Application of a New Engineered Strain of Yarrowia lipolytica for Effective Production of Calcium Ketoglutarate Dietary Supplements
Abstract
:1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Microorganism
4.2. General Genetic Techniques and Plasmid Construction
4.3. Media and Culture Conditions
4.4. Comparison of Carbon Source Assimilation
4.5. Precipitation of CaKGA
4.6. Fixed Preparation Containing Yeast Biomass and CaKGA
4.7. Analytical Methods
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- De Bandt, J.P.; Coudray-Lucas, C.; Lioret, N.; Lim, S.K.; Saizy, R.; Giboudeau, J.; Cynober, L. A randomized controlled trial of the influence of the mode of enteral ornithine α-ketoglutarate administration in burn patients. J. Nutr. 1998, 128, 563–569. [Google Scholar] [CrossRef]
- Filip, R.; Pierzynowski, S.G. The role of glutamine and α-ketoglutarate in gut metabolism and the potential application in medicine and nutrition. J. Clin. Res. 2007, 1, 9–15. [Google Scholar]
- Zdzisińska, B.; Żurek, A.; Kandefer-Szerszeń, M. Alpha-ketoglutarate as a molecule with pleiotropic activity: Well-known and novel possibilities of therapeutic use. Arch. Immunol. Ther. Exp. 2017, 65, 21–36. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shahmirzadi, A.A.; Edgar, D.; Liao, C.Y.; Hsu, Y.M.; Lucanic, M.; Shahmirzadi, A.A.; Wiley, C.D.; Gan, G.; Kim, D.E.; Kasler, H.G.; et al. Alpha-ketoglutarate, an endogenous metabolite, extends lifespan and compresses morbidity in aging mice. Cell Metab. 2020, 32, 447–456. [Google Scholar] [CrossRef] [PubMed]
- Kowalik, S.; Śliwa, E.; Tatara, M.R.; Krupski, W.; Majcher, P.; Studziński, T. Influence of alpha-ketoglutarate on mineral density and geometrical and mechanical parameters of femora during postnatal life in piglets. Bull. Vet. Inst. Pulawy 2005, 49, 107–111. [Google Scholar]
- Welborn, J.R.; Shpun, S.; Dantzler, W.H.; Wright, S.H. Effect of alpha-ketoglutarate on organic anion transport in single rabbit renal proximal tubules. Am. J. Physiol. Ren. Physiol. 1998, 274, 165–174. [Google Scholar] [CrossRef]
- Velvizhi, S.; Dakshayani, K.B.; Subramanian, P. Effects of alpha-ketoglutarate on antioxidants and lipid peroxidation products in rats treated with ammonium acetate. Nutrition 2002, 18, 747–750. [Google Scholar] [CrossRef]
- Cynober, L.A. The use of alpha-ketoglutarate salts in clinical nutrition and metabolic care. Curr. Opin. Clin. Nutr. Metab. Care 1999, 2, 33–37. [Google Scholar] [CrossRef]
- Wernerman, J.; Hammarqvist, F.; Vinnars, E. Alpha-ketoglutarate and postoperative muscle catabolism. Lancet 1990, 335, 701–703. [Google Scholar] [CrossRef]
- Riedel, E.; Nündel, M.; Hampl, H. Alpha-ketoglutarate application in hemodialysis patients improves amino acid metabolism. Nephron 1996, 74, 261–265. [Google Scholar] [CrossRef]
