Degeneration of Lumbar Intervertebral Discs: Characterization of Anulus Fibrosus Tissue and Cells of Different Degeneration Grades
Abstract
:1. Introduction
2. Results
2.1. Genome-Wide Microarray Gene Expression Profiling
2.2. Determination of Glycosaminoglycan and Collagen Content
2.3. Stimulation Assay
3. Discussion
4. Materials and Methods
4.1. Sample Preparation for Genome-Wide Microarrays
4.2. Genome-Wide Microarray Gene Expression Profiling
4.3. Determination of Glycosaminoglycan (GAG) and Collagen Content
4.4. Stimulation Assay
4.5. RTD-PCR
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
ACAN | Aggrecan |
AF | Anulus fibrosus |
BGLAP | Bone gamma-carboxcylglutamate protein (osteocalcin) |
BGN | Biglycan |
BMP | Bone morphogenetic protein |
CILP | Cartilage intermediate layer protein |
COL1A1 | Collagen type I, alpha 1 |
COL2A1 | Collagen type II, alpha 1 |
COL10A1 | Collagen type X, alpha 1 |
COMP | Cartilage oligomeric matrix protein |
CRTAP | Cartilage associated protein |
DCN | Decorin |
DMMB | Dimethyl methylene blue |
cDNA | Complementary deoxyribonucleic acid |
ECM | Extracellular matrix |
EDTA | Ethylenediaminetetraacetic acid |
FBS | Fetal bovine serum |
FC | Fold change |
GAG | Glycosaminoglycan |
GAPDH | Glyceraldehyde-3-phosphate dehydrogenase |
gDNA | Genomic deoxyribonucleic acid |
GDP | Gross domestic product |
HPRT1 | Hypoxanthine phosphoribosyltransferase 1 |
IBSP | Integrin-binding sialoprotein |
ID1 | Inhibitor of DNA Binding 1, HLH Protein |
IL1β | Interleukin 1β |
IVD | Intervertebral disc |
MMP | Matrix metalloproteinases |
NOG | Noggin |
NP | Nucleus pulposus |
POSTN | Periostin (osteoblast-specific factor) |
RNA | Ribonucleic acid |
RTD-PCR | Real-time detection polymerase chain reaction |
RUNX2 | RUNX family transcription factor 2 |
SEM | Standard error of the mean |
SERPINE1 | Serpin family E member 1 |
SMAD7 | SMAD Family Member 7 |
SOX9 | SRY (sex determining region Y)-box 9 |
SPP1 | Secreted phosphoprotein 1 (osteopontin) |
TGFβ1 | Transforming growth factor β1 |
TNFα | Tumor necrosis factor α |
References
- Schmidt, C.O.; Raspe, H.; Pfingsten, M.; Hasenbring, M.; Basler, H.D.; Eich, W.; Kohlmann, T. Back pain in the German adult population: Prevalence, severity, and sociodemographic correlates in a multiregional survey. Spine (Phila Pa 1976) 2007, 32, 2005–2011. [Google Scholar] [CrossRef] [PubMed]
- Wenig, C.M.; Schmidt, C.O.; Kohlmann, T.; Schweikert, B. Costs of back pain in Germany. Eur. J. Pain 2009, 13, 280–286. [Google Scholar] [CrossRef] [PubMed]
- Sharifi, S.; Bulstra, S.K.; Grijpma, D.W.; Kuijer, R. Treatment of the degenerated intervertebral disc; closure, repair and regeneration of the annulus fibrosus. J. Tissue Eng. Regen. Med. 2015, 9, 1120–1132. [Google Scholar] [CrossRef] [PubMed]
