lung metastases. Br. J. Surg. 2015, 102, 691–699. [Google Scholar] [CrossRef]
- Martin, T.; Ye, L.; AJ, S.; Lane, J.; Jiang, W. Cancer Invasion and Metastasis: Molecular and Cellular perspective. In Metastatic Cancer: Clinical and Biological Perspectives; Landes Bioscience: Austin, TX, USA, 2013; pp. 135–168. ISBN 978-1-58706-659-7. [Google Scholar]
- Tahtamouni, L.; Ahram, M.; Koblinski, J.; Rolfo, C. Molecular Regulation of Cancer Cell Migration, Invasion, and Metastasis. Anal. Cell. Pathol. 2019, 2019, 1–2. [Google Scholar] [CrossRef] [Green Version]
- Garg, M. Epithelial-mesenchymal transition—Activating transcription factors—Multifunctional regulators in cancer. WJSC 2013, 5, 188. [Google Scholar] [CrossRef]
- Pastushenko, I.; Blanpain, C. EMT Transition States during Tumor Progression and Metastasis. Trends Cell Biol. 2019, 29, 212–226. [Google Scholar] [CrossRef] [Green Version]
- Loree, J.M.; Kopetz, S. Recent developments in the treatment of metastatic colorectal cancer. Ther. Adv. Med. Oncol. 2017, 9, 551–564. [Google Scholar] [CrossRef] [PubMed]
- Redondo-Blanco, S.; Fernández, J.; Gutiérrez-del-Río, I.; Villar, C.J.; Lombó, F. New Insights toward Colorectal Cancer Chemotherapy Using Natural Bioactive Compounds. Front. Pharmacol. 2017, 8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Buriani, A.; Fortinguerra, S.; Sorrenti, V.; Dall’Acqua, S.; Innocenti, G.; Montopoli, M.; Gabbia, D.; Carrara, M. Human Adenocarcinoma Cell Line Sensitivity to Essential Oil Phytocomplexes from Pistacia Species: A Multivariate Approach. Molecules 2017, 22, 1336. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Butler, M.S. Natural products to drugs: Natural product-derived compounds in clinical trials. Nat. Prod. Rep. 2008, 25, 475. [Google Scholar] [CrossRef]
- Attar, R.; Tabassum, S.; Fayyaz, S.; Ahmad, M.S.; Nogueira, D.R.; Yaylim, I.; Timirci-Kahraman, O.; Kucukhuseyin, O.; Cacina, C.; Farooqi, A.A.; et al. Natural products are the future of anticancer therapy: Preclinical and clinical advancements of Viscum album phytometabolites. Cell. Mol. Biol. (Noisy-le-grand) 2015, 61, 62–68. [Google Scholar]
- Moga, M.; Dimienescu, O.; Arvatescu, C.; Mironescu, A.; Dracea, L.; Ples, L. The Role of Natural Polyphenols in the Prevention and Treatment of Cervical Cancer—An Overview. Molecules 2016, 21, 1055. [Google Scholar] [CrossRef] [Green Version]
- Sarwar, M.S.; Zhang, H.-J.; Tsang, S.W. Perspectives of Plant Natural Products in Inhibition of Cancer Invasion and Metastasis by Regulating Multiple Signaling Pathways. CMC 2019, 25, 5057–5087. [Google Scholar] [CrossRef]
- Sawicka, D.; Car, H.; Borawska, M.H.; Nikliński, J. The anticancer activity of propolis. Folia Histochem. Cytobiol. 2012, 50, 25–37. [Google Scholar] [CrossRef] [Green Version]
- Badolato, M.; Carullo, G.; Cione, E.; Aiello, F.; Caroleo, M.C. From the hive: Honey, a novel weapon against cancer. Eur. J. Med. Chem. 2017, 142, 290–299. [Google Scholar] [CrossRef]
- Kocot, J.; Kiełczykowska, M.; Luchowska-Kocot, D.; Kurzepa, J.; Musik, I. Antioxidant Potential of Propolis, Bee Pollen, and Royal Jelly: Possible Medical Application. Oxidative Med. Cell. Longev. 2018, 2018, 1–29. [Google Scholar] [CrossRef]