- Filip, R.S.; Pierzynowski, S.G.; Lindegard, B.; Wernerman, J.; Haratym-Maj, A.; Podgurniak, M. Alpha-ketoglutarate decreases serum levels of C-terminal cross-linking telopeptide of type I collagen (CTX) in postmenopausal women with osteopenia: Six-month study. Int. J. Vitam. Nutr. Res. 2007, 77, 89–97. [Google Scholar] [CrossRef]
- Zimmermann, E.; Wassmer, S.; Steudle, V. Long-term treatment with calcium-alpha-ketoglutarate corrects secondary hyperparathyroidism. Miner. Electrol. Metab. 1996, 22, 196–199. [Google Scholar]
- Legendre, F.; MacLean, A.; Appanna, V.P.; Appanna, V.D. Biochemical pathways to α-ketoglutarate, a multi-faceted metabolite. World J. Microbiol. Biotechnol. 2020, 36, 123. [Google Scholar] [CrossRef] [PubMed]
- Otto, C.; Yovkova, V.; Barth, G. Overproduction and secretion of α-ketoglutaric acid by microorganisms. Appl. Microbiol. Biotechnol. 2011, 92, 689–695. [Google Scholar] [CrossRef] [PubMed]
- Szczygiełda, M.; Prochaska, K. Effective separation of bio-based alpha-ketoglutaric acid from post-fermentation broth using bipolar membrane electrodialysis (EDBM) and fouling analysis. Biochem. Eng. J. 2021, 166, 107883. [Google Scholar] [CrossRef]
- Zeng, W.; Zhang, H.; Xu, S.; Fang, F.; Zhou, J. Biosynthesis of keto acids by fed-batch culture of Yarrowia lipolytica WSH-Z06. Bioresource Technol. 2017, 243, 1037–1043. [Google Scholar] [CrossRef] [PubMed]
- Beer, B.; Pick, A.; Sieber, V. In vitro metabolic engineering for the production of α-ketoglutarate. Metab. Eng. 2017, 40, 5–13. [Google Scholar] [CrossRef]
- Chen, X.; Dong, X.; Liu, J.; Luo, Q.; Liu, L. Pathway engineering of Escherichia coli for α-ketoglutaric acid production. Biotechnol. Bioeng. 2020, 117, 2791–2801. [Google Scholar] [CrossRef]
- Kamzolova, S.V.; Morgunov, I.G. Optimization of medium composition and fermentation conditions for α-ketoglutaric acid production from biodiesel waste by Yarrowia lipolytica. Appl. Microbiol. Biot. 2020, 104, 7979–7989. [Google Scholar] [CrossRef]
- Peterson, C.L.; Hustrulid, T. Carbon cycle for rapeseed oil biodiesel fuels. Biomass Bioenergy 1998, 14, 91–101. [Google Scholar] [CrossRef]
- FAO/WHO. Protein Quality Evaluation: Report of the Joint FAO/WHO Expert Consultation. FAO Food Nutr. 1991, 51, 1–66. [Google Scholar]
- Kamzolova, S.V.; Chiglintseva, M.N.; Lunina, J.N.; Morgunow, I.G. α-Ketoglutaric acid production by Yarrowia lipolytica and its regulation. Appl. Microbiol. Biotechnol. 2012, 96, 783–791. [Google Scholar] [CrossRef]
- Rywińska, A.; Tomaszewska-Hetman, L.; Rakicka-Pustułka, M.; Juszczyk, P.; Rymowicz, W. Alpha-ketoglutaric acid production from a mixture of glycerol and rapeseed oil by Yarrowia lipolytica using different substrate feeding strategies. Sustainability 2020, 12, 6109. [Google Scholar] [CrossRef]