- Lebow, R.L.; Adogwa, O.; Parker, S.L.; Sharma, A.; Cheng, J.; McGirt, M.J. Asymptomatic same-site recurrent disc herniation after lumbar discectomy: Results of a prospective longitudinal study with 2-year serial imaging. Spine (Phila Pa 1976) 2011, 36, 2147–2151. [Google Scholar] [CrossRef] [PubMed]
- Newton, M.D.; Marek, A.A.; Planalp, M.; Park, D.K.; Baker, K.C.; Maerz, T. Longitudinal characterization of intervertebral disc remodeling following acute annular injury in a rat model of degenerative disc disease. Connect. Tissue Res. 2019, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Bailey, A.; Araghi, A.; Blumenthal, S.; Huffmon, G.V.; Anular Repair Clinical Study, G. Prospective, multicenter, randomized, controlled study of anular repair in lumbar discectomy: Two-year follow-up. Spine (Phila Pa 1976) 2013, 38, 1161–1169. [Google Scholar] [CrossRef] [PubMed]
- Parker, S.L.; Grahovac, G.; Vukas, D.; Vilendecic, M.; Ledic, D.; McGirt, M.J.; Carragee, E.J. Effect of an Annular Closure Device (Barricaid) on Same-Level Recurrent Disk Herniation and Disk Height Loss After Primary Lumbar Discectomy: Two-year Results of a Multicenter Prospective Cohort Study. Clin. Spine Surg. 2016, 29, 454–460. [Google Scholar] [CrossRef]
- Ledic, D.; Vukas, D.; Grahovac, G.; Barth, M.; Bouma, G.J.; Vilendecic, M. Effect of anular closure on disk height maintenance and reoperated recurrent herniation following lumbar diskectomy: Two-year data. J. Neurol. Surg. A Cent. Eur. Neurosurg. 2015, 76, 211–218. [Google Scholar] [CrossRef]
- Bron, J.L.; Helder, M.N.; Meisel, H.J.; Van Royen, B.J.; Smit, T.H. Repair, regenerative and supportive therapies of the annulus fibrosus: Achievements and challenges. Eur. Spine J. 2009, 18, 301–313. [Google Scholar] [CrossRef] [Green Version]
- Sivan, S.S.; Tsitron, E.; Wachtel, E.; Roughley, P.J.; Sakkee, N.; van der Ham, F.; DeGroot, J.; Roberts, S.; Maroudas, A. Aggrecan turnover in human intervertebral disc as determined by the racemization of aspartic acid. J. Biol. Chem. 2006, 281, 13009–13014. [Google Scholar] [CrossRef] [Green Version]
- Sivan, S.S.; Wachtel, E.; Tsitron, E.; Sakkee, N.; van der Ham, F.; Degroot, J.; Roberts, S.; Maroudas, A. Collagen turnover in normal and degenerate human intervertebral discs as determined by the racemization of aspartic acid. J. Biol. Chem. 2008, 283, 8796–8801. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vadala, G.; Mozetic, P.; Rainer, A.; Centola, M.; Loppini, M.; Trombetta, M.; Denaro, V. Bioactive electrospun scaffold for annulus fibrosus repair and regeneration. Eur. Spine J. 2012, 21 (Suppl. 1), S20–S26. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pirvu, T.; Blanquer, S.B.; Benneker, L.M.; Grijpma, D.W.; Richards, R.G.; Alini, M.; Eglin, D.; Grad, S.; Li, Z. A combined biomaterial and cellular approach for annulus fibrosus rupture repair. Biomaterials 2015, 42, 11–19. [Google Scholar] [CrossRef] [PubMed]
