Loss of Wnt16 Leads to Skeletal Deformities and Downregulation of Bone Developmental Pathway in Zebrafish
Abstract
:1. Introduction
2. Results
2.1. Generation of Wnt16−/− Zebrafish
2.2. Wnt16−/− Zebrafish Identified Significant Differences Based on Skeletal Phenotype Analysis
2.3. Transcriptome Sequencing and Differential Expression Gene Profiles
2.4. The Skeletal Developmental Pathways Are Down-Regulated Following Wnt16 Knockout
2.5. Validation of Selected DEGs Using Quantitative Real-Time PCR (qRT-PCR)
3. Discussion
4. Materials and Methods
4.1. Zebrafish Maintenance
4.2. Microinjection and Generation of Wnt16 Mutant Zebrafish
4.3. Whole-Mount In Situ Hybridisation
4.4. Light Microscopy and Micro-CT Imaging
4.5. Library Construction and High-Throughput Sequencing
4.6. KEGG and GO Enrichment Analysis of DEGs
4.7. Validation of Selected Genes by Quantitative RT-PCR
4.8. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Baron, R.; Hesse, E. Update on bone anabolics in osteoporosis treatment: Rationale, current status, and perspectives. J. Clin. Endocrinol. Metab. 2012, 97, 311–325. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wright, N.C.; Looker, A.C.; Saag, K.G.; Curtis, J.R.; Delzell, E.S.; Randall, S.; Dawson-Hughes, B. The recent prevalence of osteoporosis and low bone mass in the United States based on bone mineral density at the femoral neck or lumbar spine. J. Bone Miner. Res. 2014, 29, 2520–2526. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, J.; Curtis, E.M.; Cooper, C.; Harvey, N.C. State of the art in osteoporosis risk assessment and treatment. J. Endocrinol. Investig. 2019, 42, 1149–1164. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lane, J.M.; Russell, L.; Khan, S.N. Osteoporosis. Clin. Orthop. Relat. Res. 2000, 372, 139–150. [Google Scholar] [CrossRef] [PubMed]
- Maeda, K.; Kobayashi, Y.; Koide, M.; Uehara, S.; Okamoto, M.; Ishihara, A.; Kayama, T.; Saito, M.; Marumo, K. The Regulation of Bone Metabolism and Disorders by Wnt Signaling. Int. J. Mol. Sci. 2019, 20, 5525. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Khosla, S.; Westendorf, J.J.; Oursler, M.J. Building bone to reverse osteoporosis and repair fractures. J. Clin. Investig. 2008, 118, 421–428. [Google Scholar] [CrossRef] [Green Version]
- Hendrickx, G.; Boudin, E.; Fijałkowski, I.; Nielsen, T.L.; Andersen, M.; Brixen, K.; Van Hul, W. Variation in the Kozak sequence of WNT16 results in an increased translation and is associated with osteoporosis related parameters. Bone 2014, 59, 57–65. [Google Scholar] [CrossRef]
- Zheng, H.F.; Tobias, J.H.; Duncan, E.; Evans, D.M.; Eriksson, J.; Paternoster, L.; Yerges-Armstrong, L.M.; Lehtimäki, T.; Bergström, U.; Kähönen, M.; et al. WNT16 influences bone mineral density, cortical bone thickness, bone strength, and osteoporotic fracture risk. PLoS Genet. 2012, 8, e1002745. [Google Scholar] [CrossRef] [Green Version]
- Baron, R.; Kneissel, M. WNT signaling in bone homeostasis and disease: From human mutations to treatments. Nat. Med. 2013, 19, 179–192. [Google Scholar] [CrossRef]
- García-Ibarbia, C.; Pérez-Núñez, M.I.; Olmos, J.M.; Valero, C.; Pérez-Aguilar, M.D.; Hernández, J.L.; Zarrabeitia, M.T.; González-Macías, J.; Riancho, J.A. Missense polymorphisms of the WNT16 gene are associated with bone mass, hip geometry and fractures. Osteoporos. Int. 2013, 24, 2449–2454. [Google Scholar] [CrossRef] [PubMed]