- Wehbe, R.; Frangieh, J.; Rima, M.; El Obeid, D.; Sabatier, J.-M.; Fajloun, Z. Bee Venom: Overview of Main Compounds and Bioactivities for Therapeutic Interests. Molecules 2019, 24, 2997. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Burdock, G.A. Review of the biological properties and toxicity of bee propolis (propolis). Food Chem. Toxicol. 1998, 36, 347–363. [Google Scholar] [CrossRef]
- Oršolić, N. A review of propolis antitumour action in vivo and in vitro. J. Apiprod. Apimed. Sci. 2010, 2, 1. [Google Scholar] [CrossRef]
- Patel, S. Emerging Adjuvant Therapy for Cancer: Propolis and its Constituents. J. Diet. Suppl. 2016, 13, 245–268. [Google Scholar] [CrossRef]
- Zabaiou, N.; Fouache, A.; Trousson, A.; Baron, S.; Zellagui, A.; Lahouel, M.; Lobaccaro, J.-M.A. Biological properties of propolis extracts: Something new from an ancient product. Chem. Phys. Lipids 2017, 207, 214–222. [Google Scholar] [CrossRef]
- Bankova, V. Chemical diversity of propolis and the problem of standardization. J. Ethnopharmacol. 2005, 100, 114–117. [Google Scholar] [CrossRef]
- Piccinelli, A.L.; Lotti, C.; Campone, L.; Cuesta-Rubio, O.; Campo Fernandez, M.; Rastrelli, L. Cuban and Brazilian Red Propolis: Botanical Origin and Comparative Analysis by High-Performance Liquid Chromatography–Photodiode Array Detection/Electrospray Ionization Tandem Mass Spectrometry. J. Agric. Food Chem. 2011, 59, 6484–6491. [Google Scholar] [CrossRef]
- Syamsudin; Wiryowidagdo, S.; Simanjuntak, P.; Heffen, W.L. Chemical Composition of Propolis from Different Regions in Java and their Cytotoxic Activity. Am. J. Biochem. Biotechnol. 2009, 5, 180–183. [Google Scholar]
- Díaz-Carballo, D.; Malak, S.; Bardenheuer, W.; Freistuehler, M.; Peter Reusch, H. The contribution of plukenetione A to the anti-tumoral activity of Cuban propolis. Bioorg. Med. Chem. 2008, 16, 9635–9643. [Google Scholar] [CrossRef]
- Popolo, A.; Piccinelli, L.A.; Morello, S.; Cuesta-Rubio, O.; Sorrentino, R.; Rastrelli, L.; Pinto, A. Antiproliferative activity of brown Cuban propolis extract on human breast cancer cells. Nat. Prod. Commun. 2009, 4, 1711–1716. [Google Scholar] [CrossRef] [Green Version]
- Frión-Herrera, Y.; Gabbia, D.; Díaz-García, A.; Cuesta-Rubio, O.; Carrara, M. Chemosensitizing activity of Cuban propolis and nemorosone in doxorubicin resistant human colon carcinoma cells. Fitoterapia 2019, 136, 104173. [Google Scholar] [CrossRef] [PubMed]
- Rubio, O.C.; Cuellar, A.C.; Rojas, N.; Castro, H.V.; Rastrelli, L.; Aquino, R. A Polyisoprenylated Benzophenone from Cuban Propolis. J. Nat. Prod. 1999, 62, 1013–1015. [Google Scholar] [CrossRef] [PubMed]
- Hernández, I.M.; Fernandez, M.C.; Cuesta-Rubio, O.; Piccinelli, A.L.; Rastrelli, L. Polyprenylated Benzophenone Derivatives from Cuban Propolis. J. Nat. Prod. 2005, 68, 931–934. [Google Scholar] [CrossRef] [PubMed]
- Cuesta-Rubio, O.; Piccinelli, A.L.; Fernandez, M.C.; Hernández, I.M.; Rosado, A.; Rastrelli, L. Chemical characterization of Cuban propolis by HPLC-PDA, HPLC-MS, and NMR: The brown, red, and yellow Cuban varieties of propolis. J. Agric. Food Chem. 2007, 55, 7502–7509. [Google Scholar] [CrossRef]