- Tim Yoon, S.; Su Kim, K.; Li, J.; Soo Park, J.; Akamaru, T.; Elmer, W.A.; Hutton, W.C. The effect of bone morphogenetic protein-2 on rat intervertebral disc cells in vitro. Spine (Phila Pa 1976) 2003, 28, 1773–1780. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Y.; An, H.S.; Song, S.; Toofanfard, M.; Masuda, K.; Andersson, G.B.; Thonar, E.J. Growth factor osteogenic protein-1: Differing effects on cells from three distinct zones in the bovine intervertebral disc. Am. J. Phys. Med. Rehabil. 2004, 83, 515–521. [Google Scholar] [CrossRef] [PubMed]
- Chujo, T.; An, H.S.; Akeda, K.; Miyamoto, K.; Muehleman, C.; Attawia, M.; Andersson, G.; Masuda, K. Effects of growth differentiation factor-5 on the intervertebral disc--in vitro bovine study and in vivo rabbit disc degeneration model study. Spine (Phila Pa 1976) 2006, 31, 2909–2917. [Google Scholar] [CrossRef]
- Hegewald, A.A.; Zouhair, S.; Endres, M.; Cabraja, M.; Woiciechowsky, C.; Thome, C.; Kaps, C. Towards biological anulus repair: TGF-beta3, FGF-2 and human serum support matrix formation by human anulus fibrosus cells. Tissue Cell 2013, 45, 68–76. [Google Scholar] [CrossRef]
- Hondke, S.; Cabraja, M.; Krüger, J.P.; Stich, S.; Hartwig, T.; Sittinger, M.; Endres, M. Proliferation, Migration, and ECM Formation Potential of Human Annulus Fibrosus Cell Is Independent of Degeneration Status. Cartilage 2018. [Google Scholar] [CrossRef]
- Stich, S.; Moller, A.; Cabraja, M.; Kruger, J.P.; Hondke, S.; Endres, M.; Ringe, J.; Sittinger, M. Chemokine CCL25 Induces Migration and Extracellular Matrix Production of Anulus Fibrosus-Derived Cells. Int. J. Mol. Sci. 2018, 19, 2207. [Google Scholar] [CrossRef] [Green Version]
- Pfirrmann, C.W.; Metzdorf, A.; Zanetti, M.; Hodler, J.; Boos, N. Magnetic resonance classification of lumbar intervertebral disc degeneration. Spine (Phila Pa 1976) 2001, 26, 1873–1878. [Google Scholar] [CrossRef]
- Roberts, S.; Caterson, B.; Menage, J.; Evans, E.H.; Jaffray, D.C.; Eisenstein, S.M. Matrix metalloproteinases and aggrecanase: Their role in disorders of the human intervertebral disc. Spine (Phila Pa 1976) 2000, 25, 3005–3013. [Google Scholar] [CrossRef] [PubMed]
- Urban, J.P.; Roberts, S. Degeneration of the intervertebral disc. Arthritis Res. Ther. 2003, 5, 120–130. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Melrose, J.; Ghosh, P.; Taylor, T.K. A comparative analysis of the differential spatial and temporal distributions of the large (aggrecan, versican) and small (decorin, biglycan, fibromodulin) proteoglycans of the intervertebral disc. J. Anat. 2001, 198, 3–15. [Google Scholar] [CrossRef] [PubMed]
- Cs-Szabo, G.; Ragasa-San Juan, D.; Turumella, V.; Masuda, K.; Thonar, E.J.; An, H.S. Changes in mRNA and protein levels of proteoglycans of the anulus fibrosus and nucleus pulposus during intervertebral disc degeneration. Spine (Phila Pa 1976) 2002, 27, 2212–2219. [Google Scholar] [CrossRef]
- Iu, J.; Santerre, J.P.; Kandel, R.A. Inner and outer annulus fibrosus cells exhibit differentiated phenotypes and yield changes in extracellular matrix protein composition in vitro on a polycarbonate urethane scaffold. Tissue Eng. Part A 2014, 20, 3261–3269. [Google Scholar] [CrossRef]