- Cho, S.W.; Yang, J.-Y.; Sun, H.J.; Jung, J.Y.; Her, S.J.; Cho, H.Y.; Choi, H.J.; Kim, S.W.; Kim, S.Y.; Shin, C.S. Wnt inhibitory factor (WIF)-1 inhibits osteoblastic differentiation in mouse embryonic mesenchymal cells. Bone 2009, 44, 1069–1077. [Google Scholar] [CrossRef]
- Gopalsamy, A.; Shi, M.; Stauffer, B.; Bahat, R.; Billiard, J.; Ponce-de-Leon, H.; Seestaller-Wehr, L.; Fukayama, S.; Mangine, A.; Moran, R.; et al. Identification of Diarylsulfone Sulfonamides as Secreted Frizzled Related Protein-1 (sFRP-1) Inhibitors. J. Med. Chem. 2008, 51, 7670–7672. [Google Scholar] [CrossRef] [PubMed]
- Lewiecki, E.M. Role of sclerostin in bone and cartilage and its potential as a therapeutic target in bone diseases. Ther. Adv. Musculoskelet. Dis. 2014, 6, 48–57. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Movérare-Skrtic, S.; Henning, P.; Liu, X.; Nagano, K.; Saito, H.; Börjesson, A.E.; Sjögren, K.; Windahl, S.H.; Farman, H.; Kindlund, B.; et al. Osteoblast-derived WNT16 represses osteoclastogenesis and prevents cortical bone fragility fractures. Nat. Med. 2014, 20, 1279–1288. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Alam, I.; Alkhouli, M.; Gerard-O’Riley, R.L.; Wright, W.B.; Acton, D.; Gray, A.K.; Patel, B.; Reilly, A.M.; Lim, K.E.; Robling, A.G.; et al. Osteoblast-Specific Overexpression of Human WNT16 Increases Both Cortical and Trabecular Bone Mass and Structure in Mice. Endocrinology 2016, 157, 722–736. [Google Scholar] [CrossRef]
- Wergedal, J.E.; Kesavan, C.; Brommage, R.; Das, S.; Mohan, S. Role of WNT16 in the regulation of periosteal bone formation in female mice. Endocrinology 2015, 156, 1023–1032. [Google Scholar] [CrossRef] [Green Version]
- Li, D.; Cheng, S.; Zhang, W.; Wang, M.; Sun, C.; Zhang, C.; Wang, Y.; Jin, J.; Zhang, Y.; Li, B. Hedgehog-Gli1 signaling regelates differentiation of chicken (Gallus gallus) embryonic stem cells to male germ cells. Anim. Reprod. Sci. 2017, 182, 9–20. [Google Scholar] [CrossRef]
- Ma, R.S.; Zhou, Z.L.; Luo, J.W.; Zhang, H.; Hou, J.F. The Ihh signal is essential for regulating proliferation and hypertrophy of cultured chicken chondrocytes. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2013, 166, 117–122. [Google Scholar] [CrossRef] [PubMed]
- Wu, W.; Xiao, Z.; Chen, Y.; Deng, Y.; Zeng, D.; Liu, Y.; Huang, F.; Wang, J.; Liu, Y.; Bellanti, J.A.; et al. CD39 Produced from Human GMSCs Regulates the Balance of Osteoclasts and Osteoblasts through the Wnt/β-Catenin Pathway in Osteoporosis. Mol. Ther. 2020, 28, 1518–1532. [Google Scholar] [CrossRef]
- Sebastian, A.; Hum, N.R.; Morfin, C.; Murugesh, D.K.; Loots, G.G. Global gene expression analysis identifies Mef2c as a potential player in Wnt16-mediated transcriptional regulation. Gene 2018, 675, 312–321. [Google Scholar] [CrossRef]
- Cauley, J.A. Estrogen and bone health in men and women. Steroids 2015, 99 Pt A, 11–15. [Google Scholar] [CrossRef]
- Khosla, S.; Melton, L.J., 3rd; Riggs, B.L. The unitary model for estrogen deficiency and the pathogenesis of osteoporosis: Is a revision needed? J. Bone Miner. Res. 2011, 26, 441–451. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McGuffin, L.J.; Bryson, K.; Jones, D.T. The PSIPRED protein structure prediction server. Bioinformatics 2000, 16, 404–405. [Google Scholar] [CrossRef] [PubMed]