- Mirończuk, A.M.; Rzechonek, D.A.; Biegalska, A.; Rakicka, M.; Dobrowolski, A. A novel strain of Yarrowia lipolytica as a platform for value-added product synthesis from glycerol. Biotechnol. Biofuels 2016, 9, 180. [Google Scholar] [CrossRef] [Green Version]
- Pignède, G.; Wang, H.; Fudalej, F.; Gaillardin, C.; Seman, M.; Nicaud, J.M. Characterization of an extracellular lipase encoded by LIP2 in Yarrowia lipolytica. J. Bacteriol. 2000, 182, 2802–2810. [Google Scholar] [CrossRef] [Green Version]
- Hapeta, P.; Rakicka-Pustułka, M.; Juszczyk, P.; Robak, M.; Rymowicz, W.; Lazar, Z. Overexpression of citrate synthase increases isocitric acid biosynthesis in the yeast Yarrowia lipolytica. Sustainability 2020, 12, 7364. [Google Scholar] [CrossRef]
- Chernyavskaya, O.G.; Shishkanova, N.V.; Il’chenko, A.P.; Finogenova, T.V. Synthesis of alpha-ketoglutaric acid by Yarrowia lipolytica yeast grown on ethanol. Appl. Microbiol. Biotechnol. 2000, 53, 152–158. [Google Scholar] [CrossRef]
- Papanikolaou, S.; Aggelis, G. Modelling aspects of the biotechnological valorization of raw glycerol: Production of citric acid by Yarrowia lipolytica and 1,3-propanediol by Clostridium butyricum. J. Chem. Technol. Biotechnol. 2003, 78, 542–547. [Google Scholar] [CrossRef]
- Papanikolaou, S.; Fakas, S.; Fick, M.; Chevalot, I.; Galiotou-Panayotou, M.; Komaitis, M.; Marc, I.; Aggelis, G. Biotechnological valorisation of raw glycerol discharged after bio-diesel (fatty acid methyl esters) manufacturing process: Production of 1,3-propanediol, citric acid and single cell oil. Biomass Bioenergy 2008, 32, 60–71. [Google Scholar] [CrossRef]
- Zeng, W.; Fang, F.; Liu, S.; Du, G.; Chen, J.; Zhou, J. Comparative genomics analysis of a series of Yarrowia lipolytica WSH-Z06 mutants with varied capacity for α-ketoglutarate production. J. Biotechnol. 2016, 239, 76–82. [Google Scholar] [CrossRef]
- Otto, C.; Yovkova, V.; Aurich, A.; Mauersberger, S.; Barth, G. Variation of the by-product spectrum during α-ketoglutaric acid production from raw glycerol by overexpression of fumarase and pyruvate car-boxylase genes in Yarrowia lipolytica. Appl. Microbiol. Biotechnol. 2012, 95, 905–917. [Google Scholar] [CrossRef]
- Yovkova, V.; Otto, C.; Aurich, A.; Mauersberger, S.; Barth, G. Engineering the α-ketoglutarate over production from raw glycerol by overexpression of the genes encoding NADP+-dependent isocitrate dehydrogenase and pyruvate carboxylase in Yarrowia lipolytica. Appl. Microbiol. Biotechnol. 2014, 98, 2003–2013. [Google Scholar] [CrossRef]
- Zhou, J.; Yin, X.; Madzak, C.; Du, G.; Chen, J. Enhanced α-ketoglutarate production in Yarrowia lipolytica WSH-Z06 by alteration of the acetyl-CoA metabolism. J. Biotechnol. 2012, 161, 257–264. [Google Scholar] [CrossRef] [PubMed]