- Rutges, J.; Creemers, L.B.; Dhert, W.; Milz, S.; Sakai, D.; Mochida, J.; Alini, M.; Grad, S. Variations in gene and protein expression in human nucleus pulposus in comparison with annulus fibrosus and cartilage cells: Potential associations with aging and degeneration. Osteoarthr. Cartil. 2010, 18, 416–423. [Google Scholar] [CrossRef] [Green Version]
- Lefebvre, V.; de Crombrugghe, B. Toward understanding SOX9 function in chondrocyte differentiation. Matrix Biol. 1998, 16, 529–540. [Google Scholar] [CrossRef]
- Prescher, A. Anatomy and pathology of the aging spine. Eur. J. Radiol. 1998, 27, 181–195. [Google Scholar] [CrossRef]
- Schubert, A.K.; Smink, J.J.; Pumberger, M.; Putzier, M.; Sittinger, M.; Ringe, J. Standardisation of basal medium for reproducible culture of human annulus fibrosus and nucleus pulposus cells. J. Orthop. Surg. Res. 2018, 13, 209. [Google Scholar] [CrossRef]
- Rajeevan, M.S.; Vernon, S.D.; Taysavang, N.; Unger, E.R. Validation of Array-Based Gene Expression Profiles by Real-Time (Kinetic) RT-PCR. J. Mol. Diagn. 2001, 3, 26–31. [Google Scholar] [CrossRef] [Green Version]
- Nakao, A.; Afrakhte, M.; Moren, A.; Nakayama, T.; Christian, J.L.; Heuchel, R.; Itoh, S.; Kawabata, M.; Heldin, N.E.; Heldin, C.H.; et al. Identification of Smad7, a TGFbeta-inducible antagonist of TGF-beta signalling. Nature 1997, 389, 631–635. [Google Scholar] [CrossRef] [PubMed]
- Bitzer, M.; von Gersdorff, G.; Liang, D.; Dominguez-Rosales, A.; Beg, A.A.; Rojkind, M.; Bottinger, E.P. A mechanism of suppression of TGF-beta/SMAD signaling by NF-kappa B/RelA. Genes Dev. 2000, 14, 187–197. [Google Scholar] [PubMed]
- Sekiya, I.; Vuoristo, J.T.; Larson, B.L.; Prockop, D.J. In vitro cartilage formation by human adult stem cells from bone marrow stroma defines the sequence of cellular and molecular events during chondrogenesis. Proc. Natl. Acad. Sci. USA 2002, 99, 4397–4402. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Karlsson, C.; Brantsing, C.; Svensson, T.; Brisby, H.; Asp, J.; Tallheden, T.; Lindahl, A. Differentiation of human mesenchymal stem cells and articular chondrocytes: Analysis of chondrogenic potential and expression pattern of differentiation-related transcription factors. J. Orthop. Res. 2007, 25, 152–163. [Google Scholar] [CrossRef] [PubMed]
- Risbud, M.V.; Shapiro, I.M. Role of cytokines in intervertebral disc degeneration: Pain and disc content. Nat. Rev. Rheumatol. 2014, 10, 44–56. [Google Scholar] [CrossRef]
- Irizarry, R.A.; Bolstad, B.M.; Collin, F.; Cope, L.M.; Hobbs, B.; Speed, T.P. Summaries of Affymetrix GeneChip probe level data. Nucleic Acids Res. 2003, 31, e15. [Google Scholar] [CrossRef]
- Sturn, A.; Quackenbush, J.; Trajanoski, Z. Genesis: Cluster analysis of microarray data. Bioinformatics 2002, 18, 207–208. [Google Scholar] [CrossRef] [Green Version]