- Schwede, T.; Kopp, J.; Guex, N.; Peitsch, M.C. SWISS-MODEL: An automated protein homology-modeling server. Nucleic Acids Res. 2003, 31, 3381–3385. [Google Scholar] [CrossRef] [Green Version]
- Chen, H.; Ji, X.; Lee, W.C.; Shi, Y.; Li, B.; Abel, E.D.; Jiang, D.; Huang, W.; Long, F. Increased glycolysis mediates Wnt7b-induced bone formation. FASEB J. 2019, 33, 7810–7821. [Google Scholar] [CrossRef]
- Lee, W.C.; Guntur, A.R.; Long, F.; Rosen, C.J. Energy Metabolism of the Osteoblast: Implications for Osteoporosis. Endocr. Rev. 2017, 38, 255–266. [Google Scholar] [CrossRef] [PubMed]
- Chang, N.; Sun, C.; Gao, L.; Zhu, D.; Xu, X.; Zhu, X.; Xiong, J.W.; Xi, J.J. Genome editing with RNA-guided Cas9 nuclease in zebrafish embryos. Cell Res. 2013, 23, 465–472. [Google Scholar] [CrossRef] [Green Version]
- Huang, M.C.; Cheong, W.C.; Lim, L.S.; Li, M.H. A simple, high sensitivity mutation screening using Ampligase mediated T7 endonuclease I and Surveyor nuclease with microfluidic capillary electrophoresis. Electrophoresis 2012, 33, 788–796. [Google Scholar] [CrossRef] [PubMed]
- Jiang, M.; Fu, X.; Yang, H.; Long, F.; Chen, J. mTORC1 Signaling Promotes Limb Bud Cell Growth and Chondrogenesis. J. Cell Biochem. 2017, 118, 748–753. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Oh, C.D.; Kim, S.J.; Ju, J.W.; Song, W.K.; Kim, J.H.; Yoo, Y.J.; Chun, J.S. Immunosuppressant rapamycin inhibits protein kinase C alpha and p38 mitogen-activated protein kinase leading to the inhibition of chondrogenesis. Eur. J. Pharmacol. 2001, 427, 175–185. [Google Scholar] [CrossRef]
- Phornphutkul, C.; Wu, K.Y.; Auyeung, V.; Chen, Q.; Gruppuso, P.A. mTOR signaling contributes to chondrocyte differentiation. Dev. Dyn. 2008, 237, 702–712. [Google Scholar] [CrossRef] [Green Version]
- Karner, C.M.; Esen, E.; Okunade, A.L.; Patterson, B.W.; Long, F. Increased glutamine catabolism mediates bone anabolism in response to WNT signaling. J. Clin. Investig. 2015, 125, 551–562. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Karner, C.M.; Lee, S.Y.; Long, F. Bmp Induces Osteoblast Differentiation through both Smad4 and mTORC1 Signaling. Mol. Cell Biol. 2017, 37. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Esen, E.; Chen, J.; Karner, C.M.; Okunade, A.L.; Patterson, B.W.; Long, F. WNT-LRP5 signaling induces Warburg effect through mTORC2 activation during osteoblast differentiation. Cell Metab. 2013, 17, 745–755. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ambrogini, E.; Almeida, M.; Martin-Millan, M.; Paik, J.H.; Depinho, R.A.; Han, L.; Goellner, J.; Weinstein, R.S.; Jilka, R.L.; O’Brien, C.A.; et al. FoxO-mediated defense against oxidative stress in osteoblasts is indispensable for skeletal homeostasis in mice. Cell Metab. 2010, 11, 136–146. [Google Scholar] [CrossRef] [Green Version]
- Rached, M.T.; Kode, A.; Xu, L.; Yoshikawa, Y.; Paik, J.H.; Depinho, R.A.; Kousteni, S. FoxO1 is a positive regulator of bone formation by favoring protein synthesis and resistance to oxidative stress in osteoblasts. Cell Metab. 2010, 11, 147–160. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Iyer, S.; Ambrogini, E.; Bartell, S.M.; Han, L.; Roberson, P.K.; de Cabo, R.; Jilka, R.L.; Weinstein, R.S.; O’Brien, C.A.; Manolagas, S.C.; et al. FOXOs attenuate bone formation by suppressing Wnt signaling. J. Clin. Investig. 2013, 123, 3409–3419. [Google Scholar] [CrossRef] [PubMed]