- Holz, M.; Otto, C.; Kretzschmar, A.; Yovkova, V.; Aurich, A.; Pötter, M.; Marx, A.; Barth, G. Overexpression of alpha-ketoglutarate dehydrogenase in Yarrowia lipolytica and its effect on production of organic acids. Appl. Microbiol. Biotechnol. 2011, 89, 1519–1526. [Google Scholar] [CrossRef] [PubMed]
- Guo, H.; Liu, P.; Madzak, C.; Du, G.; Zhou, J.; Chen, J. Identification and application of keto acids transporters in Yarrowia lipolytica. Sci. Rep. 2015, 5, 8138. [Google Scholar] [CrossRef] [Green Version]
- Carsanba, E.; Papanikolaou, S.; Fickers, P.; Erten, H. Screening various Yarrowia lipolytica strains for citric acid production. Yeast 2019, 36, 319–327. [Google Scholar] [CrossRef]
- Kuttiraja, M.; Douha, A.; Valéro, J.R.; Tyagi, R.D. Elucidating the Effect of glycerol concentration and C/N ratio on lipid production using Yarrowia lipolytica SKY7. Appl. Biochem. Biotechnol. 2016, 180, 1586–1600. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Yu, X.; Lv, J.; Xu, J.; Xia, J.; Wu, Z.; Zhang, T.; Deng, Y. A cost-effective process for the coproduction of erythritol and lipase with Yarrowia lipolytica M53 from waste cooking oil. Food Bioprod. Process. 2017, 103, 86–94. [Google Scholar] [CrossRef]
- Rywińska, A.; Marcinkiewicz, M.; Cibis, E.; Rymowicz, W. Optimization of medium composition for erythritol production from glycerol by Yarrowia lipolytica using response surface methodology. Prep. Biochem. Biotech. 2015, 45, 515–529. [Google Scholar] [CrossRef]
- Drzymała, K.; Mirończuk, A.M.; Pietrzak, W.; Dobrowolski, A. Rye and oat agricultural wastes as substratec for biomass production of the non-conventional yeast Yarrowia lipolytica. Sustainability 2020, 12, 7704. [Google Scholar] [CrossRef]
- Juszczyk, P.; Tomaszewska, L.; Kita, A.; Rymowicz, W. Biomass production by novel strains of Yarrowia lipolytica using raw glycerol, derived from biodiesel production. Bioresource Technol. 2013, 137, 124–131. [Google Scholar] [CrossRef]
- Michalik, B.; Biel, W.; Lubowicki, R.; Jacyno, E. Chemical composition and biological value of proteins of the yeast Yarrowia lipolytica growing on industrial glycerol. Can. J. Anim. Sci. 2014, 94, 99–104. [Google Scholar] [CrossRef] [Green Version]
- Yan, J.; Han, B.; Gui, X.; Wang, G.; Xu, L.; Yan, Y.; Madzak, C.; Pan, D.; Wang, Y.; Zha, G.; et al. Engineering Yarrowia lipolytica to simultaneously produce lipase and single cell protein from agro-industrial wastes for feed. Sci. Rep. 2018, 8, 758. [Google Scholar] [CrossRef] [Green Version]
- Cybulski, K.; Tomaszewska-Hetman, L.; Rakicka, M.; Łaba, W.; Rymowicz, W.; Rywińska, A. The bioconversion of waste products from rapeseed processing into keto acids by Yarrowia lipolytica. Ind. Crop. Prod. 2018, 119, 102–110. [Google Scholar] [CrossRef]
- Kamzolova, S.V.; Morgunov, I.G. α-Ketoglutaric acid production from rapeseed oil by Yarrowia lipolytica yeast. Appl. Microbiol. Biot. 2013, 97, 5517–5525. [Google Scholar] [CrossRef]