- Farndale, R.W.; Buttle, D.J.; Barrett, A.J. Improved quantitation and discrimination of sulphated glycosaminoglycans by use of dimethylmethylene blue. Biochim. Biophys. Acta 1986, 883, 173–177. [Google Scholar] [CrossRef]
- Stegemann, H.; Stalder, K. Determination of hydroxyproline. Clin. Chim. Acta 1967, 18, 267–273. [Google Scholar] [CrossRef]
- Homicz, M.R.; McGowan, K.B.; Lottman, L.M.; Beh, G.; Sah, R.L.; Watson, D. A compositional analysis of human nasal septal cartilage. Arch. Facial Plast Surg. 2003, 5, 53–58. [Google Scholar] [CrossRef]
- Ruschke, K.; Meier, C.; Ullah, M.; Krebs, A.C.; Silberreis, K.; Kohl, B.; Knaus, P.; Jagielski, M.; Arens, S.; Schulze-Tanzil, G. Bone morphogenetic protein 2/SMAD signalling in human ligamentocytes of degenerated and aged anterior cruciate ligaments. Osteoarthr. Cartil. 2016, 24, 1816–1825. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yoo, J.U.; Barthel, T.S.; Nishimura, K.; Solchaga, L.; Caplan, A.I.; Goldberg, V.M.; Johnstone, B. The chondrogenic potential of human bone-marrow-derived mesenchymal progenitor cells. J. Bone Joint Surg. Am. 1998, 80, 1745–1757. [Google Scholar] [CrossRef] [PubMed]
- Muller, R.D.; John, T.; Kohl, B.; Oberholzer, A.; Gust, T.; Hostmann, A.; Hellmuth, M.; Laface, D.; Hutchins, B.; Laube, G.; et al. IL-10 overexpression differentially affects cartilage matrix gene expression in response to TNF-alpha in human articular chondrocytes in vitro. Cytokine 2008, 44, 377–385. [Google Scholar] [CrossRef] [PubMed]
Affymetrix ID | Symbol | Accession No. | Mean Signal NA Mild | Mean Signal NA Severe | Native FC | Mean Signal ML Mild | Mean Signal ML Severe | Monolayer FC | Name |
---|---|---|---|---|---|---|---|---|---|
205679_x_at | ACAN | NM_001135 | 6901 | 2063 | 4.32 | 161 | 410 | −2.35 | aggrecan |
222608_s_at | ANLN | NM_018685 | 34 | 153 | −4.19 | 851 | 320 | 2.76 | anillin, actin binding protein |
227911_at | ARHGAP28 | NM_001010000 | 56 | 168 | −3.51 | 160 | 354 | −2.32 | Rho GTPase activating protein 28 |
219087_at | ASPN | NM_017680 | 20,240 | 8186 | 2.35 | 56 | 558 | −9.40 | asporin |
218899_s_at | BAALC | NM_001024372 | 653 | 154 | 5.12 | 238 | 87 | 2.66 | brain and acute leukemia, cytoplasmic |
207172_s_at | CDH11 | NM_001797 | 118 | 810 | −7.24 | 931 | 2050 | −2.05 | cadherin 11, type 2, OB-cadherin (osteoblast) |
204170_s_at | CKS2 | NM_001827 | 132 | 362 | −2.13 | 1146 | 508 | 2.14 | CDC28 protein kinase regulatory subunit 2 |
211343_s_at | COL13A1 | NM_001130103 | 205 | 1454 | −5.61 | 288 | 89 | 2.94 | collagen, type XIII, alpha 1 |
225647_s_at | CTSC | NM_001114173 | 101 | 471 | −4.78 | 1430 | 547 | 2.35 | cathepsin C |
203666_at | CXCL12 | NM_000609 | 461 | 2751 | −5.53 | 317 | 1576 | −4.00 | chemokine (C-X-C motif) ligand 12 (stromal cell-derived factor 1) |
201289_at | CYR61 | NM_001554 | 10,725 | 5011 | 2.37 | 3354 | 7457 | −2.19 | cysteine-rich, angiogenic inducer, 61 |