- Cuesta-Rubio, O.; Frontana-Uribe, B.A.; Ramírez-Apan, T.; Cárdenas, J. Polyisoprenylated benzophenones in cuban propolis; biological activity of nemorosone. Z. Naturforsch. C J. Biosci. 2002, 57, 372–378. [Google Scholar] [CrossRef]
- Monzote, L.; Cuesta-Rubio, O.; Campo Fernandez, M.; Márquez Hernandez, I.; Fraga, J.; Pérez, K.; Kerstens, M.; Maes, L.; Cos, P. In vitro antimicrobial assessment of Cuban propolis extracts. Mem. Inst. Oswaldo Cruz 2012, 107, 978–984. [Google Scholar] [CrossRef] [Green Version]
- Pardo Andreu, G.L.; Reis, F.H.Z.; Dalalio, F.M.; Nuñez Figueredo, Y.; Cuesta Rubio, O.; Uyemura, S.A.; Curti, C.; Alberici, L.C. The cytotoxic effects of brown Cuban propolis depend on the nemorosone content and may be mediated by mitochondrial uncoupling. Chem. Biol. Interact. 2015, 228, 28–34. [Google Scholar] [CrossRef] [Green Version]
- Boesch, M.; Spizzo, G.; Seeber, A. Concise Review: Aggressive Colorectal Cancer: Role of Epithelial Cell Adhesion Molecule in Cancer Stem Cells and Epithelial-to-Mesenchymal Transition: EpCAM in Aggressive Colorectal Cancer. STEM CELLS Transl. Med. 2018, 7, 495–501. [Google Scholar] [CrossRef]
- Gayet, J.; Zhou, X.-P.; Duval, A.; Rolland, S.; Hoang, J.-M.; Cottu, P.; Hamelin, R. Extensive characterization of genetic alterations in a series of human colorectal cancer cell lines. Oncogene 2001, 20, 5025–5032. [Google Scholar] [CrossRef] [Green Version]
- Mouradov, D.; Sloggett, C.; Jorissen, R.N.; Love, C.G.; Li, S.; Burgess, A.W.; Arango, D.; Strausberg, R.L.; Buchanan, D.; Wormald, S.; et al. Colorectal Cancer Cell Lines Are Representative Models of the Main Molecular Subtypes of Primary Cancer. Cancer Res. 2014, 74, 3238–3247. [Google Scholar] [CrossRef] [Green Version]
- Silva-Carvalho, R.; Baltazar, F.; Almeida-Aguiar, C. Propolis: A Complex Natural Product with a Plethora of Biological Activities That Can Be Explored for Drug Development. Evid. Based Complement. Altern. Med. 2015, 2015, 1–29. [Google Scholar] [CrossRef] [PubMed]
- Hartwell, L.; Kastan, M. Cell cycle control and cancer. Science 1994, 266, 1821–1828. [Google Scholar] [CrossRef] [PubMed]
- Kohn, K.W.; Jackman, J.; O’Connor, P.M. Cell cycle control and cancer chemotherapy. J. Cell. Biochem. 1994, 54, 440–452. [Google Scholar] [CrossRef] [PubMed]
- Zhu, M.; Li, M.; Zhang, F.; Feng, F.; Chen, W.; Yang, Y.; Cui, J.; Zhang, D.; Linghu, E. FBI-1 Enhances ETS-1 Signaling Activity and Promotes Proliferation of Human Colorectal Carcinoma Cells. PLoS ONE 2014, 9, e98041. [Google Scholar] [CrossRef] [Green Version]
- Houghton, J.A.; Harwood, F.G.; Houghton, P.J. Cell cycle control processes determine cytostasis or cytotoxicity in thymineless death of colon cancer cells. Cancer Res. 1994, 54, 4967–4973. [Google Scholar]
- Danielson, K.G.; McEldrew, D.; Alston, J.T.; Roling, D.B.; Damjanov, A.; Damjanov, I.; Daskal, I.; Spinner, N. Human colon carcinoma cell lines from the primary tumor and a lymph node metastasis. In Vitro Cell Dev. Biol. Animal 1992, 28, 7–10. [Google Scholar] [CrossRef]