- Patsios, S.I.; Dedousi, A.; Sossidou, E.Ν.; Zdragas, A. Sustainable animal feed protein through the cultivation of Yarrowia lipolytica on agro-industrial wastes and by-products. Sustainability 2020, 12, 1398. [Google Scholar] [CrossRef] [Green Version]
- Tabe, L.; Higgins, T.J.V. Engineering plant protein composition for improved nutrition. Trends Plant Sci. 1998, 3, 282–286. [Google Scholar] [CrossRef]
- Shewry, P.R. Improving the protein content and composition of cereal grain. J. Cereal Sci. 2007, 46, 239–250. [Google Scholar] [CrossRef]
- Sarris, D.; Rapti, A.; Papafotis, N.; Koutinas, A.A.; Papanikolaou, S. Production of added-value chemical compounds through bioconversions of olive-mill wastewaters blended with crude glycerol by a Yarrowia lipolytica Strain. Molecules 2019, 24, 222. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bellou, S.; Triantaphyllidou, I.E.; Mizerakis, P.; Aggelis, G. High lipid accumulation in Yarrowia lipolytica cultivated under double limitation of nitrogen and magnesium. J. Biotechnol. 2016, 234, 116–126. [Google Scholar] [CrossRef]
- Darvishi, F.; Salmani, N.; Hosseini, B. Biovalorization of vegetable oil refinery wastewater into value-added compounds by Yarrowia lipolytica. J. Chem. Technol. Biotechnol. 2019, 94, 2961–2968. [Google Scholar] [CrossRef]
- Lopes, M.; Miranda, S.M.; Alves, J.M.; Pereira, A.S.; Belo, I. Waste cooking oils asf for lipase and lipid-rich biomass production. Eur. J. Lipid Sci. Technol. 2019, 121. [Google Scholar] [CrossRef] [Green Version]
- Berge, G.M.; Hatlen, B.; Odom, J.M.; Ruyter, B. Physical treatment of high EPA Yarrowia lipolytica biomass increases the availability of n-3 highly unsaturated fatty acids when fed to Atlantic salmon. Aquac. Nutr. 2013, 19, 110–121. [Google Scholar] [CrossRef]
- Hatlen, B.; Berge, G.M.; Odom, J.M.; Mundheim, H.; Ruyter, B. Growth performance, feed utilisation and fatty acid deposition in Atlantic salmon, Salmo salar L., fed graded levels of high-lipid/high-EPA Yarrowia lipolytica biomass. Aquaculture 2012, 364, 39–47. [Google Scholar] [CrossRef]
- Madzak, C. Yarrowia lipolytica strains and their biotechnological applications: How natural biodiversity and metabolic engineering could contribute to cell factories improvement. Preprints 2021, 7, 548. [Google Scholar] [CrossRef]
- Zhang, G. Preparation Method of Calcium Alpha-Ketoglutarate. Patent CN102976927A, 2012. [Google Scholar]
- Pereira, D.; Deo, K. Process of Making Calcium Alpha-Ketoglutarate. Patent WO2020068705A1, 2019. [Google Scholar]
- Kuhlmann, R. Calcium Carbonate—A versatile mineral. In Calcium Carbonate, 1st ed.; Tegethoff, F.W., Rohleder, J., Kroker, E., Eds.; Birkhäuser Verlag: Basel, Switzerland, 2001; pp. 275–311. [Google Scholar] [CrossRef] [Green Version]