202481_at | DHRS3 | NM_004753 | 697 | 266 | 2.46 | 395 | 1167 | −2.52 | dehydrogenase/reductase (SDR family) member 3 |
226281_at | DNER | NM_139072 | 1458 | 497 | 5.00 | 828 | 355 | 3.10 | delta/notch-like EGF repeat containing |
232204_at | EBF1 | NM_024007 | 300 | 686 | −2.06 | 276 | 573 | −2.13 | early B-cell factor 1 |
219134_at | ELTD1 | NM_022159 | 348 | 960 | −3.38 | 110 | 46 | 2.41 | EGF, latrophilin and seven transmembrane domain containing 1 |
40665_at | FMO3 | NM_001002294 | 38 | 173 | −3.68 | 61 | 135 | −3.59 | flavin containing monooxygenase 3 |
202709_at | FMOD | NM_002023 | 24,906 | 7901 | 3.15 | 273 | 592 | −2.54 | fibromodulin |
204984_at | GPC4 | NM_001448 | 79 | 433 | −4.67 | 126 | 277 | −2.08 | glypican 4 |
209170_s_at | GPM6B | NM_001001994 | 201 | 573 | −5.92 | 121 | 336 | −3.25 | glycoprotein M6B |
214091_s_at | GPX3 | NM_002084 | 11,915 | 1856 | 5.79 | 1232 | 2315 | −3.27 | glutathione peroxidase 3 (plasma) |
227314_at | ITGA2 | NM_002203 | 133 | 450 | −2.46 | 267 | 114 | 2.18 | integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) |
219949_at | LRRC2 | NM_024512 | 279 | 116 | 2.64 | 29 | 66 | −2.42 | leucine rich repeat containing 2 |
226210_s_at | MEG3 | NR_002766 | 560 | 161 | 4.13 | 121 | 51 | 2.19 | maternally expressed 3 (non-protein coding) |
203434_s_at | MME | NM_000902 | 32 | 109 | −3.17 | 126 | 444 | −3.25 | membrane metallo-endopeptidase |
227394_at | NCAM1 | NM_000615 | 68 | 1034 | −5.12 | 84 | 27 | 3.17 | neural cell adhesion molecule 1 |
218039_at | NUSAP1 | NM_001129897 | 82 | 214 | −2.46 | 572 | 178 | 2.83 | nucleolar and spindle associated protein 1 |
213125_at | OLFML2B | NM_015441 | 386 | 2864 | −6.96 | 530 | 1360 | −2.35 | olfactomedin-like 2B |
204040_at | RNF144A | NM_014746 | 211 | 525 | −2.64 | 120 | 246 | −2.00 | ring finger protein 144A |
209773_s_at | RRM2 | NM_001034 | 31 | 159 | −4.32 | 891 | 203 | 3.48 | ribonucleotide reductase M2 |
204051_s_at | SFRP4 | NM_003014 | 496 | 2665 | −5.92 | 1749 | 5272 | −3.43 | secreted frizzled-related protein 4 |
229151_at | SLC14A1 | NM_001128588 | 1420 | 253 | 4.59 | 854 | 128 | 10.00 | solute carrier family 14 (urea transporter), member 1 (Kidd blood group) |
225987_at | STEAP4 | NM_024636 | 447 | 1962 | −3.22 | 1030 | 1855 | −2.19 | STEAP family member 4 |
213247_at | SVEP1 | NM_153366 | 107 | 511 | −4.09 | 316 | 1184 | −3.46 | sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1 |
209228_x_at | TUSC3 | NM_006765 | 136 | 299 | −2.54 | 1121 | 614 | 2.00 | tumor suppressor candidate 3 |
230083_at | USP53 | NM_019050 | 1201 | 333 | 4.13 | 213 | 411 | −2.18 | ubiquitin specific peptidase 53 |
Gene | EMBL Accession No. | Sequence (5′-3′)/ Thermo Fisher Scientific Assay No. | PCR Product Size (bp) |
---|---|---|---|
GAPDH | NM_002046 | Cat. No. Hs99999905_m1 | 122 |
ACAN | NM_001135 | Cat. No. Hs00153936_m1 | 91 |
COMP | NM_000095 | Cat. No. Hs00164359_m1 | 101 |