- Ferron, M.; Wei, J.; Yoshizawa, T.; Del Fattore, A.; DePinho, R.A.; Teti, A.; Ducy, P.; Karsenty, G. Insulin signaling in osteoblasts integrates bone remodeling and energy metabolism. Cell 2010, 142, 296–308. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gerber, H.P.; Vu, T.H.; Ryan, A.M.; Kowalski, J.; Werb, Z.; Ferrara, N. VEGF couples hypertrophic cartilage remodeling, ossification and angiogenesis during endochondral bone formation. Nat. Med. 1999, 5, 623–628. [Google Scholar] [CrossRef]
- Yao, Z.; Lafage-Proust, M.H.; Plouët, J.; Bloomfield, S.; Alexandre, C.; Vico, L. Increase of both angiogenesis and bone mass in response to exercise depends on VEGF. J. Bone Miner. Res. 2004, 19, 1471–1480. [Google Scholar] [CrossRef]
- Zhao, H.; Sun, Z.; Ma, Y.; Song, R.; Yuan, Y.; Bian, J.; Gu, J.; Liu, Z. Antiosteoclastic bone resorption activity of osteoprotegerin via enhanced AKT/mTOR/ULK1-mediated autophagic pathway. J. Cell. Physiol. 2020, 235, 3002–3012. [Google Scholar] [CrossRef]
- Kawamura, N.; Kugimiya, F.; Oshima, Y.; Ohba, S.; Ikeda, T.; Saito, T.; Shinoda, Y.; Kawasaki, Y.; Ogata, N.; Hoshi, K.; et al. Akt1 in osteoblasts and osteoclasts controls bone remodeling. PLoS ONE 2007, 2, e1058. [Google Scholar] [CrossRef] [Green Version]
- Kim, H.N.; Iyer, S.; Ring, R.; Almeida, M. The Role of FoxOs in Bone Health and Disease. Curr. Top. Dev. Biol. 2018, 127, 149–163. [Google Scholar] [CrossRef] [PubMed]
- Clarkin, C.E.; Gerstenfeld, L.C. VEGF and bone cell signalling: An essential vessel for communication? Cell Biochem. Funct. 2013, 31, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Keramaris, N.C.; Calori, G.M.; Nikolaou, V.S.; Schemitsch, E.H.; Giannoudis, P.V. Fracture vascularity and bone healing: A systematic review of the role of VEGF. Injury 2008, 39 (Suppl. S2), S45–S57. [Google Scholar] [CrossRef]
- Medina-Gomez, C.; Kemp, J.P.; Estrada, K.; Eriksson, J.; Liu, J.; Reppe, S.; Evans, D.M.; Heppe, D.H.M.; Vandenput, L.; Herrera, L.; et al. Meta-Analysis of Genome-Wide Scans for Total Body BMD in Children and Adults Reveals Allelic Heterogeneity and Age-Specific Effects at the WNT16 Locus. PLoS Genet. 2012, 8, e1002718. [Google Scholar] [CrossRef] [Green Version]
- Alam, I.; Reilly, A.M.; Alkhouli, M.; Gerard-O’Riley, R.L.; Kasipathi, C.; Oakes, D.K.; Wright, W.B.; Acton, D.; McQueen, A.K.; Patel, B.; et al. Bone Mass and Strength are Significantly Improved in Mice Overexpressing Human WNT16 in Osteocytes. Calcif. Tissue Int. 2017, 100, 361–373. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hamilton, J.L.; Nagao, M.; Levine, B.R.; Chen, D.; Olsen, B.R.; Im, H.-J. Targeting VEGF and Its Receptors for the Treatment of Osteoarthritis and Associated Pain. J. Bone Miner. Res. 2016, 31, 911–924. [Google Scholar] [CrossRef]
- Irelli, A.; Sirufo, M.M.; Scipioni, T.; De Pietro, F.; Pancotti, A.; Ginaldi, L.; De Martinis, M. mTOR Links Tumor Immunity and Bone Metabolism: What are the Clinical Implications? Int. J. Mol. Sci. 2019, 20, 5841. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Westerfield, M. The Zebrafish Book: A Guide for the Laboratory Use of Zebrafish (Brachydanio rerio); University of Oregon Press: Eugene, OR, USA, 1995. [Google Scholar]
- Jowett, T.; Yan, Y.L. Double fluorescent in situ hybridization to zebrafish embryos. Trends Genet. 1996, 12, 387–389. [Google Scholar] [CrossRef]