- Vyayzenen, G.; Marinets, V.; Marinets, R.; Vyayzenen, A.; Barashkov, A. Fattening calves using vegetable waste and sunflower. IOP Conf. Ser. Earth Environ. Sci. 2019, 341, 012093. [Google Scholar] [CrossRef] [Green Version]
- Singh, N.; Singh, P.N.; Hershman, J.M. Effect of calcium carbonate on the absorption of levothyroxine. JAMA 2000, 283, 2822–2825. [Google Scholar] [CrossRef] [Green Version]
- EFSA Panel on Nutrition; Novel Foods and Food Allergens (NDA); Turck, D.; Castenmiller, J.; de Henauw, S.; Hirsch-Ernst, K.I.; Kearney, J.; Maciuk, A.; Mangelsdorf, I.; McArdle, H.J.; et al. Safety of Yarrowia lipolytica yeast biomass as a novel food pursuant to Regulation (EU) 2015/2283. EFSA J. 2019, 17, 5594. [Google Scholar] [CrossRef]
- Walczak, K.; Wnorowski, A.; Turski, W.A.; Plech, T. Kynurenic acid and cancer: Facts and controversies. Cell. Mol. Life Sci. 2020, 77, 1531–1550. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Turski, M.P.; Turska, M.; Zgrajka, W.; Kuc, D.; Turski, W.A. Presence of kynurenic acid in food and honeybee products. Amino Acids 2009, 36, 75–80. [Google Scholar] [CrossRef]
- Turski, M.P.; Chwil, S.; Turska, M.; Chwil, M.; Kocki, T.; Rajtar, T.; Parada-Turska, J. An exceptionally high content of kynurenic acid in chestnut honey and flowers of chestnut tree. J. Food Compos. Anal. 2016, 48, 67–72. [Google Scholar] [CrossRef]
- Wróbel-Kwiatkowska, M.; Turski, W.; Juszczyk, P.; Kita, A.; Rymowicz, W. Improved production of kynurenic acid by Yarrowia lipolytica in media containing different honeys. Sustainability 2020, 12, 9424. [Google Scholar] [CrossRef]
- Sambrook, J.; Russell, D.W. Molecular Cloning: A Laboratory Manual, 3rd ed.; Cold Spring Harbor Laboratory Press: New York, NY, USA, 2001. [Google Scholar]
- Querol, A.; Barrio, E.; Huerta, T.; Ramon, D. Molecular monitoring of wine fermentations conducted by active dry yeast strains. Appl. Environ. Microbiol. 1992, 58, 2948–2953. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dear, S.; Staden, R. A sequence assembly and editing program for efficient management of large projects. Nucleic Acids Res. 1991, 19, 3907–3911. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Beopoulos, A.; Mrozova, Z.; Thevenieau, F.; Dall, M.T.; Hapala, I.; Papanikolaou, S.; Chardot, T.; Nicaud, J.M. Control of lipid accumulation in the yeast Yarrowia lipolytica. Appl. Environ. Microbiol. 2008, 74, 7779–7789. [Google Scholar] [CrossRef] [Green Version]
- Dulermo, T.; Tréton, B.; Beopoulos, A.; Kabran Gnankon, A.P.; Haddouche, R.; Nicaud, J.M. Characterization of the two intracellular lipases of Y. lipolytica encoded by TGL3 and TGL4 genes: New insights into the role of intracellular lipases and lipid body organization. Biochim. Biophys. Acta 2013, 1831, 1486–1495. [Google Scholar] [CrossRef]