- Alley, M.C.; Hollingshead, M.G.; Borgel, S.D.; Plater, K.; Burkett, M.W.; Anver, M.R.; Yen, B.R.; Hite, K.M.; Scudiero, D.A.; Monks, A.; et al. Abstract 5202: Human colon cancer cell lines contain subsets of cells with the capacity to initiate highly prolific clonal growth in soft agar culture and to form transplantable tumor xenografts in vivo. In Proceedings of the Tumor Biology; American Association for Cancer Research: Philadelphia, PA, USA, 2011; p. 5202. [Google Scholar]
- Chen, P.; Parks, W.C. Role of matrix metalloproteinases in epithelial migration. J. Cell. Biochem. 2009, 108, 1233–1243. [Google Scholar] [CrossRef]
- Waas, E.T.; Wobbes, T.; Lomme, R.M.L.M.; DeGroot, J.; Ruers, T.; Hendriks, T. Matrix metalloproteinase 2 and 9 activity in patients with colorectal cancer liver metastasis. Br. J. Surg. 2003, 90, 1556–1564. [Google Scholar] [CrossRef]
- Mitra, A.; Mishra, L.; Li, S. EMT, CTCs and CSCs in tumor relapse and drug-resistance. Oncotarget 2015, 6, 10697–10711. [Google Scholar] [CrossRef] [Green Version]
- Sanchez-Tillo, E.; de Barrios, O.; Siles, L.; Cuatrecasas, M.; Castells, A.; Postigo, A. β-catenin/TCF4 complex induces the epithelial-to-mesenchymal transition (EMT)-activator ZEB1 to regulate tumor invasiveness. Proc. Natl. Acad. Sci. USA 2011, 108, 19204–19209. [Google Scholar] [CrossRef] [Green Version]
- Satelli, A.; Li, S. Vimentin in cancer and its potential as a molecular target for cancer therapy. Cell. Mol. Life Sci. 2011, 68, 3033–3046. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Heerboth, S.; Housman, G.; Leary, M.; Longacre, M.; Byler, S.; Lapinska, K.; Willbanks, A.; Sarkar, S. EMT and tumor metastasis. Clin. Trans. Med. 2015, 4, 6. [Google Scholar] [CrossRef] [PubMed]
- Iqbal, M.; Fan, T.; Watson, D.; Alenezi, S.; Saleh, K.; Sahlan, M. Preliminary studies: The potential anti-angiogenic activities of two Sulawesi Island (Indonesia) propolis and their chemical characterization. Heliyon 2019, 5, e01978. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cuesta-Rubio, O.; Velez-Castro, H.; Frontana-Uribe, B.A.; Cardenas, J. Nemorosone, the major constituent of floral resins of Clusia rosea. Phytochemistry 2001, 57, 279–283. [Google Scholar] [CrossRef]
- Catanzaro, D.; Gabbia, D.; Cocetta, V.; Biagi, M.; Ragazzi, E.; Montopoli, M.; Carrara, M. Silybin counteracts doxorubicin resistance by inhibiting GLUT1 expression. Fitoterapia 2018, 124, 42–48. [Google Scholar] [CrossRef]
- Franken, N.A.P.; Rodermond, H.M.; Stap, J.; Haveman, J.; van Bree, C. Clonogenic assay of cells in vitro. Nat. Protoc. 2006, 1, 2315–2319. [Google Scholar] [CrossRef]
- Gabbia, D.; Pozza, A.D.; Albertoni, L.; Lazzari, R.; Zigiotto, G.; Carrara, M.; Baldo, V.; Baldovin, T.; Floreani, A.; Martin, S.D. Pregnane X receptor and constitutive androstane receptor modulate differently CYP3A-mediated metabolism in early- and late-stage cholestasis. World J. Gastroenterol. 2017, 23, 7519–7530. [Google Scholar] [CrossRef]