- Hasumura, T.; Shimada, Y.; Kuroyanagi, J.; Nishimura, Y.; Meguro, S.; Takema, Y.; Tanaka, T. Green tea extract suppresses adiposity and affects the expression of lipid metabolism genes in diet-induced obese zebrafish. Nutr. Metab. 2012, 9, 73. [Google Scholar] [CrossRef] [Green Version]
- Tian, J.; Xue, J.; Dai, Y.; Chen, J.; Zheng, J. A novel software platform for medical image processing and analyzing. IEEE Trans. Inf. Technol. Biomed. 2008, 12, 800–812. [Google Scholar] [CrossRef] [PubMed]
- Pertea, M.; Kim, D.; Pertea, G.M.; Leek, J.T.; Salzberg, S.L. Transcript-level expression analysis of RNA-seq experiments with HISAT, StringTie and Ballgown. Nat. Protoc. 2016, 11, 1650–1667. [Google Scholar] [CrossRef] [PubMed]
- Huang, D.W.; Sherman, B.T.; Lempicki, R.A. Bioinformatics enrichment tools: Paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Res. 2009, 37, 1–13. [Google Scholar] [CrossRef] [Green Version]
- Huang, D.W.; Sherman, B.T.; Lempicki, R.A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 2009, 4, 44–57. [Google Scholar] [CrossRef]
- Szklarczyk, D.; Morris, J.H.; Cook, H.; Kuhn, M.; Wyder, S.; Simonovic, M.; Santos, A.; Doncheva, N.T.; Roth, A.; Bork, P.; et al. The STRING database in 2017: Quality-controlled protein-protein association networks, made broadly accessible. Nucleic Acids Res. 2017, 45, D362–D368. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Signaling Pathway | Genes |
---|---|
GO: | |
Blood vessel development | ptena, twsg1b, vegfaa, stab2 |
Vasculogenesis | ell, sulf1, vegfaa |
KEGG: | |
mTOR signaling pathway | pik3r3b, akt1, rps6ka3a, ptena, ulk1b |
FoxO signaling pathway | pik3r3b, prkab1a, akt1, prkab1b, ptena, bnip4 |
VEGF signaling pathway | pik3r3b, akt1, vegfaa, pla2g4f.2 |
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
wnt16 | TCCTCACCACGGGTCGAG | CACCGAGGGCTGGCATTG |
β-actin | ACGAACGACCAACCTAAACTCT | TTAGACAACTACCTCCCTTTGC |
akt1 | GGTCCTGATGATGCGAAAGA | CTTGAACGGAGGAACCAACT |
ptena | GTTGCCCTCCTCTTCCATAAA | GGATTCACCTCACTCCTGTTT |
vegfaa | TGTAAAGGCTGCCCACATAC | TGCTCGATCTCATCGGGATA |
prkab1a | CAGTCCCGAAGATGCTGATATT | AACACAGTGGGTCGATCTAAAG |
prkab1b | GACAAGATCAGGAGTCGGATAG | GAAGGAGCCAGACAAGTAGAT |
bnip4 | CTCGTGGGTAGAGCTTCATTT | CTGCTACAGTGAGAGCTTGTT |
twsg1b | CTCGTGCTGTAAGGAGTGTATG | AACAGATCCTCCACCGTACT |
pla2g4f.2 | GTAACCTCACACCTGGACAAA | AGCTCACAGTCATCTCAAACTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Qu, X.; Liao, M.; Liu, W.; Cai, Y.; Yi, Q.; Long, J.; Tan, L.; Deng, Y.; Deng, H.; Chen, X. Loss of Wnt16 Leads to Skeletal Deformities and Downregulation of Bone Developmental Pathway in Zebrafish. Int. J. Mol. Sci. 2021, 22, 6673. https://doi.org/10.3390/ijms22136673
Qu X, Liao M, Liu W, Cai Y, Yi Q, Long J, Tan L, Deng Y, Deng H, Chen X. Loss of Wnt16 Leads to Skeletal Deformities and Downregulation of Bone Developmental Pathway in Zebrafish. International Journal of Molecular Sciences. 2021; 22(13):6673. https://doi.org/10.3390/ijms22136673
Chicago/Turabian StyleQu, Xiaochao, Mei Liao, Weiwei Liu, Yisheng Cai, Qiaorong Yi, Jianmei Long, Lijun Tan, Yun Deng, Hongwen Deng, and Xiangding Chen. 2021. "Loss of Wnt16 Leads to Skeletal Deformities and Downregulation of Bone Developmental Pathway in Zebrafish" International Journal of Molecular Sciences 22, no. 13: 6673. https://doi.org/10.3390/ijms22136673