- Fickers, P.; Le Dall, M.T.; Gaillardin, C.; Thonart, P.; Nicaud, J.M. New disruption cassettes for rapid gene disruption and marker rescue in the yeast Yarrowia lipolytica. J. Microbiol. Methods 2003, 55, 727–737. [Google Scholar] [CrossRef] [PubMed]
- Xuan, J.W.; Fournier, P.; Declerck, N.; Chasles, M.; Gaillardin, C. Overlapping reading frames at the LYS5 locus in the yeast Yarrowia lipolytica. Mol. Cell. Biol. 1990, 10, 4795–4806. [Google Scholar] [CrossRef] [Green Version]
- Mauersberger, S.; Wang, H.J.; Gaillardin, C.; Barth, G.; Nicaud, J.M. Insertional mutagenesis in the n-alkane-assimilating yeast Yarrowia lipolytica: Generation of tagged mutations in genes involved in hydrophobic substrate utilization. J. Bacteriol. 2001, 183, 5102–5109. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Carbon Source | Glycerol | Rapeseed Oil | ||||
---|---|---|---|---|---|---|
Parameter/Strain | X [g/L] | µmax [h−1] | QGLY [g/Lh] | qGLY [g/gh] | X [g/L] | µmax [h−1] |
Wratislavia 1.31 | 16.5 ± 1.4 | 0.25 | 0.74 | 0.044 | No growth | |
1.31.GUT1/6 | 8.0 ± 0.6 | 0.26 | 0.57 | 0.071 | 15.9 ± 1.1 | 0.54 |
1.31.GUT1/6.CIT1/3 | 10.0 ± 0.8 | 0.22 | 0.50 | 0.050 | 7.3 ± 0.4 | 0.25 |
1.31.GUT1/6.CIT1/3.E34672 | 13.9 ± 0.7 | 0.28 | 0.66 | 0.047 | 13.1 ± 1.0 | 0.28 |
NH4Cl [g/L] | KH2PO4 [g/L] | C:N:P Ratio | QKGA [g/Lh] | SKGA [%] | TPC [%] |
---|---|---|---|---|---|
2.6 | 2.0 | 87:1.5:1 | 0.18 | 37 | 12.7 ± 0.85 |
3.5 | 2.0 | 87:2:1 | 0.28 | 58 | 20.3 ± 1.84 |
5.2 | 2.0 | 87:3:1 | 0.34 | 78 | 24.1 ± 0.57 |
5.2 | 3.0 | 87:3:1.5 | 0.33 | 79 | 21.7 ± 2.69 |
5.2 | 4.0 | 87:3:2 | 0.34 | 85 | 25.1 ± 1.70 |
7.0 | 2.0 | 87:4:1 | 0.33 | 80 | 26.5 ± 2.40 |
9.0 | 2.0 | 87:5:1 | 0.35 | 96 | 29.9 ± 1.12 |
Y. lipolytica 1.31.GUT1/6.CIT1/3.E34672 | Whole Egg 1 | Adult Requirement 1 | |
---|---|---|---|
TPC [%] | 29.9 ± 1.12 | ||
Amino acid [g/100 g of protein] | |||
Histidine | 2.19 ± 0.13 | 2.2 | 1.6 |
Isoleucine | 7.45 ± 0.44 | 5.4 | 1.3 |
Leucine | 8.10 ± 0.43 | 8.6 | 1.9 |
Lysine | 7.84 ± 0.29 | 7.0 | 1.6 |
Methionine/Cysteine | 1.60 ± 0.03 | 5.7 | 1.7 |
Phenylalanine/Tyrosine | 7.00 ± 0.44 | 9.3 | 1.9 |
Threonine | 6.23 ± 0.21 | 4.7 | 0.9 |
Tryptophan | 0.69 ± 0.05 | 1.7 | 0.5 |
Valine | 5.86 ± 0.27 | 6.6 | 1.3 |
Nutritional values | |||
ΣEAA | 47.0 | 51.2 | 12.7 |
CS (Met + Cys) | 28.1 2/94.1 3 | ||
EAAI | 80.8 2/307.4 3 |
TCL [%] | 20.8 ± 0.49 |
---|---|
Fatty acids [% of TCL] | |
16:0 | 2.15 ± 0.32 |
16:1 | 0.99 ± 0.08 |
18:0 | 1.39 ± 0.08 |
18:1 | 71.6 ± 0.08 |
18:2 | 9.08 ± 0.08 |
18:3 | 6.97 ± 0.08 |
SFA | 3.54 |
MUFA | 72.59 |
PUFA | 16.05 |
Fixed CaKGA–Biomass Preparation | |
---|---|
CaKGA [%] | 60.5 ± 2.4 |
Yeast biomass content [%] | 22.2 ± 1.9 |
Viable cell content [cfu/1 g of the product] | not detected |
Kynurenic acid [μg/g] | 87.2 ± 4.3 |
Strain | Overexpressed Gene | Carbon Source | KGA [g/L] | PA [g/L] | QKGA [g/Lh] | YKGA [g/g] | Reference |
---|---|---|---|---|---|---|---|