- Castellani, G.; Paliuri, G.; Orso, G.; Paccagnella, N.; D’Amore, C.; Facci, L.; Cima, F.; Caicci, F.; Palatini, P.; Bova, S.; et al. An intracellular adrenomedullin system reduces IL-6 release via a NF-kB-mediated, cAMP-independent transcriptional mechanism in rat thymic epithelial cells. Cytokine 2016, 88, 136–143. [Google Scholar] [CrossRef]
- Frión-Herrera, Y.; Gabbia, D.; Cuesta-Rubio, O.; De Martin, S.; Carrara, M. Nemorosone inhibits the proliferation and migration of hepatocellular carcinoma cells. Life Sci. 2019, 235, 116817. [Google Scholar] [CrossRef]
- Tajhya, R.B.; Patel, R.S.; Beeton, C. Detection of Matrix Metalloproteinases by Zymography. Methods Mol. Biol. 2017, 1579, 231–244. [Google Scholar]
- De Martin, S.; Paliuri, G.; Belloni, A.; Orso, G.; Zanarella, E.; Stellin, G.; Milanesi, O.; Basso, G.; Ruga, E.M.; Frasson, C.; et al. Expression and distribution of the adrenomedullin system in newborn human thymus. PLoS ONE 2014, 9, e97592. [Google Scholar] [CrossRef]
- Gabbia, D.; Pozzo, L.; Zigiotto, G.; Roverso, M.; Sacchi, D.; Dalla Pozza, A.; Carrara, M.; Bogialli, S.; Floreani, A.; Guido, M.; et al. Dexamethasone counteracts hepatic inflammation and oxidative stress in cholestatic rats via CAR activation. PLoS ONE 2018, 13, e0204336. [Google Scholar] [CrossRef]
- Gabbia, D.; Roverso, M.; Guido, M.; Sacchi, D.; Scaffidi, M.; Carrara, M.; Orso, G.; Russo, F.P.; Floreani, A.; Bogialli, S.; et al. Western Diet-Induced Metabolic Alterations Affect Circulating Markers of Liver Function before the Development of Steatosis. Nutrients 2019, 11, 1602. [Google Scholar] [CrossRef] [Green Version]
NEM (µM) | CP (µg/mL) | |||
---|---|---|---|---|
HT-29 | LoVo | HT-29 | LoVo | |
24 h | 57.1 ± 3.7 | 64.3 ± 4.7 | 83.0 ± 8.2 | 73.8 ± 5.7 |
48 h | 33.4 ± 2.8 ** | 35.9 ± 9.1 && | 39.9 ± 8.9 *** | 43.7 ± 6.3 & |
72 h | 25.7 ± 3.3 ***/$ | 22.8 ± 6.2 &&&/# | 20.2 ± 6. 8 ****/$ | 24.9 ± 10.7 &&&/# |
Gene | Forward Sequence | Reverse Sequence |
---|---|---|
GAPDH | ACATCAAGAAGGTGGTGAAGCA | GTCAAAGGTGGAGGAGTGGGT |
TP53 | GAGACCTGTGGGAAGCG | CGGGGACAGCATCAAAT |
BAX | CACTGAAGCGACTGATGTCCC | CCGCCACAAAGATGGTCAC |
BCL2 | TGTGTGTGGAGAGCGTCAA | CAGCCCAGACTCACATCACCA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Frión-Herrera, Y.; Gabbia, D.; Scaffidi, M.; Zagni, L.; Cuesta-Rubio, O.; De Martin, S.; Carrara, M. The Cuban Propolis Component Nemorosone Inhibits Proliferation and Metastatic Properties of Human Colorectal Cancer Cells. Int. J. Mol. Sci. 2020, 21, 1827. https://doi.org/10.3390/ijms21051827
Frión-Herrera Y, Gabbia D, Scaffidi M, Zagni L, Cuesta-Rubio O, De Martin S, Carrara M. The Cuban Propolis Component Nemorosone Inhibits Proliferation and Metastatic Properties of Human Colorectal Cancer Cells. International Journal of Molecular Sciences. 2020; 21(5):1827. https://doi.org/10.3390/ijms21051827
Chicago/Turabian StyleFrión-Herrera, Yahima, Daniela Gabbia, Michela Scaffidi, Letizia Zagni, Osmany Cuesta-Rubio, Sara De Martin, and Maria Carrara. 2020. "The Cuban Propolis Component Nemorosone Inhibits Proliferation and Metastatic Properties of Human Colorectal Cancer Cells" International Journal of Molecular Sciences 21, no. 5: 1827. https://doi.org/10.3390/ijms21051827