RUNX2 | NM_001015051 | Cat. No. Hs00298328_s1 | 124 |
BGLAP | NM_199173 | Cat. No. Hs00609452_g1 | 74 |
SPP1 | NM_000582 | Cat. No. Hs00167093_m1 | 65 |
COL1A1 | NM_000088 | Cat. No. Hs01076780_g1 | 109 |
HPRT1 | NM_000194 | F: CTTTGCTGACCTGCTGGATT R: CTGCATTGTTTTGCCAGTGT | 211 |
ID1 | NM_002165 | F: GCTGCTCTACGACATGAACG R: CCAACTGAAGGTCCCTGATG | 131 |
SERPINE1 | NM_000602 | F: CTTTCAGACCAAGAGCCTCTC R: CCATGCGGGCTGAGACTAT | 118 |
SOX9 | NM_000346 | F: GCAAGCTCTGGAGACTTCTGA R: CTGCAGCGCCTTGAAGAT | 206 |
NOG | NM_005450 | F: GTGCAAGCCGTCCAAGTC R: GCTAGAGGGTGGTGGAACTG | 219 |
SMAD7 | NM_00119082 | F: GGCTTTCAGATTCCCAACTTCTT R: ATTTTGCTCCGCACCTTCT | 217 |
COL1A1 | NM_000088 | F: GGCAACGATGGTGCTAAGG R: GACCAGCATCACCTCTGTCA | 139 |
COL2A1 | NM_001844 | F: GATGGCTGCACGAAACATACC R: AAGAAGCAGACCGGCCCTAT | 155 |
COL10A1 | NM_000493 | F: CACCATAAAGAGTAAAGGTATAGCAGT R: GCACACCTGGTTTCCCTACA | 194 |
COMP | NM_000095 | F: CCAACTCAAGGCTGTGAAGTC R: GTCCTTCCAACCCACGTTTC | 130 |
ACAN | NM_001135 | F: GACACCCCATGCAATTTGAGAA R: CCGCACCAGGGAATTGATCT | 242 |
BGN | NM_001711 | F: CTCCCAGACCTCAAGCTCC R: GGGGTTGTTGAAGAGGCTGAT | 138 |
IL1β | NM_000576 | F: CCCTAAACAGATGAAGTGCTCC R: AGAAGGTGCTCAGGTCATTCTC | 197 |
MMP3 | NM_002422 | F: CTATCAGAGGAAATGAGGTACGAGC R: GCCTGGCTCCATGGAATTTC | 179 |
MMP13 | NM_002427 | F: CCCCAGGCATCACCATTCAA R: CAGGTAGCGCTCTGCAAACT | 150 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Stich, S.; Jagielski, M.; Fleischmann, A.; Meier, C.; Bussmann, P.; Kohl, B.; Schmidt, J.; Krüger, J.-P.; Endres, M.; Cabraja, M.; et al. Degeneration of Lumbar Intervertebral Discs: Characterization of Anulus Fibrosus Tissue and Cells of Different Degeneration Grades. Int. J. Mol. Sci. 2020, 21, 2165. https://doi.org/10.3390/ijms21062165
Stich S, Jagielski M, Fleischmann A, Meier C, Bussmann P, Kohl B, Schmidt J, Krüger J-P, Endres M, Cabraja M, et al. Degeneration of Lumbar Intervertebral Discs: Characterization of Anulus Fibrosus Tissue and Cells of Different Degeneration Grades. International Journal of Molecular Sciences. 2020; 21(6):2165. https://doi.org/10.3390/ijms21062165
Chicago/Turabian StyleStich, Stefan, Michal Jagielski, Anja Fleischmann, Carola Meier, Patricia Bussmann, Benjamin Kohl, Julia Schmidt, Jan-Philipp Krüger, Michaela Endres, Mario Cabraja, and et al. 2020. "Degeneration of Lumbar Intervertebral Discs: Characterization of Anulus Fibrosus Tissue and Cells of Different Degeneration Grades" International Journal of Molecular Sciences 21, no. 6: 2165. https://doi.org/10.3390/ijms21062165
APA StyleStich, S., Jagielski, M., Fleischmann, A., Meier, C., Bussmann, P., Kohl, B., Schmidt, J., Krüger, J.-P., Endres, M., Cabraja, M., Reimann, K., Laue, D., Ertel, W., & Sittinger, M. (2020). Degeneration of Lumbar Intervertebral Discs: Characterization of Anulus Fibrosus Tissue and Cells of Different Degeneration Grades. International Journal of Molecular Sciences, 21(6), 2165. https://doi.org/10.3390/ijms21062165