H355 | parental strain | R-GLY | 133.0 | 1.9 | 1.51 | 0.47 | [31] |
H355A(FUM1) T1 | FUM1 | 134.1 | 0.4 | 1.51 | 0.47 | ||
H355A(PYC1) T3 | PYC1 | 126.9 | 2.3 | 1.31 | 0.42 | ||
H355A(FUM1-PYC1) T4 | FUM1-PYC1 | 138.0 | 2.3 | 1.51 | 0.52 | ||
H355 | parental strain | R-GLY | 156.9 | 8.0 | 1.47 | 0.30 | [32] |
H355A(IDP1) T1 | IDP1 | 167.6 | 8.0 | 1.58 | 0.35 | ||
H355A(PYC1-IDP1) T5 | PYC1-IDP1 | 186.0 | 8.0 | 1.75 | 0.36 | ||
Y. lipolytica-CON | parental strain | GLY | 42.4 | 35.1 | 0.29 | 0.42 | [33] |
Y. lipolytica-ACS1 | ACS1 | 52.6 | 25.4 | 0.37 | 0.53 | ||
Y. lipolytica-ACL | ACL | 56.5 | 20.2 | 0.39 | 0.57 | ||
H222 | parental strain | GLY | 97.0 | 52.0 | 0.90 | n.s. | [34] |
H222-MH1 | KGD1-KGD2-LPD1 | 72.0 | 66.0 | 0.70 | n.s. | ||
WSH-Z06 | parental strain | GLY | 36.6 | 17.8 | n.s. | n.s. | [35] |
T1 | YALI0B19470g (carboxylate transporter) | 46.7 | 12.3 | n.s. | n.s. | ||
T5 | YALI0D20108g (carboxylate transporter) | 44.0 | 23.5 | n.s. | n.s. | ||
1.31.GUT1/6.CIT1/3.E34672 | GUT1-CIT1-YALI0E34672g | GLY + O | 53.1 | 2.3 | 0.35 | 0.53 | this study |
Strain | Genotype |
---|---|
Wratislavia 1.31 | An acetate-negative mutant, uracil prototroph |
1.31.U- | Δura3, TEF-SUC2 |
1.31.GUT1/6 | TEF-GUT1 |
1.31.GUT1/6.CIT1/3 | TEF-GUT1, TEF-CIT1 |
1.31.GUT1/6.CIT1/3.E34672 | TEF-GUT1, TEF-CIT1, TEF-E34672g |
Primer | Restriction Enzyme Used | Sequence |
---|---|---|
GUT1-F | BclI | GAGATGATCAATGTCTTCCTACGTAGGAGCTCTCG |
GUT1-R | AvrII | GAGTCCTAGGTTACTCAAGCCAGCCAACAGCTC |
CIT1-F | BclI | CGCGTGATCAATGATCCCTCTTCGAACC |
CIT1-R | AvrII | GCGCCCTAGGTTATTTGGCGACCTTAATAATCTC |
E34672-F | BamHI | GAGAGGATCCATGGCTGCTGACGGAAAGAAG |
E34672-R | AvrII | GAGGCCTAGGTTACTCCTCAAACTGGGCAGCAAAAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tomaszewska-Hetman, L.; Rywińska, A.; Lazar, Z.; Juszczyk, P.; Rakicka-Pustułka, M.; Janek, T.; Kuźmińska-Bajor, M.; Rymowicz, W. Application of a New Engineered Strain of Yarrowia lipolytica for Effective Production of Calcium Ketoglutarate Dietary Supplements. Int. J. Mol. Sci. 2021, 22, 7577. https://doi.org/10.3390/ijms22147577
Tomaszewska-Hetman L, Rywińska A, Lazar Z, Juszczyk P, Rakicka-Pustułka M, Janek T, Kuźmińska-Bajor M, Rymowicz W. Application of a New Engineered Strain of Yarrowia lipolytica for Effective Production of Calcium Ketoglutarate Dietary Supplements. International Journal of Molecular Sciences. 2021; 22(14):7577. https://doi.org/10.3390/ijms22147577
Chicago/Turabian StyleTomaszewska-Hetman, Ludwika, Anita Rywińska, Zbigniew Lazar, Piotr Juszczyk, Magdalena Rakicka-Pustułka, Tomasz Janek, Marta Kuźmińska-Bajor, and Waldemar Rymowicz. 2021. "Application of a New Engineered Strain of Yarrowia lipolytica for Effective Production of Calcium Ketoglutarate Dietary Supplements" International Journal of Molecular Sciences 22, no. 14: 7577. https://doi.org/10.3390/ijms